ID: 1176178693

View in Genome Browser
Species Human (GRCh38)
Location 20:63739938-63739960
Sequence CAGCGCACTGGGGTCCCGGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 157}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176178693_1176178708 15 Left 1176178693 20:63739938-63739960 CCGGCCGGGACCCCAGTGCGCTG 0: 1
1: 0
2: 0
3: 14
4: 157
Right 1176178708 20:63739976-63739998 TGGCTGCGCGCGGAGGGTCCGGG 0: 1
1: 0
2: 0
3: 13
4: 171
1176178693_1176178703 5 Left 1176178693 20:63739938-63739960 CCGGCCGGGACCCCAGTGCGCTG 0: 1
1: 0
2: 0
3: 14
4: 157
Right 1176178703 20:63739966-63739988 CGAGGCGCCGTGGCTGCGCGCGG 0: 1
1: 0
2: 1
3: 9
4: 117
1176178693_1176178704 8 Left 1176178693 20:63739938-63739960 CCGGCCGGGACCCCAGTGCGCTG 0: 1
1: 0
2: 0
3: 14
4: 157
Right 1176178704 20:63739969-63739991 GGCGCCGTGGCTGCGCGCGGAGG 0: 1
1: 0
2: 2
3: 29
4: 390
1176178693_1176178701 -5 Left 1176178693 20:63739938-63739960 CCGGCCGGGACCCCAGTGCGCTG 0: 1
1: 0
2: 0
3: 14
4: 157
Right 1176178701 20:63739956-63739978 CGCTGCGGGCCGAGGCGCCGTGG 0: 1
1: 0
2: 0
3: 24
4: 217
1176178693_1176178705 9 Left 1176178693 20:63739938-63739960 CCGGCCGGGACCCCAGTGCGCTG 0: 1
1: 0
2: 0
3: 14
4: 157
Right 1176178705 20:63739970-63739992 GCGCCGTGGCTGCGCGCGGAGGG 0: 1
1: 0
2: 1
3: 7
4: 101
1176178693_1176178709 16 Left 1176178693 20:63739938-63739960 CCGGCCGGGACCCCAGTGCGCTG 0: 1
1: 0
2: 0
3: 14
4: 157
Right 1176178709 20:63739977-63739999 GGCTGCGCGCGGAGGGTCCGGGG 0: 1
1: 0
2: 1
3: 14
4: 202
1176178693_1176178707 14 Left 1176178693 20:63739938-63739960 CCGGCCGGGACCCCAGTGCGCTG 0: 1
1: 0
2: 0
3: 14
4: 157
Right 1176178707 20:63739975-63739997 GTGGCTGCGCGCGGAGGGTCCGG 0: 1
1: 0
2: 0
3: 16
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176178693 Original CRISPR CAGCGCACTGGGGTCCCGGC CGG (reversed) Exonic
901697186 1:11017145-11017167 CAGCACATTGGGGTCGAGGCAGG - Intronic
902350187 1:15848254-15848276 CAGCGCCCGTGGGTCCGGGCCGG - Intronic
903187902 1:21639726-21639748 CAGGGCCCTGGGGTCCAGCCAGG - Intronic
905720898 1:40200675-40200697 CAGAGCACTGGGGTCAGGGTAGG + Intronic
906640557 1:47438381-47438403 CCGCGCTCTGGCGTCCCGGGGGG + Exonic
909548037 1:76868677-76868699 CAGCGCCCCGGGGTCCCCGCGGG + Exonic
913440270 1:118889536-118889558 CAGAGCACTCGGGACCTGGCAGG - Intronic
915572548 1:156752190-156752212 CCGCGCACTGGGGTCCTCTCTGG + Intronic
916606743 1:166350594-166350616 CAGCACAGTGGGGTCCCAGGGGG - Intergenic
917027767 1:170661623-170661645 CAGGGCTCTGGGCTCCCGGTCGG + Intergenic
1063179579 10:3585638-3585660 GAGCTCCCTGGAGTCCCGGCCGG + Intergenic
1064294919 10:14070217-14070239 CACCTCACAGGGGTCCCTGCAGG - Intronic
1064869845 10:19925111-19925133 CAGTTCACTGGTGTCACGGCTGG - Intronic
1065140173 10:22713367-22713389 CAGCAGGCGGGGGTCCCGGCGGG - Intronic
1069729048 10:70599364-70599386 CAGAGCACTGAGGTCCCTGAGGG - Intronic
1070961576 10:80503475-80503497 CAGAGCACTGGGGCCCAGGGAGG - Intronic
1075630060 10:123995329-123995351 CAGAGGCCTGGGGTCCCGGGAGG + Intergenic
1075664381 10:124220290-124220312 CAGCTTAATGGGGTCCCCGCTGG + Intergenic
1076744965 10:132508281-132508303 CAGGGCACTGGGGACCAGCCAGG + Intergenic
1076929957 10:133525604-133525626 CAGGGCACGCGGGTCCCGCCTGG + Intronic
1077008560 11:370081-370103 CACCGCACAGAGGTCTCGGCTGG + Intronic
1077186900 11:1239516-1239538 GTGCCCACTGGGGTTCCGGCAGG - Exonic
1082941507 11:58710001-58710023 CAGCACACAGGGGTCCCCTCAGG + Exonic
1083952875 11:65966505-65966527 GAGCACAGTGGGGCCCCGGCTGG + Exonic
1084891696 11:72239949-72239971 CGTCGCACTGGGCTCCGGGCCGG - Exonic
1084978197 11:72814644-72814666 CAGCGCACTCGGGTCACAGGCGG - Intronic
1084981256 11:72829965-72829987 CAGCCCAGAGGGGTCCCGGTGGG + Intronic
1086424662 11:86671999-86672021 CAGCGCGCGTGGGTCCTGGCTGG - Intronic
1089358767 11:117872887-117872909 CAGAGCACTGTGTTCCCGACCGG + Intronic
1091553347 12:1553623-1553645 CAGCGCACTGTGGCCCCAGGAGG + Intronic
1091950436 12:4588480-4588502 CAGGGCACTGGTGTCCAGGCTGG + Intronic
1091968246 12:4763807-4763829 CAGAGGGCTGGGATCCCGGCAGG - Intronic
1096387294 12:51203377-51203399 CAGTGCCCTGGGGACCAGGCAGG - Intronic
1096498284 12:52051094-52051116 CACCGGACTCGGGTCCCAGCTGG - Intronic
1097194531 12:57236265-57236287 CAGAGCACTGGGGTTGTGGCCGG - Intronic
1102943093 12:116961345-116961367 CAGCCCAGTGGGGTCCAGCCTGG - Intronic
1103400599 12:120640762-120640784 CAGAGAACGGGGCTCCCGGCGGG - Exonic
1104866925 12:131961324-131961346 CAGGGCTCTGGGGTCCCAGGTGG - Exonic
1104885474 12:132104692-132104714 CAGGGCTCTGGGGTCCCAGGTGG - Exonic
1106033767 13:26025692-26025714 CAGTGCACTGGGTTCCCTCCTGG + Exonic
1107414453 13:40188048-40188070 CAGCGCAGTGGGGTGCAAGCTGG + Intergenic
1109068003 13:57725134-57725156 CATCTCACTGGAATCCCGGCTGG - Exonic
1116039100 14:39664025-39664047 CATGGCGCTGGTGTCCCGGCTGG + Intergenic
1118431192 14:65720356-65720378 CAGGGCACTGGGCTCCCTTCTGG + Intronic
1119319188 14:73719262-73719284 CAGCCCGCGGGGGTCCCAGCGGG + Exonic
1121332354 14:93057706-93057728 CAGGAGACTGGGGTCCCTGCTGG - Intronic
1122153665 14:99737925-99737947 GAGGGCACTGGGGCCCCCGCAGG + Intronic
1124296349 15:28508475-28508497 CCGCGCACCGGGTTCCCGGGCGG - Intergenic
1128532675 15:68465258-68465280 CAGGGCACTGGGGCCCAGGAAGG - Intergenic
1129761488 15:78131471-78131493 CAGCGCGCCCGGGTCCCGGCAGG + Exonic
1130013462 15:80170130-80170152 CAGCGCTCCGGGGACCTGGCAGG + Intronic
1132195686 15:99913149-99913171 CAGAGCACTGAGGTGCAGGCTGG + Intergenic
1133285798 16:4690150-4690172 CTGGGGAATGGGGTCCCGGCCGG + Exonic
1136666732 16:31819392-31819414 CAGCGCGCTGGGGGCCCCGAGGG + Intergenic
1141485172 16:84334083-84334105 CAGGGCACTGGGCTCCCCTCTGG - Intergenic
1141856040 16:86682158-86682180 CAGCTCACTTGCTTCCCGGCTGG - Intergenic
1142286610 16:89173999-89174021 CAGCACCCTGGGGGCCAGGCAGG + Intronic
1142391431 16:89803449-89803471 CAGCTCACAGGGGTCCTGGTGGG - Intronic
1145005379 17:19334470-19334492 CAAAGCACTGAGGTCCTGGCAGG + Exonic
1145214783 17:21043139-21043161 CTGCGCAGTGCGGTGCCGGCCGG - Intronic
1145913796 17:28558476-28558498 CAACCCAGTGGAGTCCCGGCTGG - Exonic
1146284996 17:31568411-31568433 CAGCCCACTGGGGTCTCCACCGG + Intergenic
1146314775 17:31798295-31798317 CAGCTCCCTGGGGTCCTGGATGG + Intergenic
1149075648 17:52594421-52594443 CAGGGCACTGGGTTCCCTTCTGG + Intergenic
1150654783 17:67032673-67032695 CAGCACACAGGGGCCCTGGCAGG - Exonic
1151625083 17:75271282-75271304 CAGTGCCCCGGGGGCCCGGCAGG - Intergenic
1152264746 17:79287744-79287766 GAGCCCACAGGGGTCCAGGCAGG + Intronic
1152362037 17:79837245-79837267 CAGCCCAGTGGGGTCCGGGGCGG + Intronic
1152721907 17:81927525-81927547 CACCACACTGCGGGCCCGGCGGG + Exonic
1152725223 17:81941776-81941798 CAAGGCCCTGGGGTCCCTGCTGG + Exonic
1158024971 18:52885548-52885570 CAGGGCAGTGGGTTCCCGTCTGG + Intronic
1160806613 19:994878-994900 CAGCCCTGTGGGGTCCCGGAAGG + Intronic
1160917320 19:1503457-1503479 GAGGGCAGTGGGGTGCCGGCAGG + Intergenic
1161063545 19:2226925-2226947 GCGCGAACTGCGGTCCCGGCGGG - Exonic
1161196077 19:2987441-2987463 CAGGGCACTGGGGTTCCTGTGGG + Intronic
1161313696 19:3608186-3608208 CAGCCCCCTGGGGTCAGGGCTGG + Intergenic
1162372347 19:10287133-10287155 AAGGGCACTGAGGTCCCGGAGGG - Exonic
1163427008 19:17245508-17245530 CGCCGCCCTGGGGCCCCGGCGGG + Exonic
1163526888 19:17826832-17826854 CAGCGCCCTGGGCCCCCAGCTGG - Exonic
1164464841 19:28478739-28478761 CGGCGCACTGGGATCACTGCGGG + Intergenic
1165063765 19:33217675-33217697 CAGCCCCCTGCGGGCCCGGCAGG - Intronic
1165794644 19:38511842-38511864 CAGCCCAGTGGGGTCAGGGCTGG + Intronic
1166367476 19:42284678-42284700 CGGCGCAGGGGGGACCCGGCAGG - Exonic
1167007933 19:46787594-46787616 GAGCGCGCCGGGGTCCAGGCTGG + Exonic
1167160681 19:47765594-47765616 CAGAGCTCTGGGGACCTGGCAGG + Intergenic
1167497172 19:49826534-49826556 CAGTGCACTGGTGGCCTGGCAGG - Intronic
1168271035 19:55249969-55249991 CAGGGCACTGGGGTCACCGTGGG - Intronic
925607531 2:5673699-5673721 CAGAGAACTGTGGTCCAGGCAGG + Intergenic
929525018 2:42693641-42693663 CAGGGCACTGGGCTCCCCTCTGG + Intronic
933679821 2:85089795-85089817 CAGCGAATTGGGGGCCCTGCTGG - Intergenic
935356580 2:102207135-102207157 CAGGGCACTGGGCTCCCTTCTGG + Intronic
935820320 2:106887014-106887036 CGGGGCACTCGGGTCCCGGGCGG + Intronic
939153768 2:138501628-138501650 CATGGCACTAGGCTCCCGGCGGG - Intergenic
939992592 2:148889384-148889406 CAGCACTCTGGGGGCCAGGCTGG + Intronic
941164902 2:162074207-162074229 CGGGGCACTGGCATCCCGGCCGG + Exonic
941745936 2:169087372-169087394 CAGGGCACTGGGCTCCCCTCTGG + Intronic
946687333 2:222283710-222283732 CAGTTCACTGGGGGCCCGGCTGG + Intronic
1168767449 20:391359-391381 CGGCCCACTGAGGTCCTGGCTGG + Exonic
1172118106 20:32583672-32583694 CAGAACAATGAGGTCCCGGCGGG + Intronic
1172292869 20:33788790-33788812 CAGGGCACAAGGGTCCCCGCTGG - Intronic
1172952200 20:38729406-38729428 CAGCGCCAGGGGATCCCGGCTGG - Intergenic
1174506940 20:51023089-51023111 CGGCGCACTCGGAGCCCGGCGGG - Exonic
1176178693 20:63739938-63739960 CAGCGCACTGGGGTCCCGGCCGG - Exonic
1179375508 21:40846929-40846951 CAGCTCAGTGGGCCCCCGGCAGG + Exonic
1180871503 22:19149593-19149615 CACTGGACTGGGGTCCTGGCGGG - Intronic
1181268161 22:21642951-21642973 CAGCGCACCGGGGACCCGCGCGG - Exonic
1183730026 22:39613273-39613295 CTGGGCACTGGGGACCCAGCAGG + Intronic
1184879150 22:47294192-47294214 CAGCCCAGTGGAGTCCCGTCTGG - Intergenic
949355395 3:3175406-3175428 CAGAGGACTGGGGTCCGTGCTGG + Intronic
950176395 3:10877876-10877898 CAGTGCACTGGGGTACCCTCAGG + Intronic
950184166 3:10934864-10934886 AAGCTCACTGTGGTCCTGGCAGG + Intronic
961570934 3:127798412-127798434 CAGGGCCCTGGGGTCCCAGCAGG - Intronic
963411351 3:144931699-144931721 CAGGGCAGTGGGCTCCCGTCTGG - Intergenic
965118305 3:164519989-164520011 CAGGGCACTGGGCTCCCCTCGGG + Intergenic
965415159 3:168384260-168384282 CAGGGCACTGGGCTCCCCTCTGG + Intergenic
966313020 3:178615664-178615686 CAGGGCAATGGGCTCCCCGCTGG + Intronic
968495181 4:911298-911320 CAGGGCTCTGGGGTCCCTGTGGG - Intronic
969439647 4:7209493-7209515 CCTCACGCTGGGGTCCCGGCAGG - Intronic
972699901 4:41483647-41483669 CTGAGCACAGGGTTCCCGGCAGG - Intronic
973756576 4:54080467-54080489 AAGAGCACTGGGGTCTCGGCTGG + Intronic
975095624 4:70453514-70453536 CAGGGCACTGGGCTCCCTTCTGG + Intronic
975850214 4:78564505-78564527 CTGAGCACTGGGCTCCCAGCTGG + Intronic
979674521 4:123397675-123397697 CCGGGCACTCCGGTCCCGGCAGG - Exonic
981057048 4:140373820-140373842 CTGCGCACCGGGGGCCCGGGAGG + Intronic
986372379 5:7092880-7092902 CAGCACACTGAGGTCCAGGCTGG + Intergenic
988608473 5:32703214-32703236 CAGGGCACTGGGCTCCCCTCTGG + Intronic
991291268 5:65035635-65035657 GGGCGCACCGGCGTCCCGGCTGG + Intergenic
998058169 5:139096943-139096965 CAGCGCAGTGGGCTCCCTTCTGG - Intronic
1002569673 5:180133060-180133082 CAGAGCACTGGGGTCCTCCCTGG + Intronic
1003197195 6:3925717-3925739 CAGCGCCCGGGGTCCCCGGCTGG + Intergenic
1003318628 6:5033430-5033452 CAGCGCCCGGGGTCCCCGGCTGG - Intergenic
1006531347 6:34657561-34657583 CAGCGAACTGGAATCCTGGCAGG + Intronic
1007427411 6:41756543-41756565 CAGCTCACTCGGGCACCGGCTGG + Intergenic
1007785642 6:44277787-44277809 CAGCGCCCTGGGGTGGTGGCAGG - Exonic
1010781196 6:79947520-79947542 CAGCGCACTGTGCTGGCGGCTGG - Exonic
1016541461 6:145170495-145170517 CAGTGCAGTGGGTTCCCGTCTGG - Intergenic
1016923199 6:149317028-149317050 CAGCGCCCCGGGGTCCGGCCGGG + Intronic
1018400617 6:163415551-163415573 CAGCGGCGCGGGGTCCCGGCCGG - Intronic
1019481096 7:1267190-1267212 TAAGGCACTGGGGTCCTGGCTGG + Intergenic
1021572856 7:22083142-22083164 CAGCGCACGGTGGTCACGGGCGG - Intergenic
1027190720 7:75994279-75994301 CAGCGCGATGGGGTCCCGCCGGG + Intronic
1027374682 7:77537707-77537729 CAAAGCACTGGCGGCCCGGCCGG - Intronic
1029441037 7:100586715-100586737 CGGCGAACTGCGTTCCCGGCCGG - Intronic
1034193143 7:149226017-149226039 CTGCCCACTGTGATCCCGGCTGG - Exonic
1035774033 8:2173683-2173705 CAGAGCCCTGGGCTCCCTGCGGG + Intergenic
1041382259 8:57261787-57261809 CAGCGCCCTGGGGACCAGGACGG - Intergenic
1044395196 8:91702997-91703019 CAGGGCAATGGAGTCCCTGCTGG + Intergenic
1047262521 8:123274929-123274951 CAGGGCGCTGGGCTCCCGGCCGG - Intronic
1049531478 8:143157763-143157785 CAGGGCACTGGGGTGCTGGGTGG - Intergenic
1049800481 8:144515363-144515385 CAGCACGGTGGGGTCCAGGCTGG + Exonic
1049849347 8:144822496-144822518 CAGCACAGAGGGGTCCAGGCCGG - Intergenic
1053129091 9:35605337-35605359 CAGCGCTCCGGGGCGCCGGCGGG - Exonic
1055425234 9:76188578-76188600 CAGAGCACCGGGATCCCTGCAGG - Exonic
1056475105 9:86945941-86945963 CAGCGCACCGGGGGCGCGGGTGG - Exonic
1056747712 9:89318660-89318682 CCTCGCACTGGGGGCTCGGCCGG + Intronic
1057503745 9:95616126-95616148 CAGGGCACTGAGGTCCCTGAGGG + Intergenic
1060811649 9:126614020-126614042 CGGCGCAGCGGGGTCCCGGGCGG - Intergenic
1062141975 9:134964313-134964335 CTGGGCACTGGGCTCCTGGCAGG - Intergenic
1062268494 9:135698340-135698362 CAGCGCCCTGGGGCCCAGTCAGG - Exonic
1062391306 9:136335003-136335025 CAGGGCTCTGGGACCCCGGCAGG + Intronic
1062412828 9:136433500-136433522 CTGCTCACTGGGGTCTCGGCGGG - Intronic
1062501487 9:136853840-136853862 CAGGGCCCTGGGGCCCTGGCTGG + Exonic
1062578617 9:137220090-137220112 CTGCGCACTGGGGGCCAGGCTGG - Intergenic
1187900809 X:24025462-24025484 CAGCGCACTGGGCCCCCTGCCGG - Intronic
1191694632 X:63977432-63977454 CAGGGCACTGGGCTCCCTGCTGG - Intergenic
1195037165 X:100980840-100980862 CAGGGCACTGGGTTCCCTTCTGG + Intronic
1195199385 X:102533041-102533063 CAGAGCACTGGGCTCCCCTCTGG - Intergenic
1197871795 X:131068541-131068563 CAGCGCACTGTCGACCCCGCCGG + Intronic
1198807639 X:140506144-140506166 TAGCGCTCAGCGGTCCCGGCAGG - Intergenic
1199037074 X:143064035-143064057 CAGGGCAGTGGGGTCCCATCTGG - Intergenic
1199358338 X:146886854-146886876 CAGCGCAGTGGGCTCCCTGCTGG - Intergenic
1200420804 Y:2965180-2965202 CACAGCACTGGGGTCCAGCCTGG - Intronic