ID: 1176178802

View in Genome Browser
Species Human (GRCh38)
Location 20:63740256-63740278
Sequence CCGTCCACACCGGCCGCAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 86}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176178784_1176178802 20 Left 1176178784 20:63740213-63740235 CCCGCCGCGCCGGGCTGGGGGCG 0: 1
1: 1
2: 2
3: 52
4: 351
Right 1176178802 20:63740256-63740278 CCGTCCACACCGGCCGCAGCCGG 0: 1
1: 0
2: 1
3: 12
4: 86
1176178778_1176178802 25 Left 1176178778 20:63740208-63740230 CCCTTCCCGCCGCGCCGGGCTGG 0: 1
1: 0
2: 2
3: 16
4: 199
Right 1176178802 20:63740256-63740278 CCGTCCACACCGGCCGCAGCCGG 0: 1
1: 0
2: 1
3: 12
4: 86
1176178785_1176178802 19 Left 1176178785 20:63740214-63740236 CCGCCGCGCCGGGCTGGGGGCGG 0: 1
1: 1
2: 9
3: 77
4: 536
Right 1176178802 20:63740256-63740278 CCGTCCACACCGGCCGCAGCCGG 0: 1
1: 0
2: 1
3: 12
4: 86
1176178789_1176178802 16 Left 1176178789 20:63740217-63740239 CCGCGCCGGGCTGGGGGCGGGGC 0: 1
1: 0
2: 17
3: 102
4: 737
Right 1176178802 20:63740256-63740278 CCGTCCACACCGGCCGCAGCCGG 0: 1
1: 0
2: 1
3: 12
4: 86
1176178780_1176178802 24 Left 1176178780 20:63740209-63740231 CCTTCCCGCCGCGCCGGGCTGGG 0: 1
1: 2
2: 4
3: 63
4: 670
Right 1176178802 20:63740256-63740278 CCGTCCACACCGGCCGCAGCCGG 0: 1
1: 0
2: 1
3: 12
4: 86
1176178792_1176178802 11 Left 1176178792 20:63740222-63740244 CCGGGCTGGGGGCGGGGCCGGGG 0: 1
1: 5
2: 42
3: 336
4: 1576
Right 1176178802 20:63740256-63740278 CCGTCCACACCGGCCGCAGCCGG 0: 1
1: 0
2: 1
3: 12
4: 86
1176178798_1176178802 -6 Left 1176178798 20:63740239-63740261 CCGGGGGCGGGGCCGCGCCGTCC 0: 1
1: 1
2: 5
3: 49
4: 328
Right 1176178802 20:63740256-63740278 CCGTCCACACCGGCCGCAGCCGG 0: 1
1: 0
2: 1
3: 12
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176178802 Original CRISPR CCGTCCACACCGGCCGCAGC CGG Intronic