ID: 1176175450

View in Genome Browser
Species Human (GRCh38)
Location 20:63721096-63721118
Sequence AATGCTAGGACTTTGGGAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5938
Summary {0: 1, 1: 1, 2: 30, 3: 679, 4: 5227}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176175445_1176175450 1 Left 1176175445 20:63721072-63721094 CCGGGCGCAGTGGCTCACGCCTG 0: 9533
1: 58782
2: 109662
3: 131093
4: 137784
Right 1176175450 20:63721096-63721118 AATGCTAGGACTTTGGGAAGTGG 0: 1
1: 1
2: 30
3: 679
4: 5227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176175450 Original CRISPR AATGCTAGGACTTTGGGAAG TGG Intronic
Too many off-targets to display for this crispr