ID: 1176178387

View in Genome Browser
Species Human (GRCh38)
Location 20:63739021-63739043
Sequence CCGCGGCTGTCAGAGCGGCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 127}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176178387_1176178393 -1 Left 1176178387 20:63739021-63739043 CCTGGCCGCTCTGACAGCCGCGG 0: 1
1: 0
2: 0
3: 10
4: 127
Right 1176178393 20:63739043-63739065 GCCTCCCCGGGCTCCAGAGAAGG 0: 1
1: 0
2: 0
3: 22
4: 279
1176178387_1176178401 28 Left 1176178387 20:63739021-63739043 CCTGGCCGCTCTGACAGCCGCGG 0: 1
1: 0
2: 0
3: 10
4: 127
Right 1176178401 20:63739072-63739094 TCTAAATAAAGCGCCAGCGCAGG 0: 1
1: 0
2: 0
3: 0
4: 28

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176178387 Original CRISPR CCGCGGCTGTCAGAGCGGCC AGG (reversed) Exonic
902694464 1:18130953-18130975 CCGAGGCTGTCAGAGCTGAGGGG - Intronic
920705000 1:208244281-208244303 CCGCGGGAGCCAGAGCTGCCGGG - Exonic
1063660961 10:8034889-8034911 CCAGGGCTGCCAGCGCGGCCGGG + Intergenic
1068620574 10:59176952-59176974 CCGGGACGGTAAGAGCGGCCGGG + Exonic
1074503096 10:114043882-114043904 CCGCTGCTGGAAGAGCCGCCGGG - Intergenic
1076824701 10:132961007-132961029 CCGTGGGTGTCAGAGCCACCAGG + Intergenic
1077202425 11:1317721-1317743 CAGCAGCTGTCAGACTGGCCAGG - Intergenic
1077367828 11:2168286-2168308 CCGGGGCTGTGAGAGCTGCGGGG + Intronic
1079573661 11:21976428-21976450 CCGCGGGTGACAGAGTGGCCAGG - Intergenic
1084654649 11:70508111-70508133 CACAGGCTGTCAGTGCGGCCAGG - Intronic
1087530168 11:99370966-99370988 CAGCAGCTGTCAGAGAGGCAGGG + Intronic
1089612336 11:119676531-119676553 CCCCAGCTGTCAGAGCCGGCTGG + Intronic
1094107918 12:26833163-26833185 CTGCGGCCGTCACAGCCGCCCGG + Exonic
1096744025 12:53713874-53713896 CTGAGTCTGTCAGAGCTGCCGGG + Exonic
1101531880 12:105580828-105580850 GCCAGGCTGTCAGAGAGGCCAGG - Intergenic
1102536079 12:113582627-113582649 CCCCGGGTGTCAGTGCGGCTGGG - Intergenic
1104041426 12:125133792-125133814 CCGGCGGTGTCAGAGCTGCCCGG + Intronic
1104676636 12:130715801-130715823 CCGCTGCTGTCTGAGAAGCCTGG + Intronic
1104902443 12:132196805-132196827 CGGCGGCTGTCCCAGCAGCCTGG + Exonic
1105022856 12:132828802-132828824 CCGGGGCTGCCAGAGCAGCAGGG - Intronic
1105512212 13:21060864-21060886 CCGAGGCTGTCAGGGGCGCCCGG + Intronic
1105543947 13:21338412-21338434 CTGCTGCTGTCAGAGATGCCAGG - Intergenic
1108291306 13:48964237-48964259 CCTCAGCTTTCAGAGCGGCTGGG + Intergenic
1110363136 13:74650547-74650569 CAGCAGCTGGCAGAGCAGCCTGG - Intergenic
1110443381 13:75549783-75549805 CGGCGGCTGTCAGAGCTGGAGGG + Exonic
1113967340 13:114161480-114161502 CCGCGGCGGCCACAGCGGCGGGG + Intergenic
1114836236 14:26205426-26205448 CCGAGGCTGTCAGACTGGCAAGG - Intergenic
1115761639 14:36582554-36582576 CCTCGGCTTTCAAAGCGGCCTGG - Exonic
1121183605 14:91947768-91947790 GCGGGGCTGGCAGCGCGGCCCGG + Exonic
1123035587 14:105470623-105470645 CCGCGGCCGGCCGAGCTGCCTGG + Exonic
1124721161 15:32112023-32112045 ACACGGCTTTCCGAGCGGCCAGG + Intronic
1131462129 15:92624835-92624857 CTGCGCCTGTCACAGCTGCCGGG + Intronic
1132255606 15:100373597-100373619 CCGCGGCTGTCGGGGTGGCCTGG + Intergenic
1133330042 16:4967222-4967244 CCGAGGCTGGGAGAGAGGCCAGG - Intronic
1136498873 16:30659813-30659835 CCGCGGCTGCCCGAGCCGGCAGG - Exonic
1140219595 16:73033907-73033929 CAGATGCTTTCAGAGCGGCCGGG - Intronic
1147184528 17:38706020-38706042 CCGCGGGTGTCGGGGCTGCCTGG + Intronic
1147559903 17:41502307-41502329 CCGTGGGTGTCAGAGCAGGCAGG - Intronic
1148636361 17:49152124-49152146 CCTCAGCTGTCAGAGAAGCCAGG - Intronic
1150007239 17:61477365-61477387 GCGCGGCTGCCAGAGCCCCCGGG - Intronic
1151370328 17:73643464-73643486 CAGCGGCTGGCCGAGCAGCCAGG + Intronic
1151954187 17:77372618-77372640 ACACGGCTGTCAGAGAAGCCAGG - Intronic
1153457370 18:5295728-5295750 CGGCGGCTGGCGGGGCGGCCCGG - Intronic
1153480688 18:5543659-5543681 CCGCGGCGGGCGGAGCGGGCGGG + Intronic
1153596395 18:6729677-6729699 CCGCGGCTGTCAGGGGCCCCCGG - Intergenic
1154070656 18:11149131-11149153 CCCCGGCTCTCGGAGCTGCCCGG + Intergenic
1158434829 18:57428352-57428374 CCGAGGCTGCGAGAGCCGCCTGG + Intergenic
1160733929 19:653269-653291 GCGGGGCTGCCAGAGCGTCCTGG - Intronic
1162931321 19:13959302-13959324 CAGCGGCTGCCAGAGGGTCCTGG - Exonic
1163836216 19:19575911-19575933 CCCCGGCTGTCAGAGCATGCTGG - Intronic
1164177933 19:22793554-22793576 CCGGGCCTGTCAGAGGGGCAAGG - Intergenic
1165850888 19:38849798-38849820 CGGCGGCAGTGAGGGCGGCCGGG - Exonic
1167261628 19:48462201-48462223 CCACGGCGGCCACAGCGGCCGGG - Exonic
1167358580 19:49018208-49018230 CCGCGGTGGTCGGGGCGGCCGGG + Intergenic
1167637291 19:50662341-50662363 CCACGGATGTCAAAGAGGCCTGG + Exonic
1167838438 19:52094730-52094752 CCGCGGCTGACAGAGCTACGTGG - Intronic
1167843159 19:52138868-52138890 CCGCGGCTGACAGAGCCACGTGG - Intronic
1168536187 19:57172341-57172363 CCGCGGCTGTTAGCGCTGCGTGG + Intergenic
1168688434 19:58362524-58362546 CCGCGCCGTCCAGAGCGGCCCGG - Intronic
925616111 2:5745928-5745950 CAGGGGCTGTCAGAACGCCCGGG + Intergenic
928174539 2:29024743-29024765 CCGTGGCTGTGGGAGCGCCCCGG + Intronic
931516090 2:63051423-63051445 TCGGGGCTGTGGGAGCGGCCTGG + Intronic
931695108 2:64865388-64865410 GCGCGGCTCTCGGGGCGGCCGGG + Intergenic
936080514 2:109429651-109429673 CTGGAGCTGTCAGCGCGGCCTGG - Intronic
936836641 2:116718209-116718231 AAGCGGCTGTCTGAGTGGCCTGG + Intergenic
942051910 2:172147911-172147933 TCGGAGCTGTCAGAGCTGCCTGG - Intergenic
945206181 2:207334762-207334784 TTGTGGCTGTCAGAGCAGCCAGG - Intergenic
947418589 2:229922050-229922072 CCGAGGGTGTCAGAGCAGGCGGG - Intronic
947798998 2:232915516-232915538 TGGTGGCTGTCAGAGCGGGCAGG + Intronic
1170883434 20:20317671-20317693 CAGCAGCTGTCAGAGCCGCTGGG - Intronic
1172320789 20:33993903-33993925 GCGCCGCTGTCAGTGCGGCGGGG + Exonic
1172657097 20:36543933-36543955 CGAGGGCTGTCAGAGAGGCCAGG + Intronic
1173526674 20:43738222-43738244 CCGAGGCAGTAAGAGCGGCTGGG + Intergenic
1174265469 20:49328611-49328633 CCGCTGCTGGAAGAGCGGGCTGG + Intergenic
1175575209 20:60055842-60055864 CTGTGGCTGTCAGAGGGGCTGGG + Intergenic
1175777744 20:61663724-61663746 CCGCGTCTGTCAGCCCTGCCTGG - Intronic
1175930768 20:62492818-62492840 CCGCAGCTGCAAGAGAGGCCTGG + Intergenic
1176178387 20:63739021-63739043 CCGCGGCTGTCAGAGCGGCCAGG - Exonic
1178914054 21:36697325-36697347 CGGCAGCTGTCAGCGCAGCCAGG + Intergenic
1179605809 21:42514366-42514388 CCTCAGCTGTCACCGCGGCCCGG - Exonic
1179615756 21:42582235-42582257 CCGCTGGTGTCACAGTGGCCTGG + Intergenic
1182123437 22:27800814-27800836 CCGCGGCTGTGACAACCGCCCGG - Exonic
950829290 3:15859187-15859209 ACCCGCCTGTCAGAGCTGCCGGG - Intronic
954109055 3:48424199-48424221 CTGCTGCGGCCAGAGCGGCCTGG - Exonic
961461353 3:127052304-127052326 CCTCGGCAGGCAGAGCCGCCCGG - Intergenic
961603417 3:128077104-128077126 ATGCGGCTGTCAGGCCGGCCCGG - Intronic
968846016 4:3041916-3041938 CCACTGCTGTCAGGGCTGCCTGG + Intergenic
974047482 4:56908983-56909005 CCGGGGCGGTCGGAGGGGCCCGG + Intronic
976407263 4:84674358-84674380 CCGCGGCTGTGAGACCAGCCTGG + Intronic
982421999 4:155208879-155208901 CCGGAGCAGTCAGAGCGGCTGGG - Exonic
984801773 4:183722858-183722880 CCGCAGCGGTTAGACCGGCCAGG + Intergenic
984952245 4:185016546-185016568 TCGCGGCTGGCAGAGCAACCTGG + Intergenic
985539832 5:482780-482802 CCGCGGCTGGGAGGGCGGCCGGG - Intronic
992052791 5:72956330-72956352 CGGGGGCTGTCACCGCGGCCCGG + Intronic
992078906 5:73216159-73216181 CGGCGGCGGCCAGGGCGGCCAGG + Intergenic
997255792 5:132426999-132427021 CTGAGGCTGGCAGAGGGGCCAGG + Intronic
997393894 5:133540977-133540999 CAGGGGCTGTGAGAGCGGGCTGG - Intronic
998136542 5:139677079-139677101 CCGCGGCTGGCGGGGCGGCGGGG + Intronic
1000036448 5:157452081-157452103 CCGCGGCTGTCACAGGGGAGGGG + Intronic
1002123350 5:177022770-177022792 CCGCGGACGGCGGAGCGGCCGGG + Exonic
1003408141 6:5839968-5839990 CTGCTGCTGTCAGAGATGCCAGG + Intergenic
1004075315 6:12339578-12339600 CAGGGGCTGTGAGAGCAGCCAGG + Intergenic
1006749213 6:36366219-36366241 CTGAGGCTGTCAGTGCCGCCTGG + Exonic
1007406051 6:41637092-41637114 CCGCGGCTAGCAGCCCGGCCTGG + Intronic
1007430759 6:41775419-41775441 CCGCCGATGTCAGACAGGCCAGG - Exonic
1015440603 6:133241952-133241974 CCGCTGCGGTCCGAGCGGCCCGG - Intronic
1019689715 7:2403760-2403782 CCGCGCCCCTCAGCGCGGCCCGG - Intronic
1020017959 7:4842485-4842507 CCGCTGCTGGCAGAGAGGGCAGG + Intronic
1020254866 7:6497468-6497490 CCCAGGCTGTCAGGGGGGCCTGG - Intronic
1021198251 7:17696588-17696610 CCGAGGCACTCAGAGAGGCCAGG + Intergenic
1022113780 7:27246248-27246270 CCTCGCCTGTCACAGCGGCCCGG + Exonic
1026561536 7:71454528-71454550 CCCAGGCTGTCAGAATGGCCTGG - Intronic
1031240921 7:119238263-119238285 CAGCTGCTGTGAGAGGGGCCAGG - Intergenic
1034223065 7:149460381-149460403 GCGCGGCTGTGCGGGCGGCCCGG + Intronic
1036646403 8:10613262-10613284 CCACGGCTGCCAGAAAGGCCTGG - Exonic
1039467885 8:37797041-37797063 GCGCGGCTGTCAGCGCAGCGCGG - Intronic
1039542275 8:38382116-38382138 CTGCGGCTGGCAGCCCGGCCTGG + Exonic
1042383763 8:68150090-68150112 CTGCGGCTATCACAGCAGCCGGG + Intronic
1046208905 8:111041099-111041121 CCGGGGCTGGCAGAGCCGGCCGG + Intergenic
1048833363 8:138496996-138497018 GCGAGGCTGTCAGCGCGGTCGGG + Intergenic
1049639116 8:143706574-143706596 ACGCGGGTGTCAGAGCCGCCTGG + Intronic
1052192858 9:25678380-25678402 TCGGGGCTGGCAGGGCGGCCGGG + Exonic
1055632236 9:78236254-78236276 CCGTGGGTGCCGGAGCGGCCGGG + Exonic
1058684131 9:107465855-107465877 CCGCGCCTGGGAGAGCGGACTGG + Intergenic
1058866644 9:109167160-109167182 CCGCTGCGGCCCGAGCGGCCTGG - Exonic
1060926170 9:127456918-127456940 CCAGGGCTGGCAGAGGGGCCAGG - Intronic
1061141345 9:128769074-128769096 CCGCTGCTGTCAGAAAAGCCAGG + Intronic
1061162329 9:128902543-128902565 GCGCGGCTGTTTGAGCGGGCAGG - Intronic
1061515140 9:131085440-131085462 CAGCCGCTGGCAGAGCTGCCTGG - Intronic
1062266085 9:135687203-135687225 CCCTGGCTGTCAAAGGGGCCTGG - Intergenic
1062520287 9:136954769-136954791 CCGCGGCTGTCTGAGTGGTCAGG - Intronic
1185894216 X:3843684-3843706 GCGCGGCTGACGGAGCGGCGGGG + Exonic
1185899335 X:3882108-3882130 GCGCGGCTGACGGAGCGGCGGGG + Intergenic
1185904452 X:3920537-3920559 GCGCGGCTGACGGAGCGGCGGGG + Intergenic
1187690006 X:21856841-21856863 CCGAGGCCGACAGAGAGGCCAGG - Exonic
1190220378 X:48508980-48509002 CAGCGGCTCCCAGAGCGGCGCGG - Intronic
1200100201 X:153686366-153686388 CCGCGGCTCCCAGAGCTGTCTGG + Intronic
1200215832 X:154367875-154367897 CCGGGACTGGCAGAGCGGCCGGG - Exonic