ID: 1176178769

View in Genome Browser
Species Human (GRCh38)
Location 20:63740178-63740200
Sequence GCCGCCCGGCGCAGCCCCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 248}

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176178769_1176178788 15 Left 1176178769 20:63740178-63740200 CCGCCGGGGCTGCGCCGGGCGGC 0: 1
1: 0
2: 1
3: 27
4: 248
Right 1176178788 20:63740216-63740238 GCCGCGCCGGGCTGGGGGCGGGG 0: 1
1: 1
2: 20
3: 157
4: 954
1176178769_1176178790 19 Left 1176178769 20:63740178-63740200 CCGCCGGGGCTGCGCCGGGCGGC 0: 1
1: 0
2: 1
3: 27
4: 248
Right 1176178790 20:63740220-63740242 CGCCGGGCTGGGGGCGGGGCCGG 0: 1
1: 6
2: 56
3: 291
4: 1924
1176178769_1176178777 3 Left 1176178769 20:63740178-63740200 CCGCCGGGGCTGCGCCGGGCGGC 0: 1
1: 0
2: 1
3: 27
4: 248
Right 1176178777 20:63740204-63740226 GGAGCCCTTCCCGCCGCGCCGGG 0: 1
1: 0
2: 3
3: 11
4: 146
1176178769_1176178782 9 Left 1176178769 20:63740178-63740200 CCGCCGGGGCTGCGCCGGGCGGC 0: 1
1: 0
2: 1
3: 27
4: 248
Right 1176178782 20:63740210-63740232 CTTCCCGCCGCGCCGGGCTGGGG 0: 1
1: 1
2: 4
3: 57
4: 533
1176178769_1176178776 2 Left 1176178769 20:63740178-63740200 CCGCCGGGGCTGCGCCGGGCGGC 0: 1
1: 0
2: 1
3: 27
4: 248
Right 1176178776 20:63740203-63740225 GGGAGCCCTTCCCGCCGCGCCGG 0: 1
1: 0
2: 0
3: 9
4: 113
1176178769_1176178795 25 Left 1176178769 20:63740178-63740200 CCGCCGGGGCTGCGCCGGGCGGC 0: 1
1: 0
2: 1
3: 27
4: 248
Right 1176178795 20:63740226-63740248 GCTGGGGGCGGGGCCGGGGGCGG 0: 1
1: 21
2: 177
3: 1128
4: 5364
1176178769_1176178796 26 Left 1176178769 20:63740178-63740200 CCGCCGGGGCTGCGCCGGGCGGC 0: 1
1: 0
2: 1
3: 27
4: 248
Right 1176178796 20:63740227-63740249 CTGGGGGCGGGGCCGGGGGCGGG 0: 3
1: 15
2: 141
3: 862
4: 3744
1176178769_1176178794 22 Left 1176178769 20:63740178-63740200 CCGCCGGGGCTGCGCCGGGCGGC 0: 1
1: 0
2: 1
3: 27
4: 248
Right 1176178794 20:63740223-63740245 CGGGCTGGGGGCGGGGCCGGGGG 0: 1
1: 10
2: 62
3: 445
4: 2618
1176178769_1176178779 7 Left 1176178769 20:63740178-63740200 CCGCCGGGGCTGCGCCGGGCGGC 0: 1
1: 0
2: 1
3: 27
4: 248
Right 1176178779 20:63740208-63740230 CCCTTCCCGCCGCGCCGGGCTGG 0: 1
1: 0
2: 6
3: 29
4: 245
1176178769_1176178791 20 Left 1176178769 20:63740178-63740200 CCGCCGGGGCTGCGCCGGGCGGC 0: 1
1: 0
2: 1
3: 27
4: 248
Right 1176178791 20:63740221-63740243 GCCGGGCTGGGGGCGGGGCCGGG 0: 2
1: 13
2: 92
3: 498
4: 2765
1176178769_1176178793 21 Left 1176178769 20:63740178-63740200 CCGCCGGGGCTGCGCCGGGCGGC 0: 1
1: 0
2: 1
3: 27
4: 248
Right 1176178793 20:63740222-63740244 CCGGGCTGGGGGCGGGGCCGGGG 0: 1
1: 4
2: 68
3: 509
4: 2590
1176178769_1176178787 14 Left 1176178769 20:63740178-63740200 CCGCCGGGGCTGCGCCGGGCGGC 0: 1
1: 0
2: 1
3: 27
4: 248
Right 1176178787 20:63740215-63740237 CGCCGCGCCGGGCTGGGGGCGGG 0: 1
1: 2
2: 13
3: 113
4: 654
1176178769_1176178781 8 Left 1176178769 20:63740178-63740200 CCGCCGGGGCTGCGCCGGGCGGC 0: 1
1: 0
2: 1
3: 27
4: 248
Right 1176178781 20:63740209-63740231 CCTTCCCGCCGCGCCGGGCTGGG 0: 1
1: 1
2: 21
3: 337
4: 653
1176178769_1176178786 13 Left 1176178769 20:63740178-63740200 CCGCCGGGGCTGCGCCGGGCGGC 0: 1
1: 0
2: 1
3: 27
4: 248
Right 1176178786 20:63740214-63740236 CCGCCGCGCCGGGCTGGGGGCGG 0: 1
1: 0
2: 7
3: 79
4: 610
1176178769_1176178783 10 Left 1176178769 20:63740178-63740200 CCGCCGGGGCTGCGCCGGGCGGC 0: 1
1: 0
2: 1
3: 27
4: 248
Right 1176178783 20:63740211-63740233 TTCCCGCCGCGCCGGGCTGGGGG 0: 1
1: 1
2: 1
3: 13
4: 141
1176178769_1176178797 27 Left 1176178769 20:63740178-63740200 CCGCCGGGGCTGCGCCGGGCGGC 0: 1
1: 0
2: 1
3: 27
4: 248
Right 1176178797 20:63740228-63740250 TGGGGGCGGGGCCGGGGGCGGGG 0: 2
1: 31
2: 267
3: 1004
4: 4666

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176178769 Original CRISPR GCCGCCCGGCGCAGCCCCGG CGG (reversed) Intronic
900180163 1:1307742-1307764 GCCGCCCGGGGCCGCCGGGGTGG - Intronic
900793493 1:4694075-4694097 GCCACCAGGAGCAGCCCTGGGGG - Intronic
900915133 1:5632272-5632294 GCCTCCCGGCTCTGCCCCAGGGG + Intergenic
900984477 1:6065548-6065570 GCGGCCCTGCGCAGCCCCCCAGG + Intronic
901373266 1:8818054-8818076 CCAGCCCGGCCCAGCCCGGGGGG - Intergenic
901529824 1:9845963-9845985 CCCGCCCTGCGCAACCCCAGAGG - Intergenic
901872219 1:12144874-12144896 GCTGCCCGGCCCAGCCCAGAGGG - Intergenic
903603040 1:24556082-24556104 GCCGCCCGGCGCTGCCACCCTGG - Intergenic
903828535 1:26161501-26161523 GCCGCCTGCCGCTTCCCCGGCGG - Exonic
905451590 1:38060394-38060416 CCTGCCCTGGGCAGCCCCGGGGG - Intergenic
907296549 1:53459683-53459705 GGCGGCGGCCGCAGCCCCGGAGG - Exonic
910549739 1:88462728-88462750 GGCGCCCGCGGCAGCCCCAGCGG - Intergenic
911116085 1:94247748-94247770 GGCGGCCGGCGCAGCCGTGGCGG - Intronic
912449198 1:109759008-109759030 GCCTCCCAGCTCAGCCTCGGGGG - Intronic
915311631 1:155008326-155008348 GCCGCCTTGCCCAGCCCCTGAGG + Intronic
915462158 1:156076743-156076765 GGCGGCCTGCGGAGCCCCGGCGG - Exonic
915528243 1:156489161-156489183 GCAGCCCGGAGCAGCCTGGGAGG - Intronic
915559226 1:156676764-156676786 GCTGCCCCGCGCCGCCCCGCGGG - Exonic
919878789 1:201889001-201889023 GCGGCCCGGCGGAGCCCCGCGGG - Exonic
922586401 1:226737531-226737553 CGCTCCCGGCTCAGCCCCGGAGG + Exonic
922718287 1:227887878-227887900 GTGGCGCGGTGCAGCCCCGGGGG - Intergenic
922792709 1:228318930-228318952 GCCCCCCGAGGCAGCCCAGGAGG + Exonic
924199023 1:241640417-241640439 TCCGCCCGGCGCACCCCCCGTGG + Intronic
924503008 1:244653705-244653727 GGGTCCCGGGGCAGCCCCGGGGG - Intronic
1063452990 10:6163824-6163846 GCCGCGCGGCGCACGCCGGGAGG - Intronic
1065359550 10:24876840-24876862 GCCCCCCGACTCAGCCCCTGAGG + Intronic
1066685394 10:37976561-37976583 GCGGCCCAGCCCAGACCCGGAGG + Exonic
1071997449 10:91162625-91162647 CCCGCCCGGGGCAGCCGCCGCGG + Intergenic
1072994282 10:100229501-100229523 GCGCCCGGCCGCAGCCCCGGGGG + Exonic
1073266417 10:102230799-102230821 GGTGCCCGGGGCAGCCGCGGCGG + Exonic
1074130389 10:110568164-110568186 CCCGCCCGCGGCCGCCCCGGCGG - Intronic
1074377385 10:112951299-112951321 GCCGCCCGGAGCCGCCCCCCGGG + Intronic
1076504535 10:130963113-130963135 GCCTCCCAGGGCAGCCTCGGTGG + Intergenic
1076735320 10:132456404-132456426 GCCGCCTGGCTCAGCCTCTGTGG - Intergenic
1076765612 10:132631347-132631369 GCAGCCCAGCCCAGCCCCGAAGG + Intronic
1076858505 10:133128826-133128848 GCGGCCCAGCGCGGCCCCGTTGG - Exonic
1077011732 11:381799-381821 GCAGCCCCTCCCAGCCCCGGTGG + Exonic
1077014665 11:394260-394282 GCCGCCAGGCCCAGGCCCGGTGG + Exonic
1077051723 11:569567-569589 GCCCCCTGCCCCAGCCCCGGCGG + Intergenic
1077063340 11:627086-627108 GGCGCGCGGCGGAGCCCCCGAGG + Exonic
1077093954 11:791580-791602 CCTGCCCGGCCCAGGCCCGGGGG + Exonic
1077102124 11:827096-827118 GCCTCTCTGCGCTGCCCCGGCGG - Intronic
1077122981 11:919081-919103 GCCACCGGGCCCGGCCCCGGTGG + Intergenic
1077145420 11:1042243-1042265 CCCGCCCGGAGCAGTCCAGGGGG - Intergenic
1077360387 11:2138109-2138131 GCCGCCCCGCCGAGCCCCGCAGG + Intronic
1077361854 11:2144372-2144394 GGGGCCCGGAGCACCCCCGGTGG + Intronic
1077637950 11:3856027-3856049 TCAGGCCGCCGCAGCCCCGGCGG + Exonic
1078800975 11:14643942-14643964 GGCGGCCGGCGCAGCCCTGACGG + Exonic
1079126371 11:17720916-17720938 GCCGCCGGGCGCCGCTCGGGGGG - Exonic
1079374492 11:19879975-19879997 GCCGCCCGCCGTATCCCAGGTGG + Exonic
1080012496 11:27472560-27472582 CCGGCCCGGCGCAGCGGCGGGGG + Exonic
1083272972 11:61581247-61581269 GCCGCCCGAAGCCGCCCCGAGGG + Intergenic
1083681567 11:64354068-64354090 GCCCCCAGGCGCAGCCCCCCAGG - Exonic
1083682810 11:64359121-64359143 GGCGCCCGCCTCGGCCCCGGAGG + Intergenic
1083901779 11:65646815-65646837 GCCGCTCGCCTGAGCCCCGGCGG - Exonic
1084204415 11:67583687-67583709 CCCGCCGGCCCCAGCCCCGGCGG - Exonic
1084538852 11:69774541-69774563 GCAGCCCAGCGCAACCCCTGAGG - Intronic
1085507132 11:77066998-77067020 GCCGCCCGGCGCAGCAGCCTCGG - Exonic
1090699198 11:129279291-129279313 GCCGCCGAGGGCAGCCGCGGGGG + Intronic
1090699204 11:129279305-129279327 GACGCCCGGCCGAGCCCCCGCGG - Intronic
1091221187 11:133930953-133930975 GCCGCCCGGCCCAGCCTTGCCGG + Intronic
1091281485 11:134384138-134384160 GCCGCCCGGCGCCGACCCCAGGG - Exonic
1092365439 12:7873087-7873109 ACCGCACGGTCCAGCCCCGGCGG + Intronic
1094607317 12:31959695-31959717 GCGGCCCGGCCCAGCTCCGGTGG - Intronic
1094841839 12:34345563-34345585 GCCGCCTTGTGCAGCCCCCGGGG + Intergenic
1095517024 12:43017194-43017216 GCCCCCAGGGGCAGCCCTGGAGG - Intergenic
1100391311 12:94148361-94148383 GCCGCCCGCCGCGGCCGCCGCGG - Intergenic
1101874959 12:108591805-108591827 ACCGCCCAGTGCAGCCCTGGTGG + Exonic
1101897724 12:108768801-108768823 TCCGCCCGGCCTAGCCCTGGAGG - Intergenic
1102053637 12:109880468-109880490 GCCGCCCGCCGCAGGCTCCGGGG + Exonic
1103092032 12:118104184-118104206 GCAGCCCGGGGCAGCGGCGGGGG - Intronic
1103339865 12:120215576-120215598 GGCGGGCGGAGCAGCCCCGGAGG - Intronic
1103386303 12:120534916-120534938 GCCGCCCCGCTCCGCCTCGGCGG + Exonic
1103779713 12:123390101-123390123 TCCTCCCGTCGCAGCCCTGGAGG + Intronic
1104980549 12:132571503-132571525 GCCGCCCGCCGCACCCCCGCCGG + Exonic
1104981376 12:132574394-132574416 GCCCCCCGAGGCCGCCCCGGGGG - Exonic
1105054052 12:133080959-133080981 GCCATCCGGCGCAGACCGGGAGG - Exonic
1105635259 13:22210281-22210303 GCCGGCCCGCCCAGCCCCTGTGG - Intergenic
1106269405 13:28138872-28138894 GAGGCCCGGGGCAGCCCCGGCGG - Exonic
1106293584 13:28389518-28389540 GCCCCCCGGAGCAGCCCCCTCGG + Intronic
1106835309 13:33627812-33627834 GCCCCACGGTGCAGCCCTGGAGG - Intergenic
1111975995 13:94967940-94967962 GACGCACGGGGCAGCCGCGGAGG + Intergenic
1112088211 13:96053540-96053562 GCAACCCGGCGCCGCCCCGGCGG - Intergenic
1113378432 13:109784064-109784086 GACGCCCGGCGCGGCCCTCGCGG - Exonic
1117722176 14:58638413-58638435 GGCGCCCTGCGCGGCGCCGGGGG + Exonic
1118627805 14:67674870-67674892 GCCGGCCGGCGGGGCCCGGGAGG - Intronic
1119418587 14:74493101-74493123 TCCGCCCAGCCCAGCCCCAGGGG + Intronic
1122081354 14:99269979-99270001 CCCGCCCGCCGCAGCCCGCGGGG - Intronic
1122130924 14:99604255-99604277 GCCGCCCCGCCCACCCCGGGCGG + Intergenic
1122602938 14:102930296-102930318 CCCGCGCGGCGCAGCAGCGGCGG - Exonic
1122975220 14:105168232-105168254 GCCGCCGCGCGCAGCCTCGAGGG + Intronic
1123224083 14:106883673-106883695 GCACGCCGGCGCATCCCCGGAGG - Intergenic
1126150831 15:45522566-45522588 GCCCCCTCGCGGAGCCCCGGCGG - Intronic
1127483896 15:59402019-59402041 GCTGCCAGGAGCAGCCCCTGGGG + Intronic
1127868245 15:63048749-63048771 TCCTCCCGGGGCAGCCCCGCAGG + Intronic
1131171932 15:90184971-90184993 CCGGCCCGGCGCAGCCCCTGGGG - Intronic
1132111426 15:99104961-99104983 GCGGCCCGGCGCGGCCTCTGCGG - Intronic
1132576871 16:668339-668361 CTCGCCCCGCGCAGCCCAGGTGG + Exonic
1132625932 16:891515-891537 GCCCCCTGGCCCAGCACCGGTGG - Intronic
1132734705 16:1379654-1379676 GCCGCCCCGCGCCGCCGCCGGGG + Intronic
1132934491 16:2473885-2473907 GCCGCAGGCCGCATCCCCGGCGG - Exonic
1136025956 16:27469290-27469312 CCCGCCCGGCTCAGGCCCGCTGG - Exonic
1137412930 16:48244635-48244657 GCCGCCCGCCGCCGCCGCGGGGG - Intronic
1138360669 16:56425128-56425150 CCCGCCCGGCCGAGCGCCGGGGG - Exonic
1138363358 16:56451633-56451655 GGAGCCCGGCCCAGCCCGGGTGG + Exonic
1139853776 16:69965436-69965458 GCCGCCCTGCGCATGCCCGCGGG + Intergenic
1139882754 16:70188349-70188371 GCCGCCCTGCGCATGCCCGCGGG + Intergenic
1141044813 16:80706594-80706616 GCCGCTAGGGGCAGCCCCAGGGG + Intronic
1141054798 16:80804658-80804680 GCTGCCCGGCCGCGCCCCGGGGG + Intergenic
1141959209 16:87392877-87392899 ACGGCCCAGCGCGGCCCCGGGGG - Intronic
1142365095 16:89645954-89645976 GCTGCCGGCCGCAGCCCCGCGGG + Exonic
1142709194 17:1714515-1714537 TCCGCCCCTCACAGCCCCGGGGG - Intergenic
1143697602 17:8631384-8631406 CCAACCCCGCGCAGCCCCGGGGG - Intergenic
1143830217 17:9645418-9645440 GTGGCCCGGCGCTGCCCTGGAGG + Intronic
1144695882 17:17303602-17303624 GCCGCCCCGCGCCGCCCCGCGGG - Exonic
1147184388 17:38705596-38705618 GCCCCCCGCCCCAGCCCCGGAGG + Exonic
1147743070 17:42679612-42679634 GCCGGCGGGGGCAGCCGCGGCGG + Exonic
1148090925 17:45022111-45022133 GAGGCCCGGCCCAGCCCGGGAGG + Intergenic
1148397773 17:47323937-47323959 GCCGCGCGGCCCCGCCCCCGCGG - Intronic
1150428970 17:65100683-65100705 GCCGCTCGGCGGGGTCCCGGCGG + Intergenic
1151964633 17:77425107-77425129 GGCGCCAGGAACAGCCCCGGGGG - Intronic
1152357339 17:79813530-79813552 GCCGCCGGGCGCCCCCCCGCCGG - Intergenic
1152362670 17:79839718-79839740 TCCGCCCGCCTCCGCCCCGGCGG - Intergenic
1153457175 18:5295123-5295145 GCGGCCCGCGGCGGCCCCGGCGG + Intronic
1153457326 18:5295580-5295602 GCCGGCCCGCGCGGCCCCCGGGG + Intronic
1154196648 18:12271881-12271903 CCCGCCCGGCGAGGCCCCAGCGG + Intronic
1156350682 18:36298461-36298483 GCCGCCCGCAGCGGCCCCAGAGG - Intronic
1157222741 18:45839077-45839099 GCTGCCCGCCGCCGCCCAGGTGG + Exonic
1160760348 19:781078-781100 GCCGCCCTGTGGGGCCCCGGAGG + Intergenic
1160785266 19:897459-897481 GCGGACAGGAGCAGCCCCGGCGG + Exonic
1160791604 19:926067-926089 GGCGCGCGGCACAGCCCCGTGGG + Intronic
1160877741 19:1305045-1305067 GCCGCCCCCCACAGCCCCGGTGG + Intergenic
1160910342 19:1471071-1471093 TCGGCCCGGCGCAGCCGCGGCGG + Exonic
1161282555 19:3453829-3453851 GCCAGCCGTGGCAGCCCCGGGGG - Exonic
1161284655 19:3463157-3463179 GCCGCCCGCCCGCGCCCCGGAGG + Intronic
1161707230 19:5827830-5827852 GCCGTCGGGCGGGGCCCCGGCGG + Exonic
1161939833 19:7395335-7395357 GAGGCCCGAGGCAGCCCCGGGGG - Intronic
1163509606 19:17726996-17727018 GCTGCCCGGCGCACCTCCCGCGG - Exonic
1163666683 19:18606855-18606877 CCGGCCCGGCCCGGCCCCGGGGG + Intronic
1165448260 19:35868580-35868602 CCCGCCCGGCCCGGCCCCAGCGG - Exonic
1165528883 19:36379675-36379697 GCCACCAGGCTCAGCCGCGGAGG + Intergenic
1165831013 19:38730329-38730351 CACGCCCGACGCAGACCCGGAGG - Exonic
1165961648 19:39539866-39539888 GGCGGCCAGGGCAGCCCCGGCGG - Exonic
1167052790 19:47089904-47089926 GCCACCCGGGCCAACCCCGGTGG - Intronic
1167074756 19:47241288-47241310 GCCGCACGGCCCCGCCCCCGGGG + Intergenic
1167709076 19:51099074-51099096 GCCGCCCCGCGTCGCCCCGTAGG + Exonic
929188698 2:39120710-39120732 GCAGCCCGGGGCGGCGCCGGCGG - Intronic
929701886 2:44169280-44169302 GCCGCCCGGCACCCCGCCGGAGG + Intronic
932374863 2:71226813-71226835 GCCGCCCTTCACAGCCCCGACGG + Intronic
932722480 2:74147989-74148011 GCCTCCCGGCCCCGCCCCGGAGG + Exonic
933895571 2:86807709-86807731 GCCACCCGGAGCAGGCGCGGAGG + Exonic
935196650 2:100820285-100820307 GCCTCCCGCCGCCGCCCGGGAGG + Exonic
940317009 2:152336205-152336227 ACCGCCCGGCGCGGCGCCCGCGG - Intronic
943645979 2:190408348-190408370 CCAGCCCGTCGCAGCCCCGGAGG + Exonic
945080933 2:206085682-206085704 GCCGCCCGCGGGCGCCCCGGAGG + Intronic
946248569 2:218400236-218400258 GCCGCCCGGGGCGGCGGCGGCGG - Intronic
947012664 2:225582898-225582920 GCCACCCGGGGCTGCCCCGTAGG - Exonic
947717918 2:232351167-232351189 GCAGCCCGGCCCAGCCCCGGTGG + Intergenic
947724084 2:232386824-232386846 GCGGCGCGGCGGAGCGCCGGGGG - Intergenic
1171972539 20:31573205-31573227 GCCTCCCCGCGCCGCCCCGCGGG + Intronic
1172061545 20:32190203-32190225 GCCGCCCGGCCTTGCCCGGGAGG - Intergenic
1172118715 20:32585489-32585511 CCCGCCCGGCCCGGCCCCTGGGG + Intronic
1173874933 20:46364329-46364351 GCCTCCCGGCGCACTCCCAGAGG - Intronic
1176020374 20:62959602-62959624 GCCGCCTGGCGGAGCTCCTGGGG - Intronic
1176059522 20:63166296-63166318 GCAGCCCCGCACAGCCCTGGTGG - Intergenic
1176062476 20:63178483-63178505 GCCGCCCGCCCCAGCCCTGAGGG + Intergenic
1176140497 20:63542737-63542759 GAGGCCCGGCCCAGCCCCGTGGG + Intronic
1176178769 20:63740178-63740200 GCCGCCCGGCGCAGCCCCGGCGG - Intronic
1176380635 21:6110818-6110840 GGCGCCCGGCGGAGCGCAGGCGG + Intergenic
1176382761 21:6121309-6121331 GCAGACCGGCGCGTCCCCGGTGG + Exonic
1179740708 21:43416930-43416952 GCAGACCGGCGCGTCCCCGGTGG - Exonic
1179742837 21:43427422-43427444 GGCGCCCGGCGGAGCGCAGGCGG - Intergenic
1181941763 22:26483484-26483506 GCTGCTGGGCGCAGCCCCCGGGG + Intronic
1183407876 22:37639430-37639452 AGCGCCCCGCCCAGCCCCGGTGG - Intronic
1183525002 22:38317495-38317517 GCCCGCCGCCGCCGCCCCGGAGG + Intronic
1183788353 22:40045045-40045067 GCCGCCCCGCTCCGTCCCGGCGG - Intronic
1183788369 22:40045086-40045108 GCCGCGCCGCGCGCCCCCGGGGG - Intronic
1184477647 22:44730092-44730114 CCCGCCAGGGGCAGCCCTGGGGG - Intronic
1184657264 22:45948144-45948166 GCCTCCCGGCCGAGCCCCCGGGG - Intronic
1185420191 22:50730755-50730777 TCAGCGCAGCGCAGCCCCGGGGG + Intergenic
950467481 3:13163733-13163755 CCCGCCCAGCCCAGCCCCAGGGG + Intergenic
950490262 3:13300384-13300406 GCCGCCTGGCCCAGGCGCGGTGG - Intergenic
952377805 3:32781580-32781602 TCCGCCCGGCGCCGCCGCGCCGG - Intergenic
954912703 3:54122406-54122428 GCCGCCCGGCCCCGCCTCGGCGG - Intergenic
956061282 3:65350722-65350744 GCTGCCCTGGACAGCCCCGGTGG + Intergenic
956892332 3:73624839-73624861 GCCGCCCGGCGGCGACCCCGGGG - Exonic
966594349 3:181712434-181712456 GCCGCCGGCCGCCGCCGCGGTGG - Exonic
967098626 3:186197493-186197515 GCCACCCTGTGCAGCCCCCGGGG + Intronic
968044972 3:195618891-195618913 GCCGCCAGTGGCAGCCCCGAGGG + Intergenic
968060756 3:195724943-195724965 GCCGCCAGTGGCAGCCCCGAGGG + Exonic
968583411 4:1405155-1405177 GCCTCCAGGCGCAGAGCCGGTGG + Intronic
968697515 4:2040483-2040505 GCGGCCCGGCGCGTCCCCGGAGG + Intronic
968879946 4:3293432-3293454 CCTGCCCGGCGCCGCCCCCGCGG - Intronic
968908701 4:3466019-3466041 GCCCCCAGGGGCAGCCCCTGTGG - Intronic
969213880 4:5708305-5708327 CCCGCCCCGCTCCGCCCCGGAGG + Exonic
969406528 4:6996709-6996731 CCCGCCCGGGACAGCCCTGGGGG - Intronic
969610883 4:8227316-8227338 GGCGCCTGGCACAGGCCCGGGGG + Exonic
969669262 4:8580747-8580769 GCAGCCCGGGGCCGCCCTGGAGG - Exonic
970332937 4:15003484-15003506 GCCCCGCGGCGCCGCCACGGAGG + Exonic
972437218 4:39045254-39045276 CCCGCCCGGCCCAGCCCCTCCGG - Intronic
973531814 4:51843287-51843309 GCCGCCCGGCCCCGGCCCGCTGG - Intronic
974277742 4:59747889-59747911 GCCGCCGTGCCCAGCCCCGCAGG - Intergenic
974865060 4:67570014-67570036 GCCACCAGGCCCAGCCCCAGTGG + Intronic
976629323 4:87220551-87220573 GCGGCCCCGCGGAGCCCCGGCGG + Exonic
979033160 4:115678477-115678499 GAGGCCCGGCGCAGCACTGGCGG - Intergenic
980027199 4:127781713-127781735 TCCGCCCTGTCCAGCCCCGGGGG - Intergenic
983254088 4:165379124-165379146 GCCGCCCCCAGCAGCGCCGGCGG + Exonic
985895573 5:2748635-2748657 GCGGCCGCGGGCAGCCCCGGTGG + Exonic
988066615 5:26233254-26233276 GCAGCCCAGGGCAGCCCAGGAGG - Intergenic
992105749 5:73448077-73448099 GCCCCCGGGCCCGGCCCCGGCGG - Exonic
993901024 5:93584515-93584537 GGCGCGGGGCGCAGCGCCGGGGG - Exonic
996745941 5:126845899-126845921 GCCGCCCCGCCCCGCCCCGCCGG + Intergenic
999244021 5:150143909-150143931 GCAGCCCGGCGCAGCCCACTCGG + Intronic
999248360 5:150167205-150167227 GCCTCCTGGCGCAGCCCCTCGGG + Exonic
999322558 5:150624604-150624626 CCCGCCCCGCCCAGCCCTGGGGG - Intronic
1001245906 5:170105842-170105864 GCCGCCCGGCCAAGCCCTAGGGG + Intergenic
1001671503 5:173477909-173477931 GCCGCCTGGCGCTGTCCCTGGGG + Intergenic
1002055745 5:176597140-176597162 GCGGCCCGGCTCAGCGCTGGCGG - Exonic
1002091754 5:176810377-176810399 GCCGCCCCGCGCAGCGCGCGCGG - Intergenic
1002327822 5:178420995-178421017 GCCGCAGGGCCCAGCCCAGGAGG + Intronic
1002896192 6:1381943-1381965 GCCGCGCCGGGCAGCCCCGCGGG + Intergenic
1003874863 6:10426283-10426305 GCCTCCCGCCGCAGCCCAAGGGG - Intergenic
1006083473 6:31580799-31580821 GCGGCCTGGTGCAGCTCCGGAGG - Exonic
1006446605 6:34083316-34083338 GCCGACAGGCGCAGTCCCGGAGG + Intronic
1008932451 6:56954888-56954910 GCCCCCGGGCGCAGCCCCGCCGG + Intergenic
1016329869 6:142945115-142945137 GCCGGCCGCCGCAGCCGCAGCGG + Exonic
1017050962 6:150392985-150393007 GGCGCCCGGAGCAGACCCCGAGG - Intronic
1018443575 6:163834790-163834812 GCCGCCCCGCCCCGCCCCGTAGG - Intergenic
1018662130 6:166098077-166098099 GCCACCCGGCGCAGCCGCCAGGG - Intergenic
1018686529 6:166308097-166308119 GCCGCCCGCCCCCGCCCCGGGGG - Exonic
1019188340 6:170234604-170234626 GCAGCCCTGCGCAGTCCTGGCGG - Intergenic
1019576267 7:1739145-1739167 GCGGCCCCGCGCAGCCCTGAGGG - Intronic
1019621508 7:1994638-1994660 GCCACCGGGCGGAGCCTCGGGGG + Intronic
1022091520 7:27110745-27110767 GCCGCCCCGCGCAGACCTGGTGG + Exonic
1022106354 7:27200187-27200209 GCCGCCTGGCGCGACCCCGCGGG - Intergenic
1022723073 7:32957808-32957830 GGCGCCCGGCGCGGCCTCAGCGG + Intronic
1024323234 7:48089569-48089591 GCCTCCCCGCGCAGCCGCGCCGG - Intronic
1026732749 7:72925562-72925584 GCAGCCCGCCGCCGCTCCGGAGG + Intronic
1028621426 7:92833335-92833357 GCCGCCCGCCGCGGCGCCGCTGG + Exonic
1028982443 7:96981573-96981595 GCCCCCCGCCCCAGCCCCTGTGG + Intergenic
1035709511 8:1701459-1701481 GCAGCGCGGCGCCGCCCTGGTGG + Exonic
1037803919 8:22049153-22049175 GGAGCCCGGCGGAGCCCGGGCGG + Intronic
1037902528 8:22695883-22695905 GCCGCCCAGCTCAACTCCGGAGG + Intergenic
1038002424 8:23403439-23403461 GCTCCCGGGCGCAGCCCCCGGGG + Intronic
1040038735 8:42896372-42896394 GCCGCCCCGCAGAGCCTCGGCGG + Exonic
1040312349 8:46243302-46243324 CCTGCCCAGCGCAGCCCTGGGGG - Intergenic
1040312759 8:46245238-46245260 CCCGCCCGGGACAGCCCTGGGGG - Intergenic
1040315126 8:46256973-46256995 CCCGCCCGGGACAGCCCTGGGGG - Intergenic
1040330955 8:46385539-46385561 CCCGCCCGGGGTAGCCCTGGGGG - Intergenic
1040336879 8:46420569-46420591 CCCGCCTGGGGCAGCCCTGGAGG - Intergenic
1040338920 8:46430108-46430130 CCCGCCCGGGACAGCCCTGGGGG - Intergenic
1040610574 8:48978014-48978036 GCTGCCCGCCCCAGCCCCGCTGG - Intergenic
1043502858 8:80873981-80874003 GCAGCGCGGCGCCCCCCCGGCGG + Intronic
1044437327 8:92179491-92179513 GCAGCCGGGCGCAGGCGCGGTGG + Intergenic
1045231423 8:100310215-100310237 GCCGCCCGCAGCGGGCCCGGTGG - Intronic
1045564347 8:103298730-103298752 GCCGGGCGGCGCAGCGCAGGCGG + Intronic
1049184974 8:141245508-141245530 GCCCCCCGGGTCAGCCCTGGGGG - Intronic
1049482816 8:142834971-142834993 GAAGCGCGGCGCACCCCCGGCGG - Intronic
1049681594 8:143921076-143921098 GCCGAACGGCGCAGACACGGTGG + Exonic
1049747972 8:144271005-144271027 CCCGCCCAGCGCAGCACCTGCGG + Intronic
1051079686 9:13279651-13279673 GCCGACCGGGGCTGCCGCGGAGG + Intergenic
1054870418 9:70043714-70043736 CCCGCCCCGCCCAGCCGCGGTGG - Exonic
1056992348 9:91423727-91423749 GCCTCCCGCCGCGGCCCCGGAGG - Exonic
1057572964 9:96218260-96218282 GCCGGCGGGCTCAGCGCCGGTGG + Intergenic
1057594895 9:96407246-96407268 GCCGCCAGGAGCAGCCCCTGGGG - Intronic
1060477984 9:123999795-123999817 GCCGCGCGCCGCAGCCCGGGTGG + Intergenic
1060700858 9:125747781-125747803 GCCGCCCGCCCCGGCCTCGGGGG + Intronic
1060934907 9:127509147-127509169 GCGGCCCTGCTCAGCCCCCGCGG - Intronic
1061559763 9:131394586-131394608 GCAGCCCGGCCCGGCCTCGGGGG - Intronic
1062003093 9:134226558-134226580 GCCTCCTGGGGCAGCCCAGGTGG + Intergenic
1062388213 9:136323367-136323389 GCCTCCCACCGCAGACCCGGGGG + Intergenic
1187826084 X:23334482-23334504 GGGGCCCGGGGCAGCCCCCGCGG - Exonic
1187915571 X:24149880-24149902 GCCGCCCGGCCTAGCGCGGGAGG - Intronic
1190246852 X:48696609-48696631 GCCGCCCGGCTCGGTCCCGGAGG - Intronic
1190304490 X:49074266-49074288 ACCGCCCGGAGCAGCCCCTGCGG - Intronic
1192141135 X:68647835-68647857 GGTGCCCGGCACAGCCCCGCCGG + Exonic
1199724810 X:150569094-150569116 GGCGTCCGTCGCATCCCCGGTGG + Intronic