ID: 1176171362

View in Genome Browser
Species Human (GRCh38)
Location 20:63697779-63697801
Sequence CTGCCCGAGGGGAAGGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 299}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176171352_1176171362 16 Left 1176171352 20:63697740-63697762 CCCTGGGGAGCTCTGGGAAAGTG 0: 1
1: 0
2: 3
3: 29
4: 297
Right 1176171362 20:63697779-63697801 CTGCCCGAGGGGAAGGTGGCTGG 0: 1
1: 0
2: 3
3: 26
4: 299
1176171353_1176171362 15 Left 1176171353 20:63697741-63697763 CCTGGGGAGCTCTGGGAAAGTGG 0: 1
1: 0
2: 1
3: 26
4: 303
Right 1176171362 20:63697779-63697801 CTGCCCGAGGGGAAGGTGGCTGG 0: 1
1: 0
2: 3
3: 26
4: 299
1176171350_1176171362 20 Left 1176171350 20:63697736-63697758 CCTCCCCTGGGGAGCTCTGGGAA 0: 1
1: 0
2: 2
3: 40
4: 331
Right 1176171362 20:63697779-63697801 CTGCCCGAGGGGAAGGTGGCTGG 0: 1
1: 0
2: 3
3: 26
4: 299
1176171351_1176171362 17 Left 1176171351 20:63697739-63697761 CCCCTGGGGAGCTCTGGGAAAGT 0: 1
1: 0
2: 4
3: 40
4: 282
Right 1176171362 20:63697779-63697801 CTGCCCGAGGGGAAGGTGGCTGG 0: 1
1: 0
2: 3
3: 26
4: 299

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176171362 Original CRISPR CTGCCCGAGGGGAAGGTGGC TGG Intronic
900095933 1:940115-940137 CTGCCCTGGGGGACGGTGCCTGG - Intronic
900297685 1:1960156-1960178 CTCCCCGGGGTGAAGGCGGCTGG - Intronic
900415519 1:2532750-2532772 CTGCCGGAGGTGAGGGTGGTGGG + Intergenic
900528087 1:3138947-3138969 CTGGCCGAGGGGGAGGTGAGAGG - Intronic
900645157 1:3705691-3705713 ATGCCGGAGGGGCAGGAGGCAGG - Intronic
901208806 1:7512950-7512972 GTGCCAGAAGGGAAGATGGCAGG + Intronic
902564584 1:17302886-17302908 GTGGCAGAGGGGAAGGTTGCAGG + Intergenic
902770739 1:18644074-18644096 CTGGAAGAGGGGAAAGTGGCCGG - Intronic
903225976 1:21894454-21894476 CTGCCCCAAGGGCAGCTGGCAGG + Intronic
903788436 1:25876094-25876116 CTGCCCGAGGGGCGGGTTTCGGG - Intergenic
903879767 1:26500763-26500785 CGGCCCGTGGGGAAGGAGGCGGG + Intergenic
904252896 1:29237526-29237548 CCGCCCGAGGGGGCGGTGGCAGG + Intronic
904741939 1:32684200-32684222 CTGGCTGAGGGGATGGTGGGAGG - Exonic
904823110 1:33257758-33257780 CTGCTCGAGGGCAGGGTGGTGGG - Intronic
906114627 1:43348628-43348650 CTGCCCGAGAGAAACGTGCCAGG - Intronic
909433488 1:75615787-75615809 CGGCCCGAGGGGCAGAGGGCGGG + Intergenic
909568999 1:77086848-77086870 CTTCCTCAGGGGATGGTGGCTGG + Intergenic
912316892 1:108675481-108675503 CTCCCAGACGGGATGGTGGCCGG - Intergenic
912486663 1:110034697-110034719 CTGCCGGCGGCGGAGGTGGCGGG - Exonic
912520333 1:110240606-110240628 CTTCTCGAGGGGCAGCTGGCAGG - Intronic
912568365 1:110605156-110605178 CTGCATTGGGGGAAGGTGGCTGG + Intronic
912950318 1:114116262-114116284 CTGCCTCAGGGGAAGGAGGGAGG + Intronic
913481454 1:119293453-119293475 CTGCCCTGGGGGAAGATGACAGG - Intergenic
914908942 1:151769257-151769279 CTCCCGGAGGGGGCGGTGGCCGG + Intronic
915331700 1:155116736-155116758 ATGGGCGAGGGGAAGGTGACAGG - Intergenic
915914777 1:159934374-159934396 CTGGCCCAGGGGAAGGGAGCAGG + Intronic
917869448 1:179229140-179229162 CTGCCCGAGGGGTCGGAGGGTGG - Intronic
922239767 1:223748068-223748090 CAGATGGAGGGGAAGGTGGCAGG - Intronic
924416489 1:243861378-243861400 CTGTCCGGGGTGAAGGAGGCAGG - Intergenic
1062928331 10:1335150-1335172 CTGCCCCAGGCGCAGGTAGCTGG - Intronic
1064663409 10:17628870-17628892 CTCCCAGACGGGATGGTGGCCGG + Intergenic
1064839333 10:19573206-19573228 CTGCCCCAGGTCAAGGTGGTTGG + Intronic
1065263932 10:23955608-23955630 CTGCCCAATGGGAAGGCTGCGGG + Intronic
1067060485 10:43075770-43075792 CTTGCTGAGGGGCAGGTGGCCGG - Intergenic
1072691064 10:97572649-97572671 CTGCCCGAGGTGAAGGTGACAGG + Exonic
1074080629 10:110165694-110165716 CTACCCAAGGAGGAGGTGGCAGG - Intergenic
1074696122 10:116051502-116051524 ATGCCACAGGGGAAGGGGGCTGG + Intergenic
1076109800 10:127851683-127851705 GTGCCCCAGGGGAAGGAGGCAGG + Intergenic
1076692435 10:132230660-132230682 CTGCTGGGGGGGAAGCTGGCGGG + Intronic
1076902700 10:133347724-133347746 CTGCCCAAAAGGAAGGGGGCTGG + Intronic
1077378052 11:2214847-2214869 CTGCCAGCGGGGCAGGTGGCAGG - Intergenic
1077491809 11:2864431-2864453 CACCCTGAGGGGAAGGTGGATGG - Intergenic
1079269580 11:18971787-18971809 ATGCCTGAGGTGAAGGTGGAGGG - Intergenic
1083091279 11:60201579-60201601 CTCCCAGATGGGATGGTGGCCGG + Intronic
1083631274 11:64096777-64096799 CTCCCTGAGGGGAAGAGGGCAGG + Intronic
1084383996 11:68830649-68830671 CTGGCGGAGGGGCAGGTGACAGG - Intronic
1085068188 11:73517387-73517409 CTGCATGAGGGGAAGGGGGGTGG - Intronic
1085508307 11:77072531-77072553 CTGCCCGAGGGAGGGGTGGTGGG + Intronic
1087977245 11:104565086-104565108 CTTCCCCATGGGGAGGTGGCTGG + Intergenic
1088107494 11:106223410-106223432 CTGCCTGAGGGGAAGGTCTGGGG - Intergenic
1088257273 11:107912948-107912970 CTCCCCGACGGGGTGGTGGCCGG - Intronic
1088653254 11:111976855-111976877 ACGCCAGAGGGGAAGGTGGGAGG + Intronic
1088754605 11:112875592-112875614 CTGGCAGAGGGGAAGATGCCAGG + Intergenic
1089537287 11:119168726-119168748 GTGCCCGCGGGGATGGAGGCAGG + Intronic
1089613997 11:119685040-119685062 CAGCCCCAGGGAAAGGTGGCTGG - Intronic
1089631665 11:119788127-119788149 CAGCCCCAGGGGAAGCTGCCTGG + Intergenic
1089633541 11:119797879-119797901 CTTCCCAAAGGGAAGATGGCTGG - Intergenic
1089667980 11:120032411-120032433 CTGCTGAAGGGGTAGGTGGCAGG - Intergenic
1089763239 11:120744167-120744189 CTGCCCAGGGGGAATGGGGCTGG + Intronic
1090075503 11:123578041-123578063 CTGGCAGAGAGGAGGGTGGCAGG + Intronic
1090437050 11:126695744-126695766 CTGAGAGAGGGGAAGGAGGCAGG + Intronic
1090662077 11:128890030-128890052 CTGTCCCAGGGGAGGGTGCCTGG + Intergenic
1091352562 11:134908826-134908848 CTGCACCAAGGGAGGGTGGCAGG - Intergenic
1092113980 12:5985477-5985499 CTGCCAGAGGTGAAGATGGGTGG + Intronic
1092234476 12:6797599-6797621 CTCCGCGAGGGGAATGTGGTGGG + Intronic
1092453485 12:8624887-8624909 CTCCCAGACGGGATGGTGGCCGG - Intergenic
1093477604 12:19573354-19573376 TTGGCCGAGGGTGAGGTGGCTGG + Intronic
1094719999 12:33053121-33053143 CTGCCTGAGGGCAAGGGGCCAGG - Intergenic
1095097372 12:38155762-38155784 CTGCCCGGGGGAAAAGCGGCGGG + Intergenic
1096856520 12:54488117-54488139 CTGTCCGAGAGGGAGGTGGGGGG - Intergenic
1096999356 12:55863218-55863240 CTGCCCGGGAGGGAGGTGGGGGG - Intergenic
1097254799 12:57665264-57665286 CTCCCAGAGGGGGTGGTGGCCGG - Intergenic
1101059918 12:100960020-100960042 CTGCCCCAGAGGCAGGTGTCTGG - Intronic
1101631376 12:106498308-106498330 CAGCCCGAGGTGAGGGTGGAGGG + Intronic
1102089495 12:110173437-110173459 CTCCCAGACGGGATGGTGGCCGG - Intronic
1102426463 12:112847986-112848008 CTGCCAGTGGGGAAGGGGGTGGG - Intronic
1103580140 12:121908792-121908814 CTGGTCGAGGGGAAGCTGGCAGG + Intronic
1103613553 12:122138401-122138423 CTGCAGAAGGGGCAGGTGGCTGG - Intronic
1103614279 12:122142271-122142293 CTGCCCGTGGGGCAGTTGGAAGG + Exonic
1104131799 12:125901042-125901064 CTCCCAGAGGGGAATGTGGATGG - Intergenic
1104307338 12:127621563-127621585 CACCCCCAGGGGAAGGTGGCAGG + Intergenic
1105472650 13:20706125-20706147 CTGCCCACGGGGAAGTTGGGTGG + Intronic
1105702343 13:22942956-22942978 CTGCCCGTGGGGAGGGTGCGCGG + Intergenic
1105854966 13:24364740-24364762 CTGCCCGTGGGGAGGGTGCATGG + Intergenic
1105973455 13:25452263-25452285 ATGCCAGAGGGGAATGTGGGTGG - Intronic
1108603146 13:52011887-52011909 CCGCCTGCGGGGAAGGTGCCCGG + Intergenic
1108687799 13:52835916-52835938 CTGCCCCAGGGGATGCTGGTTGG - Intergenic
1108800915 13:54093167-54093189 AGGCCCAAGGGGAAGGTGGTCGG + Intergenic
1112816896 13:103283321-103283343 CTTCCTGAGAGGAAGGGGGCAGG - Intergenic
1113822765 13:113226968-113226990 GTGCCCTGGGGGTAGGTGGCGGG - Intronic
1114613049 14:24054566-24054588 CTGGCCCAGGGGAAGGAGGAAGG - Intronic
1115622249 14:35152451-35152473 CTCCCAGACGGGATGGTGGCCGG + Intronic
1115857763 14:37649447-37649469 CTGGCCCAGAGGAAGTTGGCAGG - Intronic
1119254457 14:73184523-73184545 CTGTCCGAGAGGGAGGTGGGGGG - Intronic
1122108733 14:99480727-99480749 CTGCGCTAGGGGAAGCGGGCAGG - Exonic
1122695393 14:103549806-103549828 GTGCCCGTGGGGAAGGGGCCAGG + Intergenic
1122902035 14:104785999-104786021 CGGCCCGAGGGGTGGGTGACGGG - Intronic
1123108797 14:105855662-105855684 CTGCGCGAGGGGAAGCAGGTGGG - Intergenic
1123449188 15:20349634-20349656 CAGCCCCTGGGAAAGGTGGCTGG + Intergenic
1125600967 15:40915635-40915657 ATGCCCCAGGGGCAGGGGGCGGG - Intergenic
1125929510 15:43590171-43590193 CTGCGCGAGCGGAGGGAGGCGGG - Exonic
1125942677 15:43690003-43690025 CTGCGCGAGCGGAGGGAGGCGGG - Intergenic
1126101243 15:45119503-45119525 CTGGCTGAGGGGCATGTGGCTGG + Intronic
1128793764 15:70450460-70450482 ATGCCTGAGGGGGAGGTGGGGGG - Intergenic
1128978069 15:72167670-72167692 ATGCCCGTGGGGCAGGAGGCTGG + Intronic
1129161810 15:73751949-73751971 CTGGCTGGGGGGAAGGTGGGGGG - Intronic
1129297620 15:74608618-74608640 CTGGCCCAGGGGCAGGTGGGAGG - Intronic
1129703613 15:77782308-77782330 GTGCCTGATAGGAAGGTGGCAGG - Intronic
1129739843 15:77984870-77984892 TTCCCTGAGGGGAGGGTGGCAGG + Intronic
1129846194 15:78768742-78768764 TTCCCTGAGGGGAGGGTGGCAGG - Intronic
1130255711 15:82325185-82325207 TTCCCTGAGGGGAAGGTGGCAGG + Intergenic
1130255931 15:82326067-82326089 TTCCCTGAGGGGAAGGTGGCAGG + Intergenic
1130599024 15:85263919-85263941 TTCCCTGAGGGGAGGGTGGCAGG - Intergenic
1130599251 15:85264801-85264823 TTCCCTGAGGGGAAGGTGGCAGG - Intergenic
1131048893 15:89333723-89333745 CTGCTCTGGAGGAAGGTGGCCGG - Exonic
1131517505 15:93089006-93089028 CTGCCCCGGGGCAAGGTGGGAGG + Intronic
1133716892 16:8458565-8458587 CTGCCAGAAGGGAAGGAGGATGG + Intergenic
1137366314 16:47862670-47862692 CTGCAGGAGGTGATGGTGGCTGG + Intergenic
1138521945 16:57576084-57576106 CTCCCCTGGAGGAAGGTGGCAGG - Exonic
1140063209 16:71589250-71589272 TTGCCAGACGGGATGGTGGCCGG - Intergenic
1140194901 16:72847881-72847903 AAGCCCGAGGGGGAGGAGGCTGG + Intronic
1140700946 16:77581077-77581099 CTGTCCAAGGAGAAGATGGCTGG + Intergenic
1141442241 16:84036955-84036977 GTGCCCGAGGGGTGGCTGGCTGG - Intronic
1141635987 16:85314154-85314176 CTGCCTCAGGGGAGGGAGGCTGG - Intergenic
1141663508 16:85454010-85454032 ATGCCCGTGGGGCAGGGGGCGGG - Intergenic
1141862434 16:86727116-86727138 CTGCCAGAATTGAAGGTGGCTGG + Intergenic
1142120669 16:88385107-88385129 TTCTCCCAGGGGAAGGTGGCAGG - Intergenic
1142247480 16:88976629-88976651 AGGCTCGAGGGGAAGGTGGTGGG - Intronic
1142398255 16:89845235-89845257 GTCCCCGAGGGGGAGGTGGGGGG + Intronic
1143756224 17:9069722-9069744 GTGCCTGAGGACAAGGTGGCAGG + Intronic
1144623978 17:16835088-16835110 CTCCCAGAGGGGGATGTGGCAGG + Intergenic
1144656914 17:17042702-17042724 CCGCCCGCCGGGAAGGAGGCCGG + Intronic
1144737133 17:17561487-17561509 CTGCCCGAGGGGGAAGCGGACGG + Intronic
1144882447 17:18437628-18437650 CTCCCAGAGGGGGATGTGGCAGG - Intergenic
1145149787 17:20506758-20506780 CTCCCAGAGGGGGATGTGGCAGG + Intergenic
1146346384 17:32062803-32062825 CCGCCCTAAGGGAAGGTGGGGGG + Intergenic
1147715687 17:42506529-42506551 CTGCCCGAAGGCCAGGTTGCAGG + Intronic
1147951612 17:44110910-44110932 CAGACCGAAGGGAAGGTGGTCGG + Intronic
1148206733 17:45784257-45784279 CGGACCGTGGGGGAGGTGGCGGG + Intergenic
1148567576 17:48642606-48642628 CTGCCCGACAGGGAGGTGGCCGG - Intergenic
1148618193 17:49015384-49015406 CCGACCGAGGGAAAGGTGGGGGG - Intronic
1149466155 17:56880754-56880776 CTGACAGAGGGGATCGTGGCTGG + Intergenic
1149554947 17:57566891-57566913 GTGCCCGCTGGGGAGGTGGCAGG + Intronic
1149998364 17:61416732-61416754 CTCCAGGAGGGGAAGGGGGCAGG - Intergenic
1150127502 17:62647880-62647902 CTGCCCGCTGGGTAGTTGGCAGG - Intronic
1150435094 17:65147483-65147505 CTGCCTGAGTGACAGGTGGCAGG + Intronic
1151354834 17:73552066-73552088 CTGGCCGAGGGGTGGGGGGCAGG - Intronic
1151490729 17:74431173-74431195 CAGCCCCGGGGGAAGGCGGCCGG + Exonic
1151557126 17:74852193-74852215 AGGCCCACGGGGAAGGTGGCGGG + Exonic
1151785414 17:76272673-76272695 CTGCCCGGGGAGAAAGGGGCTGG + Intergenic
1152247683 17:79193859-79193881 CTGGCCCACAGGAAGGTGGCTGG + Intronic
1152339461 17:79716230-79716252 CAGCCCCCGGGAAAGGTGGCTGG - Intergenic
1152519056 17:80844898-80844920 TTGCTCGGGGGGAAGGTGGGTGG - Intronic
1152573891 17:81131874-81131896 CTGCCCAGGGTAAAGGTGGCCGG - Intronic
1152750537 17:82060565-82060587 CTGCCCAAGGGAAAGGAGGAGGG - Intronic
1153358139 18:4161232-4161254 CTGTCCTGGGGAAAGGTGGCGGG - Intronic
1160835894 19:1124299-1124321 GTGCCCGGGAGGAAGGTGCCCGG + Intronic
1160842910 19:1154460-1154482 ATGCCCGAGGGAGAGGCGGCCGG - Intronic
1160939784 19:1614855-1614877 CTGCCTGACGGGAAGGGGCCAGG + Intronic
1160966548 19:1749313-1749335 GTGCCCGAGGGGAAGGGTCCGGG - Intergenic
1161417748 19:4157154-4157176 CAGCCGGCGGGGGAGGTGGCTGG - Exonic
1161486138 19:4536855-4536877 CTGCCCCCGGGCAAGGTTGCAGG - Exonic
1162757213 19:12867564-12867586 GGCCCCGAGGAGAAGGTGGCCGG + Exonic
1163697983 19:18773601-18773623 TTGCCCGAGGCGAGGGAGGCAGG - Intronic
1166317011 19:41994674-41994696 CTGCAGGAGGGGAAGTTGGAAGG + Intronic
1166696775 19:44856422-44856444 AGGCCTGAGGGGAAGGTGGTGGG - Intronic
1167418824 19:49390890-49390912 CTGCCCGAGGGCCCGGTGGGTGG + Exonic
1168339485 19:55615068-55615090 GGGCCCGGGGGGAAGGTGGGCGG - Exonic
1168358570 19:55718665-55718687 CTTGGCGAGGGGAATGTGGCTGG - Intronic
926142150 2:10374064-10374086 CTGCCTGTGGGGAAGCAGGCGGG - Intronic
927809206 2:26172745-26172767 CTGGGCGCGGGGAAGCTGGCGGG + Intergenic
927928159 2:27027122-27027144 GTGCCCGAGGGGCAGGGGGTGGG - Exonic
928184538 2:29097697-29097719 CTGCCTGTGGGGACGCTGGCTGG + Intronic
929690189 2:44067257-44067279 CTGTCCGAGAGGGAGGTGGGGGG - Intergenic
930201450 2:48555247-48555269 CTCCCAGACGGGGAGGTGGCTGG + Intronic
931847797 2:66222498-66222520 CTGCACGAGGGTAAGGAGGGGGG - Intergenic
932578225 2:72974422-72974444 CTGGATGAGGGGAAGGAGGCTGG - Intronic
933273207 2:80255907-80255929 CTGCCAGAGGGAAGGGTGGCAGG - Intronic
933840754 2:86284068-86284090 CAGGCCAAGGGGGAGGTGGCTGG + Intronic
935944074 2:108270224-108270246 CTTCCAGATGGGAAGGTGGGTGG - Intergenic
937100217 2:119262955-119262977 CTGGCGGAGGGGAAGGAGGGTGG - Intronic
937149159 2:119673990-119674012 AAGCCTGAGGGGAAGGTGGGAGG - Intergenic
937694426 2:124791994-124792016 CTGCCTCTGGGGAATGTGGCCGG + Intronic
938972374 2:136444224-136444246 CTGCCCCTGGGAAATGTGGCAGG + Intergenic
940017594 2:149123089-149123111 GTTCCAGAAGGGAAGGTGGCAGG + Intronic
941793236 2:169575194-169575216 CTGCCCGGGAGGGAGGTGGGGGG - Intergenic
942447512 2:176087972-176087994 CTGCCCGAGGGGAGGGGCGCCGG + Intergenic
946077965 2:217091534-217091556 CTGTCACAGGGGAACGTGGCAGG - Intergenic
946295751 2:218782276-218782298 TTGTCCGAGGGGAGGGCGGCAGG - Exonic
946396946 2:219448085-219448107 CGACCCGAGGGGACGGTGGGGGG - Exonic
947797102 2:232901593-232901615 CTGGCCGTGAGGAAGGTGGAGGG - Intronic
948023100 2:234753401-234753423 CTGCCCAAGGTGAGGGTTGCCGG - Intergenic
948598100 2:239093281-239093303 CTGCTTTCGGGGAAGGTGGCTGG + Intronic
948755252 2:240155693-240155715 CTGCCTGTGGGGTAAGTGGCTGG - Intergenic
1169431368 20:5539280-5539302 CTTTCAGAGGGGAAGGTGGGTGG + Intergenic
1170500203 20:16967977-16967999 CCACCCGAGGGGAAGGAGGAAGG - Intergenic
1170569076 20:17622748-17622770 CACCCCGAGGGGAAGGCTGCTGG + Intronic
1171109247 20:22465242-22465264 CTGCCAGAGGAGAAGGAGGTGGG - Intergenic
1171178568 20:23074437-23074459 CTGCCCTGGGTGGAGGTGGCGGG - Intergenic
1172094172 20:32452589-32452611 GCCCCCGGGGGGAAGGTGGCTGG - Intronic
1172519850 20:35559487-35559509 CCGCCTGAGGGGCTGGTGGCCGG - Intergenic
1173228677 20:41177330-41177352 CTGCCCTGCGGGAAGATGGCAGG + Intronic
1173334560 20:42102049-42102071 CTTCCTGAGGTGGAGGTGGCTGG - Intronic
1173346393 20:42204674-42204696 CTGAGGGAGGGGTAGGTGGCAGG + Intronic
1173898930 20:46572535-46572557 CTGGCCTAGAGGAAGGAGGCTGG - Intronic
1174551102 20:51362342-51362364 CTGGCCAAGGGAAAGGTGACAGG + Intergenic
1174572037 20:51508857-51508879 AGGCCAGAGGGGATGGTGGCTGG - Intronic
1175145687 20:56894537-56894559 CATCCCGGGGGGAAGGTGGAAGG + Intergenic
1175286395 20:57839707-57839729 CTGCCCCAGGTCAAGGTGGTTGG + Intergenic
1175869988 20:62204560-62204582 GTGTCCAAGTGGAAGGTGGCAGG - Intergenic
1176171362 20:63697779-63697801 CTGCCCGAGGGGAAGGTGGCTGG + Intronic
1176363196 21:6015999-6016021 CTCCCCGGTGGGCAGGTGGCAGG - Intergenic
1177491416 21:21830764-21830786 CTGGCAGAGAGGAAGGTAGCTGG + Intergenic
1178034479 21:28564262-28564284 CTCCCAGAGGGGGTGGTGGCCGG - Intergenic
1178138076 21:29650800-29650822 GTGGCTGTGGGGAAGGTGGCTGG - Intronic
1178922052 21:36745148-36745170 CTGCTCGTGGGGAAGGTGGGAGG + Intronic
1179531287 21:42021442-42021464 CTGCCAGAGGAGACCGTGGCAGG - Intergenic
1179760322 21:43522546-43522568 CTCCCCGGTGGGCAGGTGGCAGG + Intergenic
1179775538 21:43659571-43659593 CGGCCCGGGCGGACGGTGGCTGG + Exonic
1179791319 21:43757459-43757481 CCGTCCGTGGGGAAGGTAGCGGG - Exonic
1180985017 22:19898962-19898984 CTGCCGGAAGGGCGGGTGGCAGG + Intronic
1181598955 22:23937367-23937389 CTCCCAGAGGGGGTGGTGGCCGG - Intergenic
1181617487 22:24065037-24065059 CTCCCAGAGGGGGTGGTGGCCGG + Intronic
1182638805 22:31750427-31750449 CTGCCAGAGTGGAAGCAGGCAGG - Intergenic
1183098509 22:35569026-35569048 CTGCATGCGGGGAAGGTGGGAGG + Intergenic
1183315523 22:37135043-37135065 CAACCCGAGGGGAAGGTGGGAGG - Intronic
1183669826 22:39265924-39265946 CTCCCCTAGGGAAGGGTGGCTGG + Intergenic
1184288752 22:43487040-43487062 CTACCCGACAGGAAGGTGGGAGG - Intronic
1184688611 22:46107490-46107512 CTGCCCGTGGGCAGGGTGCCCGG - Intronic
1185133284 22:49052676-49052698 CTGCCCGGTGGGAAGTTCGCTGG - Intergenic
952765013 3:36945785-36945807 TTGCCCCAGGGGAGGGCGGCGGG - Intergenic
952838905 3:37627934-37627956 CTGCCTCTGGGGAAGGGGGCTGG + Intronic
953251676 3:41249750-41249772 CTGACCAAGGGGAAAGAGGCAGG + Intronic
953427195 3:42804746-42804768 CTGCCCGAGGGGAAAAGGGCAGG - Intronic
953558696 3:43967523-43967545 CTGCCCGAGGGCGAGGGAGCCGG - Intergenic
953627274 3:44581140-44581162 CCGCCCGCAGGGAAGGAGGCCGG - Intronic
953770562 3:45776100-45776122 GTCCCCGAAGGGCAGGTGGCTGG + Intronic
954240638 3:49290868-49290890 CTTCACGAGGGCAAGGTGGAAGG + Intronic
961333479 3:126156542-126156564 CTGCCCGAGGACAGGCTGGCAGG - Intronic
961681472 3:128602955-128602977 CTGCCTCTGGGAAAGGTGGCTGG + Intergenic
962207563 3:133447495-133447517 CTACCTCAGGGGAAGCTGGCAGG + Intronic
962234926 3:133699633-133699655 AAGCCAGAGGGGAAGATGGCAGG - Intergenic
962254507 3:133861113-133861135 CTGCAGAAGGGGAAGGGGGCTGG + Intronic
964555717 3:157936020-157936042 CTGCCAGAGGTGAAGGAGGAGGG + Intergenic
966011748 3:175087267-175087289 CTGCCCGGGAGGGAGGTGGGGGG + Intronic
966924071 3:184633322-184633344 CTGCCCGAGGGGAGGGTGACAGG - Intronic
968319087 3:197749898-197749920 GTGCGCGAGTGGGAGGTGGCAGG + Exonic
969240241 4:5892601-5892623 CCGGCCGAGGGGCAGGTCGCGGG + Exonic
969468141 4:7369915-7369937 CTTCCAGAAGGGAAGGGGGCAGG - Intronic
969581869 4:8070652-8070674 CTGCCACAGGGGAGGCTGGCAGG - Intronic
969617932 4:8264729-8264751 CTTCCCGAGGAGAAAGCGGCTGG - Intergenic
977609863 4:99020537-99020559 CTGCCTGAGGAGGAGGAGGCGGG + Intronic
980340963 4:131546996-131547018 CTTCCGGAGGGCAAGGTGGGAGG + Intergenic
981554735 4:145980564-145980586 ATGACAGAGGGGAAGGTGGGGGG + Intergenic
981724699 4:147834797-147834819 CTGACCCAGGGGAAGGAGACAGG - Intronic
981908841 4:149954499-149954521 CTGCCTGTGGGGAGGGTGTCAGG - Intergenic
984533536 4:180945018-180945040 CTGTCCGGGAGGAAGGTGGGGGG + Intergenic
985509258 5:302966-302988 CTTCCCAAGGGGAAGTTGGGAGG + Intronic
985739013 5:1603926-1603948 CTTCCCAAGGGGAAGTTGGGAGG - Intergenic
990210698 5:53479876-53479898 CTGCCAGGGTGGAAGGTGCCGGG + Intergenic
990954804 5:61331547-61331569 CGGCTGGAGGGGAAGCTGGCAGG + Intergenic
992391729 5:76336321-76336343 CTCCCAGAGGGGATGGCGGCTGG + Intronic
994691630 5:103026831-103026853 GGGGCCTAGGGGAAGGTGGCAGG + Intronic
995650461 5:114362632-114362654 CTGCCCGTGGGGCTGGCGGCGGG - Exonic
997938946 5:138139159-138139181 GGGCTCGAGGGGACGGTGGCTGG + Intronic
998403739 5:141862173-141862195 TTGCCCTGGGGGAAGGTGGCTGG + Intronic
998799643 5:145856391-145856413 CTGCCCTATGGGAAGGCCGCCGG + Intergenic
999150440 5:149422931-149422953 CTGCCGGAGGGGAGGGTGAGGGG - Intergenic
1000130286 5:158290621-158290643 CTCCCCAAGGGGCAGTTGGCAGG - Intergenic
1001431720 5:171667611-171667633 CTCCCGGAGGGGAAGGGCGCAGG - Intergenic
1002929838 6:1625434-1625456 CTGCCAGAGGGGACGGTGGCGGG - Intronic
1003551753 6:7107478-7107500 CTGCCCGAGGGGAAGGGTCCGGG - Intergenic
1004423918 6:15494917-15494939 CAGCCCGAGAGGAAGGTGCCAGG - Intronic
1004511269 6:16286116-16286138 CTGTCCAAGGGGATGGTGCCAGG + Intronic
1005611521 6:27529967-27529989 CTGCCAGACGGGGCGGTGGCCGG + Intergenic
1007094282 6:39203812-39203834 CTGCCCTAGTGGAAGCTGACAGG + Intronic
1007784838 6:44273582-44273604 CTCCCTGGGGGGAAGGTGGGAGG + Intronic
1010030433 6:71266486-71266508 CTCCCGGACGGGCAGGTGGCCGG + Intergenic
1012555412 6:100505551-100505573 GTGGCAGTGGGGAAGGTGGCTGG + Intergenic
1013154262 6:107477983-107478005 CTACCTGAGGGGGAGGTGGGAGG + Intergenic
1017006313 6:150030051-150030073 CTGACCGAGTGGTAGCTGGCTGG - Intergenic
1017866653 6:158449781-158449803 CTGCTAGAGGTTAAGGTGGCTGG - Intronic
1019373596 7:676824-676846 CTCCCCGAGGGCAAGGAGGGTGG + Intronic
1019523626 7:1471225-1471247 CTGACCGGGGGAAAGGTGGGAGG + Intronic
1019750370 7:2725345-2725367 CTGCGCGAGGGGAAGGGCGAAGG + Intronic
1021838948 7:24706750-24706772 GTGCCCGGTGGGAATGTGGCCGG - Intronic
1022223003 7:28332594-28332616 CTGGCCCAGGAGAAGGTTGCTGG - Intronic
1022539178 7:31120787-31120809 CTGGCTGAGAGGAAGGTGGCTGG + Intergenic
1023939636 7:44761346-44761368 GTCCCTGCGGGGAAGGTGGCTGG + Intronic
1026503259 7:70960580-70960602 CTGCCAGAGGAGAAGGAGGGTGG + Intergenic
1028175918 7:87657897-87657919 CTCCCACAGGGGAAGGTGGGAGG - Intronic
1029237456 7:99132819-99132841 CTGCCAGAGAGGAATATGGCAGG + Intronic
1029389708 7:100266831-100266853 CTGCCCTAGAGGCAGGAGGCAGG + Intronic
1032271177 7:130408087-130408109 CTTCCCTTGGGGAAGGAGGCAGG - Intronic
1032530440 7:132615401-132615423 CTGGCGGAGGGGACGGGGGCTGG + Intronic
1033324022 7:140362926-140362948 CTGTCCGGGAGGGAGGTGGCGGG + Intronic
1036071283 8:5442240-5442262 GTGACAGAGGGGAAGGTGTCAGG - Intergenic
1036496762 8:9277171-9277193 CTGCCAGAGGGGAAGGAGCCTGG - Intergenic
1039493579 8:37965319-37965341 ACGCCCGAGGGGAAGAGGGCCGG + Exonic
1039901151 8:41753421-41753443 CTGACTGAGGGGAAGGGGTCTGG - Intronic
1049389470 8:142360580-142360602 CAGCCTGAGGGGCTGGTGGCTGG - Intronic
1049481557 8:142826894-142826916 CTCCCAGAGGGGATGGTGGCCGG + Intergenic
1051563890 9:18474076-18474098 CTGACCGAGGGGTGGGTGGGTGG - Exonic
1052492653 9:29188838-29188860 CTGTCTGGGAGGAAGGTGGCGGG - Intergenic
1052942165 9:34138213-34138235 CTCCCAGACGGGGAGGTGGCCGG - Intergenic
1055256115 9:74373253-74373275 CTGCCAGTGGGGAAGAAGGCAGG - Intergenic
1056007134 9:82284882-82284904 CTGCCTCGGGGGAAGGTGGGTGG - Intergenic
1056355493 9:85797606-85797628 CTGCCCTAGGTGAAGGTGAAGGG - Intergenic
1056409661 9:86312586-86312608 CTCCCAGATGGGATGGTGGCCGG - Intronic
1056600410 9:88042602-88042624 CTGCCTGAGGGGAAGGTTTAGGG + Intergenic
1057630442 9:96715623-96715645 CCGTCCGAGGGGGAGGTGGGGGG - Intergenic
1058141628 9:101362604-101362626 CTGCCCCAGGGTAAGATAGCAGG + Exonic
1058142891 9:101376702-101376724 GTGCACGAGTGGGAGGTGGCAGG - Intronic
1059249902 9:112879292-112879314 CAGCCTGAGGGGAATGTGGAAGG - Exonic
1060944520 9:127562037-127562059 CTGCCCGCGGGGAAGGAGGAGGG + Intronic
1061430251 9:130526335-130526357 CTGGCCGAGGGGAAGTGGGATGG + Intergenic
1061678300 9:132230521-132230543 CTGCCCCAGGGGAAGGGGCCTGG - Intronic
1062546577 9:137066295-137066317 GTGCCCGAGGGGAACGTCGGAGG - Exonic
1185453453 X:295323-295345 CTCCCCGCGGGGACGGTGGCAGG + Intronic
1193132173 X:77931534-77931556 CTCCCAGAGGGGGTGGTGGCCGG + Intronic
1193164568 X:78265527-78265549 CTGTCCGGGAGGAAGGTGGGGGG - Intergenic
1195060757 X:101191639-101191661 CTGCCCGGGCGGGAGGAGGCGGG + Intergenic
1196393464 X:115233940-115233962 CGGCTGGAGGGGGAGGTGGCGGG - Exonic
1196641611 X:118068907-118068929 CTGCCTGAGGGGATGGGGGAAGG - Intronic
1198518148 X:137428549-137428571 CAGCCCGGGGGGAGGGGGGCTGG + Intergenic
1200064893 X:153499636-153499658 CTGCCTGAGGGGCTGGGGGCTGG - Intronic
1200136193 X:153875887-153875909 CGGCCGGAGGGGAAGGGGGCTGG + Exonic
1200224274 X:154408662-154408684 GAGCCCGAAGGGAAGGTGACAGG - Intronic
1200238841 X:154483157-154483179 CTCCCTGAGGGGCAGGTGGTGGG + Intergenic