ID: 1176178918

View in Genome Browser
Species Human (GRCh38)
Location 20:63740602-63740624
Sequence CCCTGACCTGGCCTCCGTCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 146}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176178918_1176178929 23 Left 1176178918 20:63740602-63740624 CCCCGACGGAGGCCAGGTCAGGG 0: 1
1: 0
2: 0
3: 7
4: 146
Right 1176178929 20:63740648-63740670 ACCCCCAAGCTCTTCAGCCCTGG 0: 1
1: 1
2: 1
3: 19
4: 220
1176178918_1176178933 26 Left 1176178918 20:63740602-63740624 CCCCGACGGAGGCCAGGTCAGGG 0: 1
1: 0
2: 0
3: 7
4: 146
Right 1176178933 20:63740651-63740673 CCCAAGCTCTTCAGCCCTGGAGG 0: 1
1: 0
2: 2
3: 22
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176178918 Original CRISPR CCCTGACCTGGCCTCCGTCG GGG (reversed) Intronic
900205028 1:1427951-1427973 CCCTCCCCTGCCCTCCGTGGCGG - Intergenic
901429402 1:9203785-9203807 CCCTCACCCGCCCTCCCTCGAGG + Intergenic
901643532 1:10704951-10704973 GCCTGTCCTGGCCTCGGCCGTGG + Intronic
902609935 1:17591106-17591128 CCCTTCCCTGGCCTCTGTCTTGG - Intronic
902715116 1:18267432-18267454 CCCTGCCCTGGCCTCCCACTTGG + Intronic
903935874 1:26894457-26894479 CCCTGAGCTTCCCTCCCTCGGGG - Intronic
904698964 1:32346975-32346997 CCCTGAGCTGGCCTCATTTGAGG + Intergenic
905275979 1:36818571-36818593 CCCTGCCCTGGCCTCTGCCATGG + Intronic
905667415 1:39771263-39771285 ACCTGTCCTGGCCTCCGACCCGG - Exonic
907524575 1:55046704-55046726 CCCTGGCCTGGCCTCCCTGCTGG + Intronic
920660660 1:207911444-207911466 CCCTGCCCTGGCCACCGGCAAGG - Intergenic
1063122603 10:3115278-3115300 CCCAGTCCTGTCCTCCGCCGTGG - Intronic
1063122615 10:3115325-3115347 CCCAGTCCTGTCCTCCGCCGTGG - Intronic
1063655143 10:7980818-7980840 ACCTGCCCTGGCCTCCATGGTGG - Intronic
1066759824 10:38740145-38740167 CCCTGACCTTGCCTCAGCCCTGG + Intergenic
1066961800 10:42232622-42232644 CCCTGACCTTGCCTCAGCCCTGG - Intergenic
1072241189 10:93496766-93496788 CACTGACCTGCCCTCCCTGGCGG - Exonic
1074807495 10:117068053-117068075 GCCTGACCAGGCCTCTGTCTTGG - Intronic
1076746988 10:132519480-132519502 CTCTGACCTGACCTCCCTCCTGG - Intergenic
1077367141 11:2165846-2165868 TCCTGGCCTGGCCTCCCTGGGGG - Intronic
1080876354 11:36278553-36278575 CCGTGACCTGTCCTCTGCCGAGG - Exonic
1083780354 11:64914331-64914353 CCCTCACCTGGACCCCGGCGGGG + Exonic
1084445793 11:69202803-69202825 CGGTGACCCGCCCTCCGTCGGGG + Intergenic
1089646554 11:119884215-119884237 CCCTGACCCAGCCCCCATCGTGG + Intergenic
1090261228 11:125322107-125322129 CCCTGACCTGGCGTCCTTGAAGG + Intronic
1091792138 12:3278027-3278049 CTCTCACCAGGCCTCCGTCTTGG + Intronic
1096069881 12:48768930-48768952 CCCTCACCTGGATTCGGTCGGGG + Exonic
1101966955 12:109288081-109288103 CCCAGACCTGGCATGCCTCGGGG + Exonic
1107323210 13:39211350-39211372 CCCTGACCTGGCCACCCTAAAGG - Intergenic
1119522206 14:75294459-75294481 CCCTGCCCTTGCCTCCGCCTGGG - Intergenic
1120058094 14:79948916-79948938 CCCTGACCTGGCCTCACTTGGGG + Intergenic
1121339604 14:93097397-93097419 GCATGACCTGGCCTCCTTCTTGG - Intronic
1121453973 14:94026842-94026864 CCCTGTCCCTGCTTCCGTCGAGG - Intronic
1122346937 14:101066629-101066651 CCCTGTGCTGGCCTCCATCCTGG + Intergenic
1122917306 14:104865154-104865176 CCCTAACCTGGTTTCCGGCGGGG + Intergenic
1202930531 14_KI270725v1_random:29642-29664 CCCTGACCTTGCCTCAGCCCTGG + Intergenic
1123421819 15:20141769-20141791 CCCTGACCTCGCCTCAGACCTGG - Intergenic
1123531045 15:21148309-21148331 CCCTGACCTCGCCTCAGACCTGG - Intergenic
1124215578 15:27805344-27805366 CCCAGCCCAGGCCTCCTTCGCGG - Intronic
1125503214 15:40252351-40252373 CCCTGGCCTGGCCACAGCCGCGG - Exonic
1129875578 15:78973359-78973381 CACCGACCTGGCCTTCATCGAGG - Exonic
1132686387 16:1163888-1163910 CCCAGACCTGGCCTTCGAGGTGG - Intronic
1134717327 16:16363482-16363504 CCCTGAACTGCCCCCCGCCGCGG + Intergenic
1134957425 16:18388677-18388699 CCCTGAACTGCCCCCCGCCGCGG - Intergenic
1135725422 16:24850436-24850458 CCCTGGCCTGGCCTGGGTCTAGG - Intronic
1136722980 16:32339114-32339136 CCCTGACCTTGCCTCAGCCCTGG - Intergenic
1136841300 16:33545113-33545135 CCCTGACCTTGCCTCAGCCCTGG - Intergenic
1139389836 16:66600498-66600520 CCCTCACCTGGCCTCCTCCTAGG + Intergenic
1141647179 16:85373785-85373807 CCCTGCCCTGGGCTGCCTCGGGG - Intergenic
1142089566 16:88202831-88202853 ACCTGACCTGGCCTCCCTTCTGG - Intergenic
1203003451 16_KI270728v1_random:178650-178672 CCCTGACCTTGCCTCAGCCCTGG + Intergenic
1203124501 16_KI270728v1_random:1562041-1562063 CCCTGACCTTGCCTCAGCCCTGG + Intergenic
1203135059 16_KI270728v1_random:1715057-1715079 CCCTGACCTTGCCTCAGCCCTGG + Intergenic
1203151465 16_KI270728v1_random:1845410-1845432 CCCTGACCTTGCCTCAGCCCTGG - Intergenic
1143859171 17:9875466-9875488 CCCTGATCTGGCCTCCCTCCAGG + Intronic
1144774692 17:17779390-17779412 CGCTGTCCTGGCCTCCCTGGAGG - Intronic
1146056208 17:29582580-29582602 CCCTGACCTGGCTGCCTTTGGGG + Intronic
1147563796 17:41524498-41524520 CACTGACCTGGCCTCCCACTTGG + Exonic
1151554332 17:74839026-74839048 CCTTGACCTGGCCTGCACCGGGG - Exonic
1152520545 17:80853396-80853418 CCCTGACCTGGCCTCGCTGCAGG - Intronic
1153924858 18:9826854-9826876 CTCTGACCTTCCCTCCTTCGCGG - Intronic
1154414974 18:14171657-14171679 CCCTGACCTTGCCTCAGCCCTGG - Intergenic
1160846010 19:1166252-1166274 CCCTCACCGGGCCTCCCTCTGGG - Intronic
1161068540 19:2249614-2249636 CCGAGACCTGGCCACCTTCGGGG + Exonic
1161552785 19:4923391-4923413 CTCCGACCTGTCCTCCGTCTTGG + Intronic
1161701769 19:5799867-5799889 CCCTGCCCTGGCCTCCTTGGTGG + Intergenic
1162247523 19:9414690-9414712 CACTGACCTCCCCTCCGTTGTGG + Exonic
1163814836 19:19458304-19458326 TCCTGCCCTGGCCTCAGTCTGGG + Intronic
1165099647 19:33431364-33431386 CCCAGCCCTGGCCTCCGGCGGGG - Intronic
1165105661 19:33468465-33468487 ACCTGAGCTGGCCTCCATCGAGG + Intronic
1166763881 19:45241123-45241145 CCCTGCCCTGGCCTCCTCCCTGG + Intronic
1167507010 19:49876254-49876276 TCCGGTCCTGGCCTCCGTCTGGG - Intronic
927490864 2:23520080-23520102 CCCTGACCTGGCTTCTCTCCTGG - Intronic
927573006 2:24175823-24175845 CCCAGACCTGGCTTCTGCCGGGG - Exonic
928084248 2:28335851-28335873 CCCTGAGCTGGCCACGGTCCAGG - Intronic
929146411 2:38710449-38710471 CCCTCACCTGGCCTACTTCTGGG + Intronic
934239017 2:90251928-90251950 CCCTGACCTTGCCTCAGCCCTGG + Intergenic
934323144 2:91984491-91984513 CCCTGACCTTGCCTCAGCCCTGG + Intergenic
934461460 2:94215282-94215304 CCCTGACCTTGCCTCAGCCCTGG + Intergenic
935112494 2:100105402-100105424 CCCGGACCTGCTCTCCGTTGCGG + Intronic
935222472 2:101027327-101027349 CCCTGAGCTGGCCTGAGCCGCGG - Intronic
938548190 2:132353513-132353535 GCCTGACTTGGCCTCAGTCACGG - Intergenic
1169422393 20:5471068-5471090 CCCTGGCCCGGCCTCCCTCTTGG + Intergenic
1169427085 20:5504714-5504736 CCCCGGCCTGGCCTCCTTCTCGG - Intergenic
1171877062 20:30586285-30586307 GCCTGACTTGGCCTCAGTCACGG - Intergenic
1172618928 20:36307077-36307099 CCCTGACCTGGCATCTGGGGAGG + Intronic
1172951649 20:38726469-38726491 TCCTGCCCTGGCCTCCCTTGGGG - Intronic
1175213316 20:57375416-57375438 CCCTGCCCTGGCTTCCGATGGGG + Intronic
1175232309 20:57481601-57481623 CCCTGCCCTGGGCTGTGTCGGGG + Intergenic
1175901388 20:62361244-62361266 CCCTGCCCTGGCCTGGGTCTGGG - Intronic
1176020795 20:62961478-62961500 CCCTGGCCTGGCCTCGATCCAGG - Intronic
1176178918 20:63740602-63740624 CCCTGACCTGGCCTCCGTCGGGG - Intronic
1176592542 21:8658237-8658259 CCCTGACCTTGCCTCAGCCCTGG + Intergenic
1176866106 21:14056055-14056077 CCCTGACCTTGCCTCAGCCCTGG - Intergenic
1179993125 21:44958869-44958891 TCCTGACCTGGCCTGCGCCCAGG + Intronic
1180110224 21:45643931-45643953 CCGTCACTCGGCCTCCGTCGGGG - Intronic
1180275400 22:10635385-10635407 CCCTGACCTTGCCTCAGCCCTGG + Intergenic
1180549891 22:16530368-16530390 CCCTGACCTTGCCTCAGCCCTGG + Intergenic
1181354787 22:22291474-22291496 CCCTGACCTTGCCTCAGCCCTGG - Intergenic
1182104763 22:27681544-27681566 GCTTGACCTGGCCTGCGTAGGGG + Intergenic
1182278913 22:29206946-29206968 ACCTGTCCTGGCCTCTGTCCTGG + Intronic
1182451697 22:30425756-30425778 TCCTGACCTGTCCTTCGGCGCGG + Exonic
1184775059 22:46618966-46618988 CCCTGACCTGGCCTCCCTGCAGG - Intronic
950008358 3:9705262-9705284 CCCTGACTTGGCCTCGGCCCAGG + Intronic
954684881 3:52365063-52365085 CCCTGACCTGGACTCCAAGGTGG - Intronic
955060735 3:55489543-55489565 CCCAGCCCTGGCCTCCTTCCTGG + Intronic
966863204 3:184241927-184241949 CCTTGACCTGGCCGCCCTCAAGG + Exonic
967840767 3:194003176-194003198 CCCTGACCTCGCCTCCCACGCGG + Intergenic
969378304 4:6777792-6777814 CCCTGACCCGACCTCCCTCCTGG - Intergenic
969439986 4:7211315-7211337 CCATGGCCTGCCCCCCGTCGTGG - Intronic
969585500 4:8089141-8089163 CCCTCACCTGGCCTCACTCCAGG - Intronic
970804135 4:20010330-20010352 CCCTGACATGGACTCCCTGGTGG - Intergenic
971756865 4:30718230-30718252 CCCTGCCCTGGCCTCGGAGGAGG + Intergenic
998369452 5:141651435-141651457 GCCTGACCTGGCCTGGGGCGGGG - Intergenic
998595131 5:143521545-143521567 CCCTGCCCAGACCTCCGTCATGG + Intergenic
1001720695 5:173854759-173854781 CCCTGACCTCACCTCCGCCTAGG + Intergenic
1002021925 5:176368946-176368968 CCCTGACCTGCCTGTCGTCGTGG + Exonic
1003062485 6:2874561-2874583 CCCAGCCCTGGCCTCCATCCTGG + Intergenic
1006799725 6:36752257-36752279 CCCTGACCTGGCACCTGTCCTGG + Intronic
1007400359 6:41599444-41599466 CCCTGCCCTGGCCTGGGTGGAGG + Exonic
1008368244 6:50707008-50707030 CCTAGACCAGGCCTCCGTCTGGG + Intergenic
1010057706 6:71585392-71585414 CACTGACCTGGCCTCCCACTTGG - Intergenic
1010789428 6:80048030-80048052 CCCTGACCTGCCAGCCATCGGGG - Intergenic
1015251871 6:131135662-131135684 CCCCGCCCTGGCCTCCGCCTCGG + Exonic
1017980371 6:159395790-159395812 CCCTGACCTGGCAGATGTCGTGG - Intergenic
1019102470 6:169642458-169642480 CCCTGAGCCGGCCTCTTTCGTGG - Intronic
1019164693 6:170090233-170090255 CTCTGACGTGGCCTCTGCCGTGG + Intergenic
1019304679 7:327618-327640 CCCTGCCCTGGCCTCCAGGGTGG + Intergenic
1026953028 7:74360146-74360168 CCCTGTCCTGGCCTTCCTTGGGG + Intronic
1026980600 7:74524381-74524403 CCCAGACCTGGGCTCAGTGGCGG + Intronic
1034271226 7:149804221-149804243 CCTTGAACTGGCCTCGGTGGAGG + Intergenic
1035249367 7:157586928-157586950 CCCTGGCCTGGCCCCGGTGGAGG - Intronic
1035577243 8:715653-715675 CCCTGACCTGGCCTTGGCTGGGG + Intronic
1035588891 8:798285-798307 CCCTCACCTGGCCAGCGCCGGGG - Intergenic
1036490195 8:9218122-9218144 CCCTGACCTGGGCACAGTCTTGG + Intergenic
1036548912 8:9799729-9799751 CCCTGCCCTGGCCTCCTTGTGGG - Intergenic
1036682051 8:10882420-10882442 CCCTGACCTCGCCACGGTGGGGG + Intergenic
1040020542 8:42737045-42737067 CCCTGCACTGGCCTCCTTGGTGG + Exonic
1049560856 8:143309585-143309607 CCCTGACCTGGCCTTCAAGGTGG - Intronic
1053163600 9:35829584-35829606 CCCTGGCCTGGCCCCCATCCCGG + Exonic
1053691937 9:40590935-40590957 CCCTGACCTTGCCTCAGCCCTGG + Intergenic
1054272866 9:63046556-63046578 CCCTGACCTTGCCTCAGCCCTGG - Intergenic
1054303194 9:63391901-63391923 CCCTGACCTTGCCTCAGCCCTGG + Intergenic
1054401973 9:64718411-64718433 CCCTGACCTTGCCTCAGCCCTGG + Intergenic
1054435579 9:65202726-65202748 CCCTGACCTTGCCTCAGCCCTGG + Intergenic
1054494814 9:65818961-65818983 CCCTGACCTTGCCTCAGCCCTGG - Intergenic
1056791581 9:89628624-89628646 CCCTGGCCTGGGCTCCCTGGTGG + Intergenic
1056814698 9:89792723-89792745 CACTGTCCTGGCCTCTGTGGAGG + Intergenic
1060295316 9:122339228-122339250 CCCAGAGCTGGCCTCTGTCTGGG + Intergenic
1060473090 9:123965016-123965038 CCGTGGCCTGGCCTGCCTCGTGG + Intergenic
1061284670 9:129615325-129615347 GCCTGAACTGGCCTCCTTGGAGG - Intronic
1203622597 Un_KI270749v1:137071-137093 CCCTGACCTTGCCTCAGCCCTGG + Intergenic
1186640807 X:11453410-11453432 ACCTGCCCTGGCCTCCAACGGGG + Intronic
1201190567 Y:11439479-11439501 CCCTGACCTTGCCTCAGCCCTGG + Intergenic