ID: 1176172338

View in Genome Browser
Species Human (GRCh38)
Location 20:63701637-63701659
Sequence AGGGCTGGCAGCAGCAGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 652
Summary {0: 1, 1: 0, 2: 4, 3: 72, 4: 575}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176172330_1176172338 -2 Left 1176172330 20:63701616-63701638 CCCTGAGGTGGGAGAACCTCCAG 0: 1
1: 0
2: 2
3: 21
4: 172
Right 1176172338 20:63701637-63701659 AGGGCTGGCAGCAGCAGGTCTGG 0: 1
1: 0
2: 4
3: 72
4: 575
1176172326_1176172338 12 Left 1176172326 20:63701602-63701624 CCTCTGGGCGCCTGCCCTGAGGT No data
Right 1176172338 20:63701637-63701659 AGGGCTGGCAGCAGCAGGTCTGG 0: 1
1: 0
2: 4
3: 72
4: 575
1176172331_1176172338 -3 Left 1176172331 20:63701617-63701639 CCTGAGGTGGGAGAACCTCCAGG 0: 1
1: 0
2: 1
3: 28
4: 234
Right 1176172338 20:63701637-63701659 AGGGCTGGCAGCAGCAGGTCTGG 0: 1
1: 0
2: 4
3: 72
4: 575
1176172329_1176172338 2 Left 1176172329 20:63701612-63701634 CCTGCCCTGAGGTGGGAGAACCT 0: 1
1: 0
2: 0
3: 17
4: 218
Right 1176172338 20:63701637-63701659 AGGGCTGGCAGCAGCAGGTCTGG 0: 1
1: 0
2: 4
3: 72
4: 575

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176172338 Original CRISPR AGGGCTGGCAGCAGCAGGTC TGG Intronic