ID: 1176173019

View in Genome Browser
Species Human (GRCh38)
Location 20:63704685-63704707
Sequence GTGGACCCACACTTCCACGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 100}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176173019_1176173024 5 Left 1176173019 20:63704685-63704707 CCAACGTGGAAGTGTGGGTCCAC 0: 1
1: 0
2: 1
3: 18
4: 100
Right 1176173024 20:63704713-63704735 GCTGCAGCTGTGGCCAGTGCAGG 0: 1
1: 0
2: 2
3: 62
4: 449
1176173019_1176173025 14 Left 1176173019 20:63704685-63704707 CCAACGTGGAAGTGTGGGTCCAC 0: 1
1: 0
2: 1
3: 18
4: 100
Right 1176173025 20:63704722-63704744 GTGGCCAGTGCAGGCATCTCTGG 0: 1
1: 0
2: 6
3: 27
4: 263
1176173019_1176173022 -5 Left 1176173019 20:63704685-63704707 CCAACGTGGAAGTGTGGGTCCAC 0: 1
1: 0
2: 1
3: 18
4: 100
Right 1176173022 20:63704703-63704725 TCCACATAGGGCTGCAGCTGTGG 0: 1
1: 0
2: 1
3: 17
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176173019 Original CRISPR GTGGACCCACACTTCCACGT TGG (reversed) Intronic
904818510 1:33223371-33223393 TTGGACTTACAGTTCCACGTGGG - Intergenic
911063165 1:93764845-93764867 CTGGACCCAGACTCCCACTTAGG - Intronic
912579269 1:110705551-110705573 TTGGACCCACAGTTCCACAGGGG + Intergenic
915894128 1:159798094-159798116 GTGGGGCCACACTTCCAGCTGGG - Intergenic
917141064 1:171836571-171836593 ATGAACTCACAGTTCCACGTGGG + Intergenic
923997135 1:239507464-239507486 TTGGACTTACAGTTCCACGTGGG - Intronic
1063309448 10:4938514-4938536 GAGGACCCACACCTCCCCTTAGG + Intronic
1065265358 10:23969854-23969876 ATGGACTCACAGTTCCACGTGGG + Intronic
1067978983 10:51061159-51061181 ATGGACTCACAGTTCCACATGGG + Intronic
1073516077 10:104076709-104076731 GTTGAGGCACACTTCCACGCTGG - Intronic
1073892956 10:108121996-108122018 ATGGACTCACAGTTCCACGTGGG - Intergenic
1076295987 10:129385127-129385149 GTGCACCCTCACTTCCACACAGG + Intergenic
1076640131 10:131910052-131910074 GTGGCGTCACACTTCCATGTGGG + Intronic
1077405276 11:2379811-2379833 GTGGACCCACCCATCCACTGGGG + Intronic
1080973162 11:37303173-37303195 ATGGACTCACAGTTCCATGTGGG + Intergenic
1081003136 11:37699702-37699724 ATTGACCCACAGTTCCACATGGG + Intergenic
1092098457 12:5863093-5863115 ATGGACTCACAGTTCCACGTGGG - Intronic
1098650042 12:72953147-72953169 TTGGACTTACAGTTCCACGTGGG + Intergenic
1100063019 12:90604667-90604689 ATGGACTCACACTTCCACATTGG - Intergenic
1100378860 12:94043296-94043318 ATGGACTCACAGTTCCACATGGG + Intergenic
1102901852 12:116644992-116645014 GGGGAACCACACTTCCTGGTAGG + Intergenic
1104984872 12:132591073-132591095 CTGAACCCACAGTTCCACGTTGG - Intergenic
1107447438 13:40481411-40481433 GAGGACCCACAACTCCACCTGGG + Intergenic
1107582303 13:41803444-41803466 ATGGACTCACAGTTCCATGTGGG + Intronic
1109098127 13:58144015-58144037 ATGGACTTACAGTTCCACGTGGG - Intergenic
1110724258 13:78801393-78801415 ATGGACTCACAGTTCCACATGGG + Intergenic
1111365989 13:87245778-87245800 ATGGACTCACAGTTCCACATGGG + Intergenic
1115566469 14:34629640-34629662 GTGGACCTCCACTCCCACGCGGG - Intronic
1115949499 14:38704122-38704144 TGGCACCTACACTTCCACGTAGG + Intergenic
1117197883 14:53359722-53359744 ATGGACTCACAATTCCACATGGG + Intergenic
1117455898 14:55896577-55896599 ATGGACTCACAGTTCCACGTAGG - Intergenic
1124082911 15:26517797-26517819 GTGGAACCAGAGTTCCAGGTGGG - Intergenic
1127899430 15:63330100-63330122 GTGGAGCCACTCTGCCACTTGGG - Intronic
1130750243 15:86703810-86703832 ATTGACTCACACTTCCACATGGG - Intronic
1133729478 16:8567524-8567546 CTGGTCCCACACGTCCACCTTGG - Intergenic
1139597952 16:67968884-67968906 GGGGAAACACACTTCCACCTCGG + Intronic
1140160791 16:72490827-72490849 GAGGACCAACAGGTCCACGTAGG - Intergenic
1143143225 17:4755081-4755103 GTGGACTCAGACATCCACCTAGG + Intergenic
1144380044 17:14686023-14686045 GTTGACACACCCTTCCAGGTGGG - Intergenic
1144512116 17:15886348-15886370 GTAGAACCACACTTCCCTGTGGG + Intergenic
1158772904 18:60543165-60543187 ATGGACTCACAGTTCCACATGGG - Intergenic
1159413462 18:68111913-68111935 ATGGGCCCACACTTGCAAGTAGG - Intergenic
1160262054 18:77303291-77303313 GTGGACTCACAGTTCCACATAGG - Intergenic
1160552557 18:79704347-79704369 GTGGACACACCACTCCACGTGGG - Intronic
1161013180 19:1969896-1969918 GTGGGCCCCAACTTCCGCGTCGG + Exonic
1162419482 19:10557967-10557989 GAGGACCCCAACTTCAACGTAGG - Exonic
1166969758 19:46558426-46558448 GTGGACTTACAGTTCCACGTGGG + Intronic
925234604 2:2266897-2266919 ATGGAATCACAGTTCCACGTGGG - Intronic
925968294 2:9086810-9086832 GTGTATAAACACTTCCACGTTGG + Intergenic
927355130 2:22164253-22164275 ATTGAGCCACACTTGCACGTGGG + Intergenic
938639656 2:133266031-133266053 GTGCAGAAACACTTCCACGTTGG - Intronic
943796382 2:192001791-192001813 ATGGACTCACAGTTCCACGTGGG - Intronic
944250084 2:197572985-197573007 ATTGACTCACAGTTCCACGTAGG - Intronic
946598374 2:221332063-221332085 ATGGACTCACAGTTCCACGTGGG + Intergenic
947888401 2:233594498-233594520 ATGGACTCACAGTTCCACTTGGG - Intergenic
948903673 2:240968013-240968035 ATGGACCCCCACCTCCACGTGGG + Intronic
949053721 2:241912489-241912511 GTGGCCCCACGCTTCCCCGAGGG + Intergenic
1170999745 20:21400852-21400874 CTGGACCCCCACTTCAAAGTGGG - Intergenic
1174679522 20:52392678-52392700 GTGGTCTCACACATCCACTTGGG - Intergenic
1176173019 20:63704685-63704707 GTGGACCCACACTTCCACGTTGG - Intronic
1180903955 22:19395342-19395364 GTGGGCCCATCCTTCCAGGTAGG - Intronic
1181324604 22:22034907-22034929 GTGCCCACACACTTCCAAGTGGG + Intergenic
1182679811 22:32070078-32070100 GTGGACCTACAGCTCCAGGTTGG - Intronic
956048831 3:65225197-65225219 ATGGACTCACAGTTCCACATGGG - Intergenic
959981180 3:112519259-112519281 ATGGACTCACAGTTCCACATGGG - Intergenic
963259055 3:143176058-143176080 GTGGACACACACTCCCGCTTGGG + Intergenic
963548117 3:146686440-146686462 TTGGACTTACATTTCCACGTTGG + Intergenic
963634519 3:147777305-147777327 ATGGACTCACAGTTCCATGTGGG - Intergenic
965306420 3:167069829-167069851 GGGGCCCCACACTTCCATGAGGG + Intergenic
970869112 4:20794130-20794152 ATGGGCTCACACTTCCACATGGG - Intronic
971133475 4:23839707-23839729 TTAGACTCACAGTTCCACGTGGG + Intronic
971757662 4:30722420-30722442 GTTGACCCCCACGTCCAAGTCGG - Exonic
973722285 4:53737018-53737040 GTGAACCCACACATCCTCGAAGG + Intronic
976162874 4:82221737-82221759 ATGGACTCACAGTTCCACGTGGG - Intergenic
984440402 4:179762460-179762482 ATGGACTCACAGTTCCACATGGG + Intergenic
986356010 5:6927095-6927117 GTGGACTCAAAATTCCACATGGG + Intergenic
986832345 5:11593726-11593748 ATGGACTCACAATTCCACATGGG - Intronic
987337392 5:16909089-16909111 ATGGACTCACAGTTCCACATGGG + Intronic
988173067 5:27683863-27683885 ATGGACTCACAGTTCCATGTGGG + Intergenic
1003266460 6:4568643-4568665 GGGGACTCACACTTACAGGTAGG - Intergenic
1003849497 6:10207107-10207129 ATGGACTCACAGTTCCACATTGG - Intronic
1016134702 6:140525204-140525226 ATGGACTCACAGTTCCACGTGGG - Intergenic
1016230774 6:141801210-141801232 GTGGACTTACACTTTCACATTGG - Intergenic
1016512493 6:144859241-144859263 ATGGACTCACAGTTCCACATTGG - Intergenic
1019699753 7:2468921-2468943 GTGGACCCGCATTTCCAGCTCGG - Intergenic
1020742403 7:12038819-12038841 ATGGACCCACCATTCCACATGGG + Intergenic
1029642951 7:101832529-101832551 CAGGACCCACACTTCGGCGTTGG + Intronic
1031473045 7:122190481-122190503 GTGGACTCACAGTTCCACGTAGG - Intergenic
1032873013 7:136006458-136006480 GTGGACTCACAGTTCCACGAGGG - Intergenic
1033810916 7:145009909-145009931 GTGGACCCAGGCTTCCACGAAGG - Intergenic
1036905799 8:12707588-12707610 GTGTACACACACTTCGATGTTGG - Intergenic
1037126320 8:15354602-15354624 ATGGACTCACAGTTCCACATGGG - Intergenic
1037401428 8:18498697-18498719 GTGAGCCCACACCTCCACGTGGG - Intergenic
1038913484 8:31993629-31993651 ATGGACTCACAGTTCCACATTGG - Intronic
1040871133 8:52101023-52101045 GTGGGCCCAGACTTCAACCTGGG + Intergenic
1045489951 8:102660567-102660589 AAGGACCCACACTTCCACCTAGG - Intergenic
1045602198 8:103730921-103730943 ATTGACTCACAGTTCCACGTGGG + Intronic
1046839343 8:118840108-118840130 ATTGACTCACAGTTCCACGTGGG - Intergenic
1047641251 8:126823934-126823956 ATGGACTCACATTTCCACGTGGG - Intergenic
1047701277 8:127451766-127451788 ATGGACTCACAGTTCCACATGGG - Intergenic
1048822155 8:138390451-138390473 ATGGACTCACAGTTCCATGTGGG - Intronic
1049213046 8:141395549-141395571 GTGCACCCCCACTTCCCCTTAGG + Intronic
1052254924 9:26444978-26445000 ATGAACTCACAGTTCCACGTGGG + Intergenic
1052860410 9:33434740-33434762 GGGGATCCCCACTTCCATGTTGG - Intergenic
1053893586 9:42719947-42719969 ATGGACTCACAGTTCCACATAGG - Intergenic
1060239675 9:121892350-121892372 ATGGACTCACAATTCCACATGGG + Intronic
1060494830 9:124110937-124110959 ATGGACTCACAGTTCCACATGGG - Intergenic
1185558505 X:1040170-1040192 GTTGACCTTCACTTCCACATTGG + Intergenic
1185619212 X:1443074-1443096 GTGGACACACACTGCCATCTGGG + Intronic
1185619229 X:1443188-1443210 GTGGACACACACTGCCATCTGGG + Intronic
1185619304 X:1443689-1443711 GTGGACACACACTGCCATCTTGG + Intronic
1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG + Intronic
1190013951 X:46810584-46810606 ATGGACTCACAGTTCCACATGGG + Intergenic
1191674399 X:63779320-63779342 ATGGACTCACAGTTCCACATGGG + Intronic
1194505484 X:94729078-94729100 GTTGACTCACAGTTCCACATGGG + Intergenic
1196834919 X:119804841-119804863 ATGGACTCACAGTTCCACATGGG + Intergenic
1198967032 X:142237982-142238004 ATGGACTCACAGTTCCATGTGGG - Intergenic
1199228547 X:145408676-145408698 ATGGACTCACAGTTCCACATGGG - Intergenic
1200008588 X:153104593-153104615 ATGGACTCACAGTTCCATGTAGG - Intergenic
1201596663 Y:15677948-15677970 ATGGACTCATAGTTCCACGTGGG - Intergenic