ID: 1176178802

View in Genome Browser
Species Human (GRCh38)
Location 20:63740256-63740278
Sequence CCGTCCACACCGGCCGCAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 86}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176178778_1176178802 25 Left 1176178778 20:63740208-63740230 CCCTTCCCGCCGCGCCGGGCTGG 0: 1
1: 0
2: 2
3: 16
4: 199
Right 1176178802 20:63740256-63740278 CCGTCCACACCGGCCGCAGCCGG 0: 1
1: 0
2: 1
3: 12
4: 86
1176178798_1176178802 -6 Left 1176178798 20:63740239-63740261 CCGGGGGCGGGGCCGCGCCGTCC 0: 1
1: 1
2: 5
3: 49
4: 328
Right 1176178802 20:63740256-63740278 CCGTCCACACCGGCCGCAGCCGG 0: 1
1: 0
2: 1
3: 12
4: 86
1176178792_1176178802 11 Left 1176178792 20:63740222-63740244 CCGGGCTGGGGGCGGGGCCGGGG 0: 1
1: 5
2: 42
3: 336
4: 1576
Right 1176178802 20:63740256-63740278 CCGTCCACACCGGCCGCAGCCGG 0: 1
1: 0
2: 1
3: 12
4: 86
1176178789_1176178802 16 Left 1176178789 20:63740217-63740239 CCGCGCCGGGCTGGGGGCGGGGC 0: 1
1: 0
2: 17
3: 102
4: 737
Right 1176178802 20:63740256-63740278 CCGTCCACACCGGCCGCAGCCGG 0: 1
1: 0
2: 1
3: 12
4: 86
1176178780_1176178802 24 Left 1176178780 20:63740209-63740231 CCTTCCCGCCGCGCCGGGCTGGG 0: 1
1: 2
2: 4
3: 63
4: 670
Right 1176178802 20:63740256-63740278 CCGTCCACACCGGCCGCAGCCGG 0: 1
1: 0
2: 1
3: 12
4: 86
1176178784_1176178802 20 Left 1176178784 20:63740213-63740235 CCCGCCGCGCCGGGCTGGGGGCG 0: 1
1: 1
2: 2
3: 52
4: 351
Right 1176178802 20:63740256-63740278 CCGTCCACACCGGCCGCAGCCGG 0: 1
1: 0
2: 1
3: 12
4: 86
1176178785_1176178802 19 Left 1176178785 20:63740214-63740236 CCGCCGCGCCGGGCTGGGGGCGG 0: 1
1: 1
2: 9
3: 77
4: 536
Right 1176178802 20:63740256-63740278 CCGTCCACACCGGCCGCAGCCGG 0: 1
1: 0
2: 1
3: 12
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176178802 Original CRISPR CCGTCCACACCGGCCGCAGC CGG Intronic
901919490 1:12526046-12526068 CCCTCCACCCCCGCCACAGCTGG - Intergenic
905714029 1:40132842-40132864 CCGTCCACGCCAGCCGCACCAGG + Intergenic
906204433 1:43979439-43979461 CCGTCCGCAGCCGCCGGAGCCGG + Intronic
911078974 1:93909391-93909413 CCGGCTACTGCGGCCGCAGCGGG + Exonic
913254911 1:116944627-116944649 CCGTCCACACCGACCCCAGCCGG - Intronic
913325295 1:117623020-117623042 TCGTCCAGACCGTCCGCAGTCGG + Exonic
1063954641 10:11255026-11255048 CCGTCCACACCACCTGCTGCAGG - Intronic
1064354238 10:14603832-14603854 CGGTCCACGCCGGGCGCCGCGGG + Intronic
1064697972 10:17987416-17987438 CCCTCCATTCCGGCCTCAGCTGG - Intronic
1065712985 10:28534038-28534060 CCCTCCACCCCGGCCTCGGCTGG - Intronic
1067553781 10:47253755-47253777 CCGGCCAGAGCAGCCGCAGCGGG - Intergenic
1069642320 10:69963881-69963903 CTGTCCACACTGGCCACCGCAGG - Intronic
1069949118 10:72007398-72007420 CCGCCCAGACCGGCCGTGGCGGG + Exonic
1076736853 10:132462818-132462840 CCGTGCCCACCGGCAGCAGGTGG - Intergenic
1077361179 11:2140738-2140760 CCGGCCTCCCCGGCGGCAGCCGG + Intronic
1077445311 11:2587998-2588020 CTTTCCACACCGGGCGCAGTGGG + Intronic
1081618600 11:44605170-44605192 CCGTACTCACCAGCCCCAGCAGG - Exonic
1088764279 11:112961537-112961559 CCGTCCACACTCGCTGCAGGGGG + Exonic
1090807697 11:130212684-130212706 CAGTCCAGACCTGCAGCAGCTGG + Intergenic
1091169665 11:133508755-133508777 CCCTCCACGCCGGATGCAGCTGG + Intronic
1093173222 12:15882398-15882420 GCGTCCACACCGGCATCGGCAGG - Exonic
1103903352 12:124314894-124314916 CCGTCCCCACCGGCTGAGGCTGG - Exonic
1104944386 12:132409219-132409241 CCGTCCACACCGTCCCCAGACGG + Intergenic
1112639346 13:101255380-101255402 CCCTCCACACTGGCAACAGCAGG - Intronic
1115120163 14:29928148-29928170 CCATCCACTCCGTCCGCAGTCGG - Intronic
1119286296 14:73458011-73458033 CTCTCCTCACCGGCCGCTGCCGG + Intronic
1119559472 14:75578715-75578737 CCGGCCGCACACGCCGCAGCCGG - Exonic
1121866492 14:97367149-97367171 CCCTCCACACAGGCTGCAGAAGG + Intergenic
1125752058 15:42036165-42036187 CTGCCATCACCGGCCGCAGCAGG + Intronic
1128508866 15:68301452-68301474 CCGTCCACACTGGCCATAGATGG + Intronic
1129694478 15:77732941-77732963 CCCTCCCCACCGGCCACGGCCGG + Intronic
1130764872 15:86859662-86859684 TCGTCCAGACCTGCTGCAGCTGG - Intronic
1131158675 15:90090478-90090500 CCTTCCACACGGGCCTCATCAGG + Exonic
1133011072 16:2912142-2912164 CTGTCCTCACCGACGGCAGCGGG - Exonic
1134438881 16:14285782-14285804 CCCGCCCCGCCGGCCGCAGCAGG + Intergenic
1136222054 16:28835318-28835340 CCATGCCCACCAGCCGCAGCCGG + Exonic
1141587266 16:85042768-85042790 CCGTGCACAGAGGCAGCAGCAGG + Intronic
1142067674 16:88072111-88072133 CCATCCACGCCCGCCGCCGCGGG - Exonic
1149994351 17:61399194-61399216 CCGCCCGCGCCGGCCCCAGCAGG + Intergenic
1152352403 17:79791075-79791097 CCTCCCACACCGGTCACAGCTGG + Intergenic
1152534239 17:80941234-80941256 CCCTCCACCCCGGGTGCAGCTGG - Intronic
1158404924 18:57152441-57152463 CCTTCCACACGGGCTCCAGCTGG - Intergenic
1160536758 18:79598563-79598585 CGGCTCACACCGGCAGCAGCAGG - Intergenic
1161314915 19:3613288-3613310 CCGTCCACCTCGGCCTCCGCGGG + Exonic
1161582450 19:5088208-5088230 CCGTCCACACCTGCAGGGGCAGG + Intronic
1161585695 19:5104177-5104199 CCCTCCACCCCGGCAGCAGCAGG + Intronic
1162384675 19:10353836-10353858 CCGTCCATCCTGGCCCCAGCAGG + Intronic
1163441301 19:17323832-17323854 CCCTCCGCACCCGCCGCAGCCGG - Exonic
1163577939 19:18121675-18121697 CCCCCCACAGCTGCCGCAGCGGG + Exonic
1163700460 19:18784270-18784292 CCTTCCACAGCAGCCGCACCTGG + Exonic
1164234083 19:23316975-23316997 CCGTCAACACAGACCACAGCTGG + Intronic
1166099046 19:40560185-40560207 CCGCATACACCGTCCGCAGCTGG - Exonic
1168393948 19:56032671-56032693 CCACCCACACCTGCGGCAGCTGG + Exonic
926434771 2:12826620-12826642 CCATCCACACTGGCCTAAGCTGG - Intergenic
934933236 2:98445176-98445198 CCGTCCACATCCGCCCCAGCGGG - Intronic
937207674 2:120246823-120246845 GCCTCCACACCAGACGCAGCGGG - Intronic
938226530 2:129621275-129621297 CCGTCCCCACCTGCCACACCTGG - Intergenic
938392487 2:130916458-130916480 GCGTCCCGACCGGCCGCAGCGGG - Intronic
942560558 2:177213684-177213706 CCCTCCTCAGCGGCCGGAGCCGG - Intronic
1172628617 20:36363467-36363489 CGGTCCACAGCGGTGGCAGCAGG + Intronic
1172886682 20:38235987-38236009 GCGTCCACACCGGCCTCTGTTGG - Intronic
1175902753 20:62366585-62366607 CCCTCCCCACCGGCAGCAGGCGG + Intronic
1176178802 20:63740256-63740278 CCGTCCACACCGGCCGCAGCCGG + Intronic
1183060845 22:35335558-35335580 CCATCCACAGAGGCCCCAGCAGG + Intronic
1184305591 22:43599132-43599154 CCTTCCACAGTGGCCGCAGCAGG + Intronic
1184333256 22:43839117-43839139 CCGTGCACATGGGCCCCAGCTGG - Intronic
1184341662 22:43889585-43889607 CCTCCCACACTGGCTGCAGCCGG + Intronic
950106656 3:10392954-10392976 CTGTCCACACGGGCCTCTGCCGG - Intronic
950667647 3:14506854-14506876 CTGTCCACACTGGGCACAGCCGG + Exonic
954437301 3:50503078-50503100 CCGTCGCCCCCGGGCGCAGCGGG + Intronic
958497369 3:94862909-94862931 CCATCCACATTGGCAGCAGCTGG - Intergenic
968440982 4:624302-624324 CCGTCCACAGTGGGCCCAGCTGG - Intergenic
968498503 4:932207-932229 CCGACCACTCCGGCTGCCGCGGG - Exonic
970394789 4:15655162-15655184 CCGCCCGCACCGCCCACAGCGGG + Intronic
978924921 4:114231607-114231629 CCCTCCACAGCTGCTGCAGCAGG + Intergenic
985571128 5:645890-645912 CCGTCCACACAGGCCGCCGACGG - Intronic
985571148 5:646020-646042 CTGTCCACACAGGCCGCCGATGG - Intronic
986441156 5:7782995-7783017 CCCACCAAACCTGCCGCAGCTGG - Intronic
986706282 5:10457222-10457244 CCGTCCACCTCGGCAGCATCAGG + Intronic
986849625 5:11795882-11795904 ATGTCCACACAGGCCTCAGCAGG + Intronic
989475543 5:41869741-41869763 CATTCCACACCCGCCGCACCCGG + Intronic
998095410 5:139393418-139393440 CCGCCTACACCGTCCGCACCCGG - Exonic
1003377495 6:5593294-5593316 CCGCCCCCACCGGCCTCTGCTGG + Intronic
1007553464 6:42746981-42747003 CCGGCCACTCCCTCCGCAGCTGG + Intronic
1013428691 6:110037055-110037077 GGGTCCACACAGGCTGCAGCTGG + Intergenic
1016739090 6:147509194-147509216 CCGTCCCCACCGGCCGCCGGGGG + Exonic
1018972682 6:168539571-168539593 CCTTCCACACCGGCTCTAGCAGG + Intronic
1019564355 7:1672051-1672073 CCCTCCTCCTCGGCCGCAGCAGG + Intergenic
1019595732 7:1857550-1857572 CCGTTCATCCCAGCCGCAGCAGG - Intronic
1023030252 7:36084775-36084797 CCATCCACACTGGCCGCTGGCGG + Exonic
1023861463 7:44219812-44219834 CAGTCCACACTGGCCAGAGCTGG - Intronic
1031899435 7:127392848-127392870 CCCTCCCCACCGGCCGCGGCGGG - Intronic
1039951983 8:42179962-42179984 CCGTCCAGTCCGGCAGCTGCAGG + Exonic
1052048316 9:23820736-23820758 CCGTGCACCCCGGCCGCCGCTGG + Intronic
1060519237 9:124284654-124284676 CCTTCCACACCTGCCCCTGCAGG + Intronic
1061225946 9:129281051-129281073 CTGTCCACACAGGCCCCAGCTGG - Intergenic
1061868305 9:133506643-133506665 ACCTGCACACCGGCCGCAGGCGG - Intergenic
1062035849 9:134382213-134382235 CCGGCCACAGGGGCAGCAGCAGG - Intronic
1190288365 X:48975272-48975294 CAGGCCACACAGACCGCAGCGGG - Exonic
1192260607 X:69504254-69504276 CAGCCCCCGCCGGCCGCAGCCGG - Intergenic