ID: 1176178759

View in Genome Browser
Species Human (GRCh38)
Location 20:63740153-63740175
Sequence GTCGGTCCGCGCGTGTCCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 23
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 21}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176178752_1176178759 8 Left 1176178752 20:63740122-63740144 CCGGGGGCGGGGCAGCGGGGAGG 0: 1
1: 1
2: 14
3: 130
4: 1102
Right 1176178759 20:63740153-63740175 GTCGGTCCGCGCGTGTCCGTGGG 0: 1
1: 0
2: 0
3: 1
4: 21
1176178750_1176178759 10 Left 1176178750 20:63740120-63740142 CCCCGGGGGCGGGGCAGCGGGGA 0: 1
1: 1
2: 2
3: 65
4: 429
Right 1176178759 20:63740153-63740175 GTCGGTCCGCGCGTGTCCGTGGG 0: 1
1: 0
2: 0
3: 1
4: 21
1176178740_1176178759 24 Left 1176178740 20:63740106-63740128 CCCAAACTTCGGGCCCCCGGGGG 0: 1
1: 0
2: 0
3: 5
4: 52
Right 1176178759 20:63740153-63740175 GTCGGTCCGCGCGTGTCCGTGGG 0: 1
1: 0
2: 0
3: 1
4: 21
1176178751_1176178759 9 Left 1176178751 20:63740121-63740143 CCCGGGGGCGGGGCAGCGGGGAG 0: 1
1: 0
2: 11
3: 115
4: 914
Right 1176178759 20:63740153-63740175 GTCGGTCCGCGCGTGTCCGTGGG 0: 1
1: 0
2: 0
3: 1
4: 21
1176178748_1176178759 11 Left 1176178748 20:63740119-63740141 CCCCCGGGGGCGGGGCAGCGGGG 0: 1
1: 1
2: 5
3: 61
4: 524
Right 1176178759 20:63740153-63740175 GTCGGTCCGCGCGTGTCCGTGGG 0: 1
1: 0
2: 0
3: 1
4: 21
1176178742_1176178759 23 Left 1176178742 20:63740107-63740129 CCAAACTTCGGGCCCCCGGGGGC 0: 1
1: 0
2: 0
3: 7
4: 57
Right 1176178759 20:63740153-63740175 GTCGGTCCGCGCGTGTCCGTGGG 0: 1
1: 0
2: 0
3: 1
4: 21

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176178759 Original CRISPR GTCGGTCCGCGCGTGTCCGT GGG Intronic