ID: 1176173693

View in Genome Browser
Species Human (GRCh38)
Location 20:63707925-63707947
Sequence GGCGCCGCGCGGGGTTAGCG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 96}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176173693_1176173699 -10 Left 1176173693 20:63707925-63707947 CCGCGCTAACCCCGCGCGGCGCC 0: 1
1: 0
2: 1
3: 4
4: 96
Right 1176173699 20:63707938-63707960 GCGCGGCGCCTGACGGGACGCGG 0: 1
1: 0
2: 0
3: 4
4: 104
1176173693_1176173704 3 Left 1176173693 20:63707925-63707947 CCGCGCTAACCCCGCGCGGCGCC 0: 1
1: 0
2: 1
3: 4
4: 96
Right 1176173704 20:63707951-63707973 CGGGACGCGGGCCGGCCTCAGGG 0: 1
1: 0
2: 0
3: 5
4: 94
1176173693_1176173707 28 Left 1176173693 20:63707925-63707947 CCGCGCTAACCCCGCGCGGCGCC 0: 1
1: 0
2: 1
3: 4
4: 96
Right 1176173707 20:63707976-63707998 TGAGCTGAACCGCGTCCCAGCGG 0: 1
1: 0
2: 0
3: 0
4: 59
1176173693_1176173703 2 Left 1176173693 20:63707925-63707947 CCGCGCTAACCCCGCGCGGCGCC 0: 1
1: 0
2: 1
3: 4
4: 96
Right 1176173703 20:63707950-63707972 ACGGGACGCGGGCCGGCCTCAGG 0: 1
1: 0
2: 0
3: 4
4: 81
1176173693_1176173701 -5 Left 1176173693 20:63707925-63707947 CCGCGCTAACCCCGCGCGGCGCC 0: 1
1: 0
2: 1
3: 4
4: 96
Right 1176173701 20:63707943-63707965 GCGCCTGACGGGACGCGGGCCGG 0: 1
1: 0
2: 1
3: 11
4: 102
1176173693_1176173700 -9 Left 1176173693 20:63707925-63707947 CCGCGCTAACCCCGCGCGGCGCC 0: 1
1: 0
2: 1
3: 4
4: 96
Right 1176173700 20:63707939-63707961 CGCGGCGCCTGACGGGACGCGGG 0: 1
1: 0
2: 0
3: 2
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176173693 Original CRISPR GGCGCCGCGCGGGGTTAGCG CGG (reversed) Exonic
900913415 1:5617963-5617985 GGCGCCTGGCGGGGTTAAGGAGG - Intergenic
919101805 1:193105353-193105375 GGCGCCGCGCGGCGCTGGCGGGG - Intronic
924052283 1:240091755-240091777 GGAGCCGCGCGGGGGCAGAGGGG + Intronic
924561118 1:245156687-245156709 AGCGCCGCGCGGGGCTGGCTGGG + Intronic
1072706920 10:97687436-97687458 GGCGCCGCGCGGGGGCGGAGAGG - Intergenic
1075369946 10:121927682-121927704 GCCGCGGCGCCGGCTTAGCGGGG - Intronic
1077386268 11:2270907-2270929 GGCTGCGCGCGGGGTTAGGGTGG - Exonic
1084328124 11:68413607-68413629 GGCGCCCTGCGGGGTGAGCCAGG - Intronic
1084336495 11:68460858-68460880 GCCGCGGCGCGGGGTGTGCGAGG + Intronic
1084707996 11:70826824-70826846 GGCACCGCGGAGGGTTAACGCGG + Intronic
1090285252 11:125494862-125494884 GAGGCCCAGCGGGGTTAGCGTGG - Intronic
1092810408 12:12266984-12267006 GGAGCTGCGCGGGGGAAGCGGGG - Intronic
1094536085 12:31324168-31324190 GGCGCCGGGCCGGGCTGGCGCGG - Intronic
1103377616 12:120469289-120469311 GGCGCCGTGAGGGGTCTGCGCGG + Intronic
1103433055 12:120904208-120904230 GGCCCCGCGCGCAGTGAGCGCGG - Exonic
1105413955 13:20193194-20193216 GGCGGCGCTCGGGGTAACCGGGG - Intergenic
1105512262 13:21061046-21061068 GGCGTCGGGCGGGGGCAGCGGGG - Intronic
1117157041 14:52951273-52951295 GGGGCGGCGCGGGGGTGGCGGGG + Intronic
1117478165 14:56118295-56118317 GGGGCCGCGCGGGGGAGGCGGGG - Intronic
1122635337 14:103127093-103127115 GGCGGCGGGCGGTGTGAGCGAGG + Exonic
1122697501 14:103563112-103563134 GGCGCCCAGCGGGGTAAGCAGGG + Exonic
1131827035 15:96330459-96330481 GGCGCGGCGCGGGGCACGCGGGG - Intronic
1132641811 16:981589-981611 GGCGCCGGGCGGGGCAGGCGGGG + Intergenic
1132844295 16:1992839-1992861 TGCGCGGGGCGGGGTCAGCGGGG - Intronic
1132847992 16:2009486-2009508 GGCGCGGCCCGGGGGCAGCGGGG - Intronic
1132947129 16:2537945-2537967 GGCGCCGCGCGGGGGCGGGGCGG + Exonic
1142429826 16:90019800-90019822 GGCGCCCCTCGGGGCTGGCGAGG + Intronic
1146885039 17:36464845-36464867 GGCGCCGATCCGGGTTAGCCAGG + Intergenic
1147315344 17:39617765-39617787 GGCGCGGGGCGGGGGTGGCGAGG - Intergenic
1148899567 17:50866022-50866044 GGCGCCGGGCGGGGTCGGCGAGG - Intronic
1150108254 17:62478113-62478135 GGCGACGCGCGGGGCTGGGGCGG + Intronic
1150267888 17:63842618-63842640 GCCGCCGCCAGGGCTTAGCGGGG + Exonic
1153457350 18:5295640-5295662 GGCGCGGCGCGGTGCGAGCGGGG - Intronic
1157794114 18:50559642-50559664 GCAGCCGCGCGGGGCTGGCGGGG + Intergenic
1160738695 19:676302-676324 GGCGCGGCGCGGGAGTGGCGGGG - Intergenic
1161089572 19:2353178-2353200 GGCGCCAGGCTGGGTTACCGGGG - Exonic
1161307207 19:3574600-3574622 GGCGCCGAGCAGGGCTGGCGGGG + Intronic
1166354757 19:42220393-42220415 GGCGCCGCGCGGGGCTGGACTGG + Intronic
1166791704 19:45402630-45402652 GGCGGGGCGCGGGGGTGGCGCGG + Intronic
1167257997 19:48442677-48442699 GCCGCGGCGCGGGGTACGCGGGG - Exonic
929460828 2:42101296-42101318 GGCGCGGCGGAGGGTGAGCGGGG - Intergenic
931355771 2:61537252-61537274 GGCCCCGCGCGGGGTGGGAGGGG - Intronic
931879849 2:66556927-66556949 GGCGCAGAGAGGGGGTAGCGGGG + Intronic
932343166 2:70979168-70979190 AGCGCGGGGCGGGGTGAGCGAGG - Exonic
936396928 2:112138458-112138480 GGCGCCGCCCGGGCCTTGCGAGG - Exonic
937930959 2:127204970-127204992 GGCGCCGGGCTGGCTTAGCTTGG - Intronic
947641038 2:231708050-231708072 GGCACCGCCCGGGGCGAGCGCGG + Intronic
948764006 2:240210348-240210370 GGCCCCTCGCGGGGTCAGCTCGG - Intergenic
1168777838 20:462547-462569 GGCGCGGGGCGGGGCCAGCGGGG - Exonic
1169195977 20:3682160-3682182 GGCTCCGAGCGGGGTTGGCGGGG - Exonic
1175873812 20:62220299-62220321 GGCGCTGCGCGGGGCGCGCGGGG - Intergenic
1176132710 20:63503047-63503069 GGGGCCGGGAGGGGCTAGCGGGG - Intergenic
1176173693 20:63707925-63707947 GGCGCCGCGCGGGGTTAGCGCGG - Exonic
1176685049 21:9839528-9839550 ACCGCCGCGCGGTGTCAGCGAGG + Intergenic
1180236037 21:46459556-46459578 GGGGCCGCGCGGGGTTCCGGGGG - Intronic
1183702483 22:39457934-39457956 GGCGCGGCGCGGGGCTGGGGTGG + Intronic
1184086813 22:42270413-42270435 GGCGCTGCGCGGGGTGGGGGTGG + Intronic
1184265280 22:43343063-43343085 GGGGCCGCGCGGGGCGAGCTCGG + Intronic
1185285887 22:49999727-49999749 GGCGGGGCGCGGGGTGGGCGGGG + Intronic
950487796 3:13283075-13283097 GGCGCGGCGCGGGGCTGCCGCGG + Intergenic
952867227 3:37862119-37862141 GGCGCGGCGCGGGGGGCGCGGGG - Intronic
954618769 3:51984042-51984064 GGCGCTGCGCGTGGTGAGCTGGG - Exonic
960577136 3:119240776-119240798 GGCGCCGTGCGAGGGTAGCCGGG - Intronic
962770879 3:138609094-138609116 GGCGGCGGGCGGTGTTTGCGCGG + Intronic
968148259 3:196317925-196317947 GGGGACGCGCGGGGTCCGCGGGG - Intronic
968493286 4:901811-901833 GGCGCCGCTCCCGATTAGCGAGG + Intronic
968879846 4:3293203-3293225 GGCGCCGCGCAGGGCTGGCCGGG - Intronic
969288381 4:6222368-6222390 GGCGCCGGGCGGAGATGGCGGGG - Intergenic
971351871 4:25862807-25862829 GGCGCGGCGCGGGGCTCGGGTGG - Exonic
981660297 4:147158411-147158433 GGCGCCGAGCGGGGTCAGCGGGG + Intergenic
985783359 5:1882118-1882140 GGCGGCGCGCGGGATTGGCAAGG - Intronic
988547712 5:32174008-32174030 GGAGCTGCGCTGGGTCAGCGAGG + Exonic
999322636 5:150624796-150624818 GGCGCGGGGCGGGGGTGGCGGGG + Intronic
1002524367 5:179807035-179807057 GGCGCCGCGAGGGGGTGGGGTGG + Intronic
1003065917 6:2903402-2903424 GGCGCCGCGCGTGGTGGCCGAGG + Intergenic
1005303730 6:24494879-24494901 GGGGACGCGCGGGGAAAGCGTGG - Intronic
1007702213 6:43771892-43771914 GGGGACGGGCGGGGTTGGCGCGG - Intronic
1007779842 6:44246511-44246533 GGCGCCGGCCGGGGCTGGCGGGG - Intronic
1008659513 6:53651912-53651934 GGGGCCGCGCGGGGAGCGCGTGG - Exonic
1012059378 6:94459336-94459358 GGTGGGGCGTGGGGTTAGCGGGG - Intergenic
1013070095 6:106721304-106721326 GGCGCAGTGCGGGGTTGGTGGGG + Intergenic
1013070271 6:106723011-106723033 GGCGCAGTGCGGGGTTGGTGGGG - Intergenic
1013575701 6:111482541-111482563 GGCGCCGCGCAGCGCTCGCGCGG + Intronic
1017880557 6:158560013-158560035 GGCGCGGCGCGGTGGAAGCGGGG - Intronic
1032037300 7:128530647-128530669 GGCGACGCGCGGGGCTGGGGCGG + Intergenic
1033099849 7:138460623-138460645 GGCGCCGAGCGGGGAGAACGAGG + Exonic
1039608386 8:38901105-38901127 GGGGCCGCGCGGGGGAGGCGGGG - Intergenic
1042155556 8:65841518-65841540 GGCGCCGCGCGGAGGCAGGGCGG - Exonic
1043413818 8:80028659-80028681 GGGGCCGGGCGGGGTCAGCCAGG + Intronic
1049833011 8:144714019-144714041 GGGGCCGCGCGGAGTTTCCGCGG + Intergenic
1050357059 9:4793241-4793263 GGCGGCGCGCGGCGTGGGCGCGG + Intronic
1057146860 9:92764464-92764486 GGCGCCGGGCGGGGGTCGCAGGG + Intronic
1061075787 9:128340667-128340689 GGCGGCGGGCGGGGCTGGCGGGG + Intronic
1061559826 9:131394748-131394770 GGCGCTGAGCGGCGTTCGCGGGG + Intronic
1062364363 9:136201981-136202003 GGCGCGGCGCGGGGTGGGCTGGG - Intronic
1062579272 9:137222310-137222332 GGACCCGCGCGGGGTCCGCGGGG + Intergenic
1062606165 9:137349769-137349791 GGGGCTGGGCGGGGTTACCGTGG - Intronic
1185605493 X:1365947-1365969 CGCGGTGCGCGGGGTGAGCGGGG + Intronic
1185605707 X:1366593-1366615 CGCGGTGCGCGGGGTGAGCGGGG + Intronic
1200256435 X:154585381-154585403 GGCGCCCCGCGGGGTCCGCATGG + Exonic
1200261334 X:154619022-154619044 GGCGCCCCGCGGGGTCCGCATGG - Exonic
1200267319 X:154653319-154653341 GGCGCCCCGCGGGGTCCGCATGG - Exonic