ID: 1176177310

View in Genome Browser
Species Human (GRCh38)
Location 20:63734895-63734917
Sequence TCCCGGGGTCCCGCAGCCAT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 110}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176177303_1176177310 0 Left 1176177303 20:63734872-63734894 CCCAGGTCCAGCAGCCATCAGGT 0: 1
1: 0
2: 1
3: 20
4: 271
Right 1176177310 20:63734895-63734917 TCCCGGGGTCCCGCAGCCATCGG 0: 1
1: 0
2: 0
3: 5
4: 110
1176177306_1176177310 -7 Left 1176177306 20:63734879-63734901 CCAGCAGCCATCAGGTTCCCGGG 0: 1
1: 0
2: 2
3: 18
4: 154
Right 1176177310 20:63734895-63734917 TCCCGGGGTCCCGCAGCCATCGG 0: 1
1: 0
2: 0
3: 5
4: 110
1176177304_1176177310 -1 Left 1176177304 20:63734873-63734895 CCAGGTCCAGCAGCCATCAGGTT 0: 1
1: 0
2: 3
3: 10
4: 126
Right 1176177310 20:63734895-63734917 TCCCGGGGTCCCGCAGCCATCGG 0: 1
1: 0
2: 0
3: 5
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176177310 Original CRISPR TCCCGGGGTCCCGCAGCCAT CGG Intronic
900768319 1:4520334-4520356 ACCCTGGGTCCCTGAGCCATGGG - Intergenic
900807399 1:4776444-4776466 TCCCGGAGCCAGGCAGCCATCGG - Intronic
901685483 1:10941225-10941247 TGCTGGGGTCCCTCAGCCATAGG - Intergenic
902191692 1:14767727-14767749 TCCCTGCGGCCTGCAGCCATGGG + Intronic
906513361 1:46424036-46424058 TCCCGGAGGCCCCCAGCCACAGG + Intergenic
907306240 1:53514628-53514650 TCCCGGGTGCTCTCAGCCATGGG + Exonic
914900558 1:151709115-151709137 CCGCGGGGTCCCGCAGGGATGGG - Intronic
915299711 1:154945064-154945086 TCCCTGGGCCCCGCAGCTCTTGG + Exonic
916075303 1:161197133-161197155 TCTGGGGCTCCCGCAGCCCTGGG - Intronic
917929382 1:179813196-179813218 TCCCCGGGACCCGTAGCCAGAGG + Intronic
919778404 1:201208326-201208348 TCTGGGGGTCCAGGAGCCATGGG + Exonic
919790069 1:201284884-201284906 TCCCAGGTTCCCCCAGTCATGGG - Intronic
920666293 1:207964866-207964888 TCCCAGGGGCCTGCAGCCAGAGG - Intergenic
1063657806 10:8009250-8009272 TCCCCGGGTCCCGCCGCCTCCGG + Exonic
1066429474 10:35337350-35337372 GCCCGGGGCCCCGCAGCCTCTGG + Intronic
1069900788 10:71705544-71705566 TCCAGGGGTTCCACACCCATGGG - Intronic
1075522877 10:123154617-123154639 TCCCGGGGTCCCGTCGCCCCGGG - Intronic
1075616003 10:123891460-123891482 TCCCCGGGCCCCGCAGGCAGCGG + Exonic
1076296760 10:129391728-129391750 TCCCGGGGCCCCACAGCCCCAGG + Intergenic
1076889523 10:133276912-133276934 CCCCGGCGCCCCGCAGCCAATGG + Intergenic
1077162298 11:1119374-1119396 TCCCGGGCTCCCCCAGCAACGGG - Intergenic
1077399133 11:2344643-2344665 TCCCGGAGTCCCCCAGCCCTGGG - Intergenic
1083843151 11:65315776-65315798 TCCCGGGGTCCCGGTGCCTCCGG - Intronic
1090908048 11:131094609-131094631 GCCCAGGGTCCCACAGGCATGGG + Intergenic
1091439603 12:502280-502302 TCCCAGCGTCCTGCAGCCCTCGG + Intronic
1101427416 12:104599358-104599380 CCGCGCGGTCCCGGAGCCATGGG + Intronic
1103294793 12:119877104-119877126 TCCAGGCCTCCCGCAGCCCTGGG + Intronic
1104775442 12:131387816-131387838 TCCCGTGGTCCCCCAGCCCACGG - Intergenic
1112301539 13:98235276-98235298 TCCCTGGGGCCCACAGCCTTGGG - Intronic
1113664383 13:112131295-112131317 CCACGGGGTCCCCCAGCCACGGG + Intergenic
1118797091 14:69153257-69153279 TCTCGGGGCCCCGCAGCCGGCGG - Intergenic
1121246125 14:92462080-92462102 TCCCCGAGTCACACAGCCATTGG + Intronic
1121337610 14:93086807-93086829 TCCTGGGGCCCCCCAGCCACAGG + Intronic
1123056468 14:105572875-105572897 TCCTGGGGCCCAGCAGCCGTGGG + Intergenic
1123057465 14:105578932-105578954 TCCTGGGGCCCAGCAGCCGTGGG - Intergenic
1123080901 14:105693003-105693025 TCCTGGGGCCCAGCAGCCGTGGG + Intergenic
1123081741 14:105698865-105698887 TCCTGGGGCCCAGCAGCCGTGGG - Intergenic
1123710226 15:22980888-22980910 TCCCTGGTTCCCGCAGGCAATGG - Intronic
1128124852 15:65184996-65185018 TCCCCGGGGCCCCCAACCATTGG + Intronic
1132986527 16:2770345-2770367 TCCCCAGGTCCCGCAGCCCCCGG + Exonic
1134343756 16:13370150-13370172 TCCCGGGGTGCCACGACCATGGG + Intergenic
1136020337 16:27436135-27436157 TCCCGGGGTCTCAAAACCATGGG - Intronic
1138555744 16:57770386-57770408 GCCCTGGGTCCCGTGGCCATCGG + Intronic
1141165271 16:81656199-81656221 TCACGGCCTCCCGCAGCCCTCGG + Intronic
1141832262 16:86516328-86516350 TTGCGGCGTCCCGCAGCCGTGGG - Intergenic
1143363215 17:6388093-6388115 TCCCTGGGTCCCTGAGCCAGAGG + Intergenic
1146843452 17:36169551-36169573 GCCCGGGCTCCTGCTGCCATCGG - Intronic
1146864860 17:36330886-36330908 GCCCGGGCTCCTGCTGCCATCGG + Intronic
1146871667 17:36381400-36381422 GCCCGGGCTCCTGCTGCCATCGG - Intronic
1146879026 17:36432482-36432504 GCCCGGGCTCCTGCTGCCATCGG - Intronic
1146882967 17:36453628-36453650 GCCCGGGCTCCTGCTGCCATCGG - Intergenic
1147067719 17:37931480-37931502 GCCCGGGCTCCTGCTGCCATCGG + Intronic
1147074553 17:37982024-37982046 GCCCGGGCTCCTGCTGCCATCGG - Intronic
1147079250 17:38011035-38011057 GCCCGGGCTCCTGCTGCCATCGG + Intronic
1147086076 17:38061563-38061585 GCCCGGGCTCCTGCTGCCATCGG - Intronic
1147095189 17:38134977-38134999 GCCCGGGCTCCTGCTGCCATCGG + Intergenic
1147102021 17:38185528-38185550 GCCCGGGCTCCTGCTGCCATCGG - Intergenic
1148106087 17:45119769-45119791 CCCAGGGGTCCAGCTGCCATGGG + Intronic
1148461419 17:47841046-47841068 TCCGGGGGTCCCGCCCCCACTGG + Intronic
1149396008 17:56244466-56244488 TCTCAGGGTCCAGCAGCCAAAGG + Intronic
1149602103 17:57899687-57899709 TCCCAGGCCCTCGCAGCCATAGG + Intronic
1149846612 17:60012038-60012060 GCCCGGGCTCCTGCTGCCATCGG - Intergenic
1150084959 17:62268613-62268635 GCCCGGGCTCCTGCCGCCATCGG - Intergenic
1152632512 17:81416936-81416958 TCCCTGGGCACAGCAGCCATAGG - Intronic
1154001766 18:10487713-10487735 GCCCAGGGCCACGCAGCCATTGG - Exonic
1161031142 19:2058249-2058271 TCCTAGGGTCCCACAGCCACTGG + Intergenic
1161353045 19:3804337-3804359 TCCCCGGGTCCCCCAGGCACGGG + Exonic
1161356635 19:3822875-3822897 TCCCAGGGTCCCGCAGGCCCAGG + Intronic
1162964798 19:14150741-14150763 TCCAGGTGCCCCTCAGCCATGGG - Exonic
925065597 2:927214-927236 TCCCGGGGTCCTGCCTGCATTGG - Intergenic
925065683 2:927579-927601 TCCCGGGGTCCTGCCTGCATTGG - Intergenic
925065694 2:927630-927652 TCCCGGGGTCCTGCCTGCATTGG - Intergenic
925065709 2:927681-927703 TCCCGGGGTCCTGCCTGCATTGG - Intergenic
927552263 2:24010488-24010510 TCCCGGGGTCCCCGAGCTCTGGG + Intronic
932457589 2:71859120-71859142 TCCCTGGGCCCCTCAGCCAGTGG - Intergenic
941570921 2:167169334-167169356 TCCCAGGGCCACGCAGTCATAGG - Intronic
945319608 2:208406662-208406684 TCACTGGGTCCCGCAGCCCAGGG - Intronic
948059029 2:235030229-235030251 TCCAGGGGCCCAGCAGCCACTGG + Intronic
948592962 2:239063106-239063128 TCCCGGGGTCACGCACCCAGGGG + Intronic
948715096 2:239856078-239856100 TCCTGGGTTCCCGAAGCCACAGG - Intergenic
948889354 2:240899376-240899398 TCCCGGAGTACTGCAGGCATTGG - Intergenic
949018096 2:241724884-241724906 TGCCGGCGTCCAGCAGCCCTGGG + Intronic
1171043927 20:21792683-21792705 ACCTGGGGTCCAGCTGCCATGGG + Intergenic
1175897538 20:62346026-62346048 TCCCGGAGTCCAGCAGGCAGTGG + Intronic
1175996011 20:62812669-62812691 TCCAGGGGTCCCGCATCCTGGGG - Exonic
1176177310 20:63734895-63734917 TCCCGGGGTCCCGCAGCCATCGG + Intronic
1178680260 21:34668586-34668608 TCCGGGGGCCCTGCAGACATGGG + Intergenic
1180179146 21:46110169-46110191 TCCCTGGGGGCCGCTGCCATGGG - Intronic
1183226456 22:36553521-36553543 TCCCGGGGTCCCCAATCCCTGGG - Intergenic
953476439 3:43209614-43209636 TCCCTGCATCCCCCAGCCATTGG + Intergenic
962301870 3:134250589-134250611 TCCCGGGGGCCCGCGGCCTGAGG - Exonic
966887080 3:184382746-184382768 TCCTGGGTTCCAGCAGCCCTCGG - Exonic
971907688 4:32748370-32748392 TCCCGGAGTCCCGCCGCCCAGGG - Intergenic
984929602 4:184835084-184835106 TCCTGGGGTCCTGCCCCCATAGG - Intergenic
985156878 4:186998765-186998787 TCCCAGTGACCCGCAGCCAATGG + Intergenic
991972823 5:72157516-72157538 TCCCGGGGACAGGGAGCCATGGG + Intronic
992106334 5:73451599-73451621 TCCCGGGCCCCCGCAGCCGGTGG - Intergenic
998383666 5:141743544-141743566 TCCCAGGCTCCCTCAGCCCTTGG + Intergenic
999238292 5:150113093-150113115 TGCCGGGGTCCCACAGGCCTGGG + Intronic
1005685728 6:28251775-28251797 TCGCGGGGGCCCGCAGCCTCCGG + Exonic
1014480608 6:121931982-121932004 TCCCTGGATCCCACAGCTATAGG - Intergenic
1019516407 7:1442142-1442164 CCCCGGGGGCCCGCAGCTCTGGG - Intronic
1022036522 7:26539820-26539842 TCCCAAGGTCCTGCAGCCTTGGG + Intergenic
1029423918 7:100485224-100485246 TCCCTGGGTCCCGGATCCACTGG - Exonic
1032520364 7:132539143-132539165 TCCCTGTGTCCCACAGCCCTGGG - Intronic
1033756559 7:144401555-144401577 TCCCCGGGTCCTGCAGCCAGGGG + Exonic
1034218105 7:149423031-149423053 TCCCGGTGTGCCGCTGCCGTAGG + Intergenic
1036078374 8:5525498-5525520 TCCCTGAGTCCCGCAGCCTCTGG - Intergenic
1038844176 8:31213542-31213564 TCCCTGGGTCCTGGAGCCCTTGG + Intergenic
1053114548 9:35489916-35489938 TCCCCGGCTCCCGCAGCGATGGG - Intergenic
1053751723 9:41263785-41263807 TCACTGGGTCCCACACCCATAGG - Intergenic
1056143012 9:83702136-83702158 TCCCTGGGCCCCCCAGCCTTAGG - Intronic
1059489871 9:114658154-114658176 TCCTGGGGTTCTGCTGCCATAGG - Intergenic
1062268910 9:135699900-135699922 TCCCTGGGTCCCCCAGGCCTGGG - Intergenic
1191164903 X:57378677-57378699 TCCTGGGCTCCCACAGCCAAGGG - Exonic
1197760642 X:130025455-130025477 TCTCTGGGTCCCGAAGCCTTTGG - Intronic