ID: 1176175445

View in Genome Browser
Species Human (GRCh38)
Location 20:63721072-63721094
Sequence CAGGCGTGAGCCACTGCGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 446854
Summary {0: 9533, 1: 58782, 2: 109662, 3: 131093, 4: 137784}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176175445_1176175453 8 Left 1176175445 20:63721072-63721094 CCGGGCGCAGTGGCTCACGCCTG 0: 9533
1: 58782
2: 109662
3: 131093
4: 137784
Right 1176175453 20:63721103-63721125 GGACTTTGGGAAGTGGAGGCGGG 0: 2
1: 63
2: 1234
3: 15590
4: 184685
1176175445_1176175455 22 Left 1176175445 20:63721072-63721094 CCGGGCGCAGTGGCTCACGCCTG 0: 9533
1: 58782
2: 109662
3: 131093
4: 137784
Right 1176175455 20:63721117-63721139 GGAGGCGGGTGGATCACTTGAGG 0: 100
1: 4275
2: 30983
3: 81297
4: 109874
1176175445_1176175452 7 Left 1176175445 20:63721072-63721094 CCGGGCGCAGTGGCTCACGCCTG 0: 9533
1: 58782
2: 109662
3: 131093
4: 137784
Right 1176175452 20:63721102-63721124 AGGACTTTGGGAAGTGGAGGCGG 0: 1
1: 51
2: 1250
3: 15287
4: 181175
1176175445_1176175450 1 Left 1176175445 20:63721072-63721094 CCGGGCGCAGTGGCTCACGCCTG 0: 9533
1: 58782
2: 109662
3: 131093
4: 137784
Right 1176175450 20:63721096-63721118 AATGCTAGGACTTTGGGAAGTGG 0: 1
1: 1
2: 30
3: 679
4: 5227
1176175445_1176175456 27 Left 1176175445 20:63721072-63721094 CCGGGCGCAGTGGCTCACGCCTG 0: 9533
1: 58782
2: 109662
3: 131093
4: 137784
Right 1176175456 20:63721122-63721144 CGGGTGGATCACTTGAGGTCAGG 0: 4653
1: 35878
2: 90596
3: 118759
4: 133049
1176175445_1176175447 -6 Left 1176175445 20:63721072-63721094 CCGGGCGCAGTGGCTCACGCCTG 0: 9533
1: 58782
2: 109662
3: 131093
4: 137784
Right 1176175447 20:63721089-63721111 CGCCTGTAATGCTAGGACTTTGG 0: 2
1: 130
2: 10682
3: 161586
4: 304318
1176175445_1176175451 4 Left 1176175445 20:63721072-63721094 CCGGGCGCAGTGGCTCACGCCTG 0: 9533
1: 58782
2: 109662
3: 131093
4: 137784
Right 1176175451 20:63721099-63721121 GCTAGGACTTTGGGAAGTGGAGG 0: 1
1: 0
2: 17
3: 338
4: 4616
1176175445_1176175454 11 Left 1176175445 20:63721072-63721094 CCGGGCGCAGTGGCTCACGCCTG 0: 9533
1: 58782
2: 109662
3: 131093
4: 137784
Right 1176175454 20:63721106-63721128 CTTTGGGAAGTGGAGGCGGGTGG 0: 10
1: 340
2: 5093
3: 77913
4: 188256
1176175445_1176175448 -5 Left 1176175445 20:63721072-63721094 CCGGGCGCAGTGGCTCACGCCTG 0: 9533
1: 58782
2: 109662
3: 131093
4: 137784
Right 1176175448 20:63721090-63721112 GCCTGTAATGCTAGGACTTTGGG 0: 3
1: 308
2: 22073
3: 267746
4: 281501

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176175445 Original CRISPR CAGGCGTGAGCCACTGCGCC CGG (reversed) Intronic
Too many off-targets to display for this crispr