ID: 1176185073

View in Genome Browser
Species Human (GRCh38)
Location 20:63773848-63773870
Sequence CCTTTCCAGGAGGCGGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 564
Summary {0: 1, 1: 0, 2: 4, 3: 28, 4: 531}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176185073_1176185080 -8 Left 1176185073 20:63773848-63773870 CCTGCCACCGCCTCCTGGAAAGG 0: 1
1: 0
2: 4
3: 28
4: 531
Right 1176185080 20:63773863-63773885 TGGAAAGGCCCCAGTACCCCGGG 0: 1
1: 0
2: 3
3: 15
4: 160
1176185073_1176185079 -9 Left 1176185073 20:63773848-63773870 CCTGCCACCGCCTCCTGGAAAGG 0: 1
1: 0
2: 4
3: 28
4: 531
Right 1176185079 20:63773862-63773884 CTGGAAAGGCCCCAGTACCCCGG 0: 1
1: 0
2: 1
3: 9
4: 217
1176185073_1176185081 -7 Left 1176185073 20:63773848-63773870 CCTGCCACCGCCTCCTGGAAAGG 0: 1
1: 0
2: 4
3: 28
4: 531
Right 1176185081 20:63773864-63773886 GGAAAGGCCCCAGTACCCCGGGG 0: 1
1: 0
2: 1
3: 6
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176185073 Original CRISPR CCTTTCCAGGAGGCGGTGGC AGG (reversed) Intronic
900279377 1:1856266-1856288 CCTATTCAGGAGGTTGTGGCAGG - Intronic
900846229 1:5103728-5103750 GCTTCTCAGGAGGCTGTGGCAGG + Intergenic
901467396 1:9431173-9431195 GCTATCCAGGAGGCTGAGGCAGG + Intergenic
901854646 1:12036960-12036982 CCTATTCAGGAGGCTGAGGCGGG - Intergenic
902286625 1:15411582-15411604 CCTCTCCAGGAGCCAGGGGCAGG - Intronic
902734387 1:18390562-18390584 CCTCTCCAGGAGGTGGCAGCAGG - Intergenic
902781721 1:18709245-18709267 CCCTTCCACGAGGTCGTGGCAGG - Intronic
902926734 1:19700792-19700814 CCTTTCCGGAAGGTGGTGTCCGG - Exonic
903379559 1:22887262-22887284 CCCTTCCTGGTGGTGGTGGCTGG - Intronic
903916880 1:26771310-26771332 CCTTACCAGGAGAGGGAGGCTGG - Exonic
904149392 1:28424904-28424926 GCTTCCCAGGAGGCTGAGGCAGG - Intronic
904349961 1:29898745-29898767 CCTATTCAGGAGGCTGAGGCAGG + Intergenic
904419905 1:30384859-30384881 CCCCTCCAGGGGGCGGTGCCAGG - Intergenic
905168727 1:36098198-36098220 CCTCTCCAGGGGGCCCTGGCAGG + Exonic
905433164 1:37939250-37939272 CCTATTCAGGAGGCTGAGGCAGG + Intronic
905940980 1:41863166-41863188 ACTTCCCAGGAGGCAGTTGCTGG - Intronic
906306388 1:44722630-44722652 GCTTCCCAGGAGGCTGAGGCAGG + Intronic
906371948 1:45261523-45261545 GCTATCCAGGAGGCTGAGGCAGG + Intronic
906669432 1:47643843-47643865 GCTTCCCAGGAGGAGGTGGCCGG + Intergenic
907132375 1:52108391-52108413 GCTATCCAGGAGGCTGAGGCAGG - Intergenic
909155961 1:72077004-72077026 CCTATTCAGGAGGCTGAGGCAGG - Intronic
910773399 1:90851630-90851652 CCTTCCGAGGAGGCGGTGCTGGG - Intergenic
911010090 1:93271586-93271608 GCTATCCAGGAGGCTGAGGCAGG + Intronic
911614825 1:99998264-99998286 GCTATCCAGGAGGCTGAGGCAGG - Intronic
911745912 1:101442001-101442023 CCTACCCAGGAGGCTGAGGCAGG - Intergenic
913182831 1:116338976-116338998 GCTATCCAGGAGGCTGAGGCAGG - Intergenic
914717470 1:150264584-150264606 CCTTTCCAGGAAGAAGAGGCTGG + Exonic
914794192 1:150906185-150906207 GCTATCCAGGAGGCTGAGGCAGG + Intergenic
915361401 1:155288225-155288247 CCCCTCCAGGAGGAGGTGGACGG + Exonic
915496761 1:156287302-156287324 GCTATTCAGGAGGCGGAGGCAGG + Intronic
916138996 1:161677122-161677144 CCTTTGCGGAAGGCTGTGGCTGG + Intronic
916544521 1:165790162-165790184 GCTATTCAGGAGGCTGTGGCAGG + Intronic
917869661 1:179229813-179229835 CCCTGCGAGGAGGCGGGGGCGGG - Intergenic
917907820 1:179605469-179605491 CCTGTTCAGGAGGAGGTGGGGGG + Intronic
917999718 1:180480917-180480939 GCTATCCAGGAGGCTGAGGCAGG + Intronic
918348226 1:183625593-183625615 CCTTTTCGGGAGGCTGAGGCAGG + Intronic
918489684 1:185068113-185068135 ACTTTACAGGAGGCTGAGGCAGG - Intronic
918513877 1:185341059-185341081 CCTTCTCAGGAGGCTGAGGCAGG - Intergenic
919195971 1:194286914-194286936 GCTTTTCAGGAGGCTGAGGCAGG - Intergenic
920535619 1:206734708-206734730 ACTCTCCAGGAGGCGGTGATAGG + Intergenic
921886409 1:220311513-220311535 GCTTCACAGGAGGCTGTGGCAGG - Intergenic
922087017 1:222359499-222359521 GCTTCCCAGGAGGCTGAGGCAGG + Intergenic
922198451 1:223380895-223380917 CCTACTCAGGAGGCGGAGGCAGG - Intergenic
922824814 1:228510425-228510447 CCTTTCAGGGAGGAGGGGGCTGG + Intergenic
923565002 1:235069972-235069994 AGTTTCCAGGAGGCGTTGGCAGG - Intergenic
923671617 1:236046464-236046486 CCATGCCAGGAGGCTGTGGTTGG + Intronic
924141894 1:241033237-241033259 CCTACCCAGGAGGCTGAGGCAGG + Intronic
1062884797 10:1008291-1008313 CCTATTCAGGAGGCTGAGGCGGG + Intronic
1062995329 10:1860538-1860560 CCCTCCCAGGAGGAGGTGACTGG - Intergenic
1063689433 10:8272392-8272414 GCTTTTCAGGAGGCTGAGGCAGG - Intergenic
1064060388 10:12131800-12131822 CCTCCCCAGGAGGCTGAGGCAGG - Intronic
1064878284 10:20020121-20020143 CCTTTTCAGGAGGCTAAGGCAGG - Intronic
1065067153 10:21981686-21981708 CCTTTTCAGCAGACGGTGCCAGG + Intronic
1065099030 10:22316026-22316048 CGTTTGCGGGAGGCGGGGGCCGG + Exonic
1065551929 10:26876716-26876738 GCTATCCAGGAGGCTGAGGCAGG - Intergenic
1065906635 10:30259696-30259718 CCTATGCAGGAGGCTGAGGCAGG - Intergenic
1069383949 10:67867308-67867330 CCTACCCGGGAGGCTGTGGCAGG - Intergenic
1072743901 10:97926818-97926840 GCTGTCCTGGAGGCAGTGGCAGG + Intronic
1073345386 10:102779182-102779204 GCTTTTCAGGAGGCTGAGGCAGG + Intronic
1073463904 10:103682643-103682665 GCTATTCAGGAGGCGGAGGCAGG + Intronic
1074275984 10:112002537-112002559 AGTTTCCAGGAGGGGGTCGCAGG - Intergenic
1074390694 10:113055688-113055710 CCTATTCAGGAGGCTGGGGCAGG - Intronic
1074404155 10:113166032-113166054 CCTTTCAAGGTGGGGGTGGGGGG - Exonic
1075050144 10:119177508-119177530 CTTAGCCAGGCGGCGGTGGCGGG + Intronic
1075382123 10:122028199-122028221 GCTATCCAGGAGGCTGAGGCAGG - Intronic
1075632522 10:124009791-124009813 GCTCTCCAGAAGGCGGAGGCGGG + Exonic
1075715742 10:124554295-124554317 CCTACCCAGGAGGCGGAGGTGGG - Intronic
1075753018 10:124789641-124789663 GCTACCCAGGAGGCTGTGGCGGG + Intronic
1076009408 10:126975352-126975374 CGTTCCCAGGAGGGGGTTGCTGG + Intronic
1076463976 10:130665952-130665974 CCTGTCCAGGAAGCAGAGGCAGG + Intergenic
1076511144 10:131014453-131014475 CCTTTCCAGGAGAGGGAGCCTGG + Intergenic
1076722761 10:132399948-132399970 CCTTTCCAGCAGTCTGTGTCTGG - Intronic
1077780950 11:5329106-5329128 GCTTCTCAGGAGGCTGTGGCAGG - Intronic
1079664669 11:23089751-23089773 CCTATTCAGGAGGCTGAGGCAGG - Intergenic
1080150240 11:29044195-29044217 GCTATTCAGGAGGCGGAGGCAGG + Intergenic
1080326915 11:31085817-31085839 CCTACTCAGGAGGCTGTGGCAGG - Intronic
1081794774 11:45811755-45811777 CCTCTCCAGGTGGCTGTGGTAGG - Exonic
1082044696 11:47715335-47715357 CCCTCACAGAAGGCGGTGGCGGG - Exonic
1082284030 11:50300969-50300991 TCTTTTCAGGAGGCTGAGGCAGG - Intergenic
1082740639 11:56907228-56907250 CTTTTCCAGGCGGTGGTGGGGGG - Intergenic
1083242586 11:61400007-61400029 GCTATTCAGGAGGCTGTGGCAGG + Intergenic
1083333562 11:61910374-61910396 CCTTTCCAGAAGGCAGGGCCTGG + Intronic
1084542471 11:69796270-69796292 CCTTTCCAGGAGACGGGTGCTGG + Intergenic
1084978758 11:72817345-72817367 ACGTTCCAGGAGGCTGAGGCAGG - Intronic
1085448414 11:76616258-76616280 CACTTCCTGGAGGCAGTGGCTGG - Intergenic
1085505930 11:77059049-77059071 CCTATTCAGGAGGCTGAGGCAGG + Intergenic
1086420294 11:86631842-86631864 CCTATTCAGGAGGCTGAGGCAGG - Intronic
1087492307 11:98844415-98844437 TCTGTCCAGGAGGCAGGGGCTGG + Intergenic
1089622038 11:119727877-119727899 CCTTTCCTGGAGGGTGAGGCCGG - Intronic
1090193420 11:124793767-124793789 CCATTCCAGGAGGTGGTGCCAGG - Intronic
1091186592 11:133653170-133653192 AAATTCCAGGAGGCGGAGGCAGG - Intergenic
1091426168 12:391341-391363 GCTATCCAGGAGGCTGAGGCAGG + Intronic
1091791962 12:3277065-3277087 CCTTTCCAGCAAGCAGTGCCCGG + Intronic
1091849358 12:3682892-3682914 GCTACCCAGGAGGCTGTGGCAGG - Intronic
1092235294 12:6803671-6803693 GCTATCCAGGAGGCTGAGGCAGG + Intronic
1092364549 12:7866111-7866133 GCTACCCAGGAGGCTGTGGCAGG + Intronic
1092500219 12:9038147-9038169 CCTATTCAGGAGGCTGAGGCTGG + Intergenic
1092712641 12:11353934-11353956 GCTTTCCTGGAGGAGGTGGGGGG + Exonic
1093272006 12:17075128-17075150 CCTTCTCAGGAGGCTGTGGCAGG - Intergenic
1094293608 12:28879131-28879153 CCTATTCAGGAGGCTGAGGCAGG + Intergenic
1094543859 12:31385798-31385820 CCTGTACAGGAGGCTGAGGCAGG - Exonic
1094568820 12:31624240-31624262 GCTGTTCAGGAGGCTGTGGCAGG + Intergenic
1094624848 12:32113819-32113841 CCTATTCAGGAGGCTGAGGCAGG - Intronic
1095946612 12:47757536-47757558 TCTTTCCAGGTGGAGGTGGGAGG - Intronic
1096628810 12:52912346-52912368 CTTTTCCAAGAGGCTGGGGCTGG - Intronic
1096857354 12:54493608-54493630 GCTATTCAGGAGGCTGTGGCAGG - Intergenic
1096888548 12:54743378-54743400 CCTTTTCTGGTGGAGGTGGCAGG + Intergenic
1096985542 12:55753833-55753855 GCTATTCAGGAGGCTGTGGCAGG + Exonic
1097526454 12:60742112-60742134 GCTGTCCAGGAGGCTGAGGCAGG - Intergenic
1097991208 12:65836111-65836133 CCTTTCTGGGAGGCAGAGGCGGG + Intronic
1098094106 12:66936312-66936334 GCTTTTCAGGAGGCTGAGGCAGG + Intergenic
1098826561 12:75305369-75305391 CCTCTCCAGGAGTCGGCGGAGGG + Intronic
1098924490 12:76334443-76334465 CTGTTCCAGGAGGCCGAGGCGGG + Intergenic
1100071210 12:90720852-90720874 GCTATCCAGGAGGCTGAGGCAGG - Intergenic
1100324527 12:93528577-93528599 ACTACCCAGGAGGCGGAGGCAGG + Intergenic
1101099218 12:101375187-101375209 CCTTTTCAGGAGGCTGAGGCAGG + Intronic
1102620706 12:114192444-114192466 GCTATTCAGGAGGCGGAGGCAGG - Intergenic
1102685110 12:114718457-114718479 CCTTCCCAGAAGGCTGTGGATGG + Intergenic
1102791060 12:115645907-115645929 GCTATCCAGGAGGCTGAGGCAGG + Intergenic
1103297091 12:119896964-119896986 CCTATTCAGGAGGCTGAGGCAGG - Intergenic
1103480632 12:121247892-121247914 CCTTTCGAGGTGGCTGTGGTGGG + Intronic
1103695615 12:122813080-122813102 GCTTTTCAGGAGGCTGAGGCAGG + Intronic
1104052626 12:125206348-125206370 GCTACCCAGGAGGCGGAGGCAGG - Intronic
1104552751 12:129772487-129772509 CCTTTCCAGGAGTCGTGGGCTGG - Intronic
1104953797 12:132454158-132454180 CCTTCCCAGGAGGCCCGGGCTGG - Intergenic
1104977566 12:132559085-132559107 CCTTTGCAGGAAGCCGTGGCTGG + Intronic
1105020594 12:132814134-132814156 CCTACTCAGGAGGCTGTGGCAGG - Intronic
1105378479 13:19864669-19864691 CCGGACCAGGAGACGGTGGCAGG - Intergenic
1106465873 13:30014119-30014141 CCATTCCAGGAGGCTGGGGTGGG - Intergenic
1106521389 13:30500833-30500855 CCTTCTCAGGAGGCTGAGGCAGG - Intronic
1106579424 13:31004856-31004878 CCTGCTCAGGAGGCGGAGGCAGG - Intergenic
1107016325 13:35710555-35710577 CCTACTCAGGAGGCTGTGGCAGG - Intergenic
1107271828 13:38628188-38628210 GCTATTCAGGAGGCGGAGGCAGG + Intergenic
1107401177 13:40070775-40070797 CCTTCCCAGGCTGCGGAGGCTGG - Intergenic
1108479085 13:50849132-50849154 GCTATCCAGGAGGCTGAGGCAGG - Intergenic
1110982604 13:81919938-81919960 CCTTTCCCGGTGCCGGTGGCAGG + Intergenic
1112988594 13:105482619-105482641 CAGTTCCAGGAGGCTGAGGCAGG - Intronic
1113098442 13:106691100-106691122 CATTTCCAGGAGGCCGTTTCAGG - Intergenic
1113368372 13:109699808-109699830 ACTTTCCACGAGGCCCTGGCTGG + Intergenic
1113845725 13:113389734-113389756 CCTATTCAGGAGGCTGAGGCAGG + Intergenic
1114616875 14:24073016-24073038 CCGGTCCAGGAGGCCATGGCAGG - Exonic
1114830888 14:26140190-26140212 CCTATTCAGGAGGCTGAGGCAGG + Intergenic
1117966308 14:61210200-61210222 GCTTTTCAGGAGGCTGAGGCAGG + Intronic
1119048323 14:71340825-71340847 GCTTTTCAGGAGGCTGAGGCAGG + Intronic
1119384151 14:74246690-74246712 CCATTCCAGGTGGCTGCGGCAGG + Intronic
1119545741 14:75470012-75470034 CCTGCCCAGGAGGCGGCAGCCGG + Exonic
1119648640 14:76367443-76367465 GCTCTCCAGGAGGCTGAGGCAGG + Intronic
1123106238 14:105842838-105842860 GCTTTTCAGGAGGCTGAGGCAGG - Intergenic
1202856022 14_GL000225v1_random:52682-52704 CCTTTATAGGAGCCGCTGGCTGG + Intergenic
1202862373 14_GL000225v1_random:90641-90663 CCTTTATAGGAGCCGCTGGCTGG - Intergenic
1123791321 15:23723614-23723636 CCTACCCAGGAGGCTGAGGCAGG + Intergenic
1123887427 15:24740503-24740525 CCTATTCAGGAGGCTGAGGCGGG - Intergenic
1124014616 15:25864364-25864386 CTTGCCCAGGAGGCCGTGGCTGG + Intronic
1124257162 15:28153537-28153559 CCTACCCAGGAGGCTGAGGCAGG + Intronic
1124571427 15:30867673-30867695 GCTATCCAGGAGGCTGAGGCAGG - Intergenic
1124841836 15:33249431-33249453 CCTTTACGGGAGGCTGAGGCAGG - Intergenic
1125192262 15:37007280-37007302 GCTATCCAGGAGGCGGAGGTGGG + Intronic
1125558272 15:40604456-40604478 GCTATTCAGGAGGCTGTGGCAGG - Intronic
1125635077 15:41181196-41181218 GCTATTCAGGAGGCGGAGGCGGG - Intergenic
1125798112 15:42419253-42419275 GCTATCCAGGAGGCTGAGGCAGG + Intronic
1127559743 15:60124034-60124056 GCTATCCAGGAGGCTGAGGCAGG + Intergenic
1127991058 15:64117678-64117700 CCTATTCAGGAGGCTGAGGCAGG + Intronic
1128338974 15:66806721-66806743 GCTATCCAGGAGGCTGAGGCAGG + Intergenic
1128979866 15:72178324-72178346 CTTTTCCAGGTGGCAGAGGCCGG + Intronic
1129280913 15:74484315-74484337 GCTATCCAGGAGGCTGTGGCAGG + Intergenic
1130153595 15:81331182-81331204 CCTTTTAAGCAGTCGGTGGCCGG + Intergenic
1130246157 15:82251098-82251120 GCTTCCCAGGAGGCTGAGGCAGG + Intronic
1131085760 15:89574674-89574696 CCTATTCAGGAGGCTGAGGCAGG + Intergenic
1131277320 15:90993318-90993340 GCTTTTCAGGAGGCTGAGGCAGG - Intronic
1131383596 15:91984197-91984219 CTTTTCCAGGAGGCGGTAGTGGG + Intronic
1131527273 15:93162466-93162488 CCTTTTAAGTAGTCGGTGGCCGG + Intergenic
1131534290 15:93221690-93221712 CCTTTTAAGCAGTCGGTGGCTGG + Intergenic
1132332406 15:101021981-101022003 TCTTTCCAAGAGGTGATGGCAGG - Intronic
1132437512 15:101821175-101821197 CCTTTCTTGGAGGGGGTGGGAGG + Intergenic
1132542416 16:516932-516954 TCCCTCCAGGAGGCGGGGGCTGG + Intronic
1133103573 16:3493529-3493551 CCTCTCAGGGAGGCGGTGGCGGG + Exonic
1133155948 16:3876148-3876170 GCTATTCAGGAGGCTGTGGCAGG - Intronic
1133215094 16:4287474-4287496 GCTTTTCAGGAGGCTGAGGCAGG - Intergenic
1133236498 16:4389620-4389642 CCTTCCCACCAGGCTGTGGCCGG + Intronic
1134087755 16:11370275-11370297 CCTGTCTAGGAGGCTGAGGCAGG - Intronic
1134291655 16:12906445-12906467 CAATTCCAGGAAGCGGTGGGGGG + Intronic
1134322836 16:13179205-13179227 CCTATTCAGGAGGCTGAGGCGGG + Intronic
1135294511 16:21267637-21267659 TCGGTCCAGGAGGCTGTGGCAGG - Exonic
1135645704 16:24159871-24159893 CCTACCCAGGAGGCTGTGGTGGG + Intronic
1136174347 16:28506972-28506994 CCCTTCCCGGAGGGGGTGGGAGG + Intronic
1136373190 16:29848757-29848779 CCTTCCCAGGTGGGGGTGTCAGG + Intergenic
1136401605 16:30022133-30022155 CCACTCCAGGAGGCTGAGGCAGG + Intronic
1136597688 16:31262819-31262841 CCTTTCCAGAAGAAGGGGGCTGG + Intronic
1137628385 16:49923823-49923845 TCTTTCCGGAAGGAGGTGGCTGG + Intergenic
1137693252 16:50444424-50444446 CCTTCCCAGGAGGCTGAGGCAGG + Intergenic
1138366868 16:56486872-56486894 CCTATTCAGGAGGCTGAGGCAGG - Intronic
1138555415 16:57768232-57768254 GCTATCCAGGAGGCTGAGGCAGG + Intronic
1138644337 16:58412770-58412792 CCTATTCAGGAGGCTGAGGCAGG - Intergenic
1139363585 16:66419133-66419155 GCTATCCAGGAGGCTGAGGCAGG + Intergenic
1139522547 16:67492608-67492630 GCTTTTCAGGAGGCTGAGGCAGG + Intergenic
1140172674 16:72623177-72623199 GCTTTCCAGGAGGCTGAGGCGGG - Intergenic
1140331028 16:74056995-74057017 CCTGTCTTGGAGGCGGGGGCAGG + Intergenic
1140573582 16:76137563-76137585 CCATTCCAGGGGGCTGAGGCAGG + Intergenic
1140640803 16:76970197-76970219 CATTTCTAGGAGGCTGAGGCGGG - Intergenic
1140736343 16:77901273-77901295 GCTATCCAGGAGGCTGAGGCAGG - Intronic
1141643557 16:85355464-85355486 CCTTTCCAGGAAGAGTTGGTAGG - Intergenic
1141741211 16:85894309-85894331 CCTTTCCAGGAGGCCCTGGAGGG + Intergenic
1142181966 16:88675622-88675644 GCTATCCAGGAGGCTGAGGCAGG - Intergenic
1142292321 16:89198827-89198849 TCCTTCCAGGAGGAGGTGGAGGG - Intronic
1142473385 17:175883-175905 CCTTCCCAGGAGGTGGTGACGGG - Intronic
1142725769 17:1812658-1812680 CCTATTCAGGAGGCTGAGGCAGG - Intronic
1142831368 17:2551569-2551591 CTTTGCCAGGAGGCAGTGGTAGG - Intergenic
1143034802 17:3988576-3988598 CCTATTCAGGAGGCTGAGGCAGG - Intergenic
1143540773 17:7567405-7567427 CTATTCCTGGAGGCGGAGGCAGG + Intronic
1143674721 17:8423570-8423592 CCTATTCAGGAGGCTGAGGCAGG + Intronic
1143844383 17:9762903-9762925 GCTTCCCAGGAGGCTGAGGCAGG - Intergenic
1144991788 17:19238059-19238081 CCTTTCCTGGGGGCTGTAGCAGG + Intronic
1145268762 17:21393122-21393144 CCTTTCCAGTAGGGGAGGGCAGG - Intronic
1145737814 17:27245391-27245413 TCTTTCCAGGAGGGGCTTGCAGG - Intergenic
1145809299 17:27755140-27755162 GCTTTCCAGGAGGGGGTGAAGGG - Intergenic
1145926883 17:28654567-28654589 CACTTCCAGGAGGCAGAGGCGGG + Intronic
1146182186 17:30705635-30705657 CCTGTCCAGGAGCCTGAGGCAGG + Intergenic
1146316038 17:31807652-31807674 CCTTCTCAGGAGGCTGAGGCAGG - Intergenic
1147172417 17:38630041-38630063 CCTTCTCAGGAGGCTGAGGCAGG + Intergenic
1147336333 17:39728729-39728751 CTTTTCCTGGAGGGAGTGGCTGG + Intronic
1147549601 17:41430409-41430431 GCTATTCAGGAGGCGGAGGCAGG - Intergenic
1148098199 17:45069401-45069423 GCTATCCAGGAGGCTGAGGCAGG - Intronic
1148410489 17:47462339-47462361 CCTATTCAGGAGGCTGGGGCAGG + Intergenic
1149720377 17:58837742-58837764 ACATTCCAGGAGGCCGAGGCGGG - Intronic
1150318152 17:64187415-64187437 GCTTGGCAGGAGGCGCTGGCTGG - Intronic
1150545557 17:66154065-66154087 CCTATTCAGGAGGCTGAGGCAGG + Intronic
1150606887 17:66699696-66699718 CCTATTCAGGAGGCTGAGGCAGG - Intronic
1152488863 17:80615241-80615263 GCTCTTCAGGAGGCGGTGGCAGG - Intronic
1152577835 17:81150665-81150687 CCTTTCCACGTGGCAGTGCCAGG - Intronic
1152650131 17:81488736-81488758 CCTTTCCTGGAGGCTCTGACAGG - Intergenic
1153599988 18:6771146-6771168 GCTATCCAGGAGGCTGGGGCAGG - Intronic
1155030552 18:21980028-21980050 CCTTTTCAGGAGGCTGAGGCAGG + Intergenic
1157622031 18:49022265-49022287 TATTTCCAGGAGGCTGAGGCGGG - Intergenic
1158691681 18:59666851-59666873 GCTTTCCAGGAGCCTGAGGCAGG + Intronic
1160801934 19:974283-974305 CCTTTCCAGGAGGGGGTGGTGGG + Exonic
1161117721 19:2508142-2508164 CCTACCCAGGAGGCTGAGGCAGG - Intergenic
1162390555 19:10387192-10387214 CCTGTACAGGAGGCTGAGGCAGG + Intergenic
1162918744 19:13888291-13888313 GCGTTCCAGGACGCGGCGGCTGG + Intronic
1162945774 19:14042596-14042618 CCTCACCAGAAGGCGGTGTCTGG - Exonic
1162976646 19:14210167-14210189 CCTGTCCAGGAGCCTGAGGCAGG - Intergenic
1163039583 19:14592405-14592427 GGTTTCCAGGAGGCATTGGCTGG + Intronic
1163712316 19:18854076-18854098 GCCCTCCAGGAGGCTGTGGCCGG - Intronic
1164032654 19:21421955-21421977 GCTATTCAGGAGGCTGTGGCAGG - Intronic
1164525174 19:29008308-29008330 GCTTTTCAGGAGGCTGAGGCAGG - Intergenic
1164589131 19:29496454-29496476 CCTGTCCAGGAGGCTGTGGAGGG + Intergenic
1164632914 19:29773387-29773409 CATTTCCGGGAGGGAGTGGCCGG - Intergenic
1165074240 19:33272140-33272162 CCTTTCTGGGAGGCCGAGGCAGG - Intergenic
1165209064 19:34218113-34218135 CCTACCCAGGAGGCTGAGGCAGG - Intronic
1165233866 19:34404852-34404874 CCTTTCCAGCGGGCTGGGGCGGG + Intronic
1166187945 19:41154055-41154077 GCTATTCAGGAGGCGGAGGCGGG + Intergenic
1166389201 19:42399602-42399624 CCTTTCCAGGAAGCCTGGGCAGG - Intergenic
1166520764 19:43478801-43478823 CCTATTCAGGAGGCTGAGGCAGG + Intronic
1166522217 19:43488040-43488062 GCTTTTCAGGAGGCTGAGGCAGG + Intronic
1167016225 19:46842756-46842778 CCTCTCCAGGAGGAGGTCACTGG - Intronic
1167370895 19:49081191-49081213 GCTACCCAGGAGGCTGTGGCAGG + Intergenic
1167526043 19:49984411-49984433 GGTTTCCAGGAGCCGGTGGCGGG + Intronic
1167641006 19:50681411-50681433 CATTTCTAGGAGGCAGGGGCAGG + Intronic
1168319807 19:55502012-55502034 CCTTTTCAGGAAGCTGAGGCAGG - Intronic
1168686762 19:58353550-58353572 CCTTCCCGGAAGGCGGGGGCAGG + Intergenic
1202677637 1_KI270711v1_random:22197-22219 CCTGTTCAGGAGGCTGAGGCAGG - Intergenic
924984357 2:255483-255505 GCTACCCAGGAGGCGGAGGCAGG + Intronic
925590457 2:5504120-5504142 CCTTTCCTGGAGGCCTTGGGAGG - Intergenic
926092521 2:10060029-10060051 CCTTTGCAGGAGGCAGTCCCGGG + Intronic
927791149 2:26010540-26010562 CCTTCTCAGGAGGCTGAGGCAGG + Intergenic
929200842 2:39234023-39234045 GCTATTCAGGAGGCGGAGGCAGG - Intergenic
929908752 2:46070529-46070551 GCTTTTCAGGAGGCTGAGGCAGG + Intronic
930649115 2:53946800-53946822 CCTTCTCAGGAGGCTGAGGCGGG + Intronic
931121023 2:59219828-59219850 GCTATTCAGGAGGCTGTGGCAGG + Intergenic
931247448 2:60503367-60503389 CCTGTCCAGGCTGCGGTGGGTGG - Intronic
931723810 2:65089322-65089344 GCTATCCCGGAGGCGGAGGCGGG - Intronic
931749335 2:65317101-65317123 CCTTTCCAGGGTCTGGTGGCTGG - Intronic
932320761 2:70820554-70820576 CCCTTCCAGGAGCCAGTGGCTGG - Exonic
932786335 2:74607583-74607605 GCTATCCAGGAGGCTGAGGCAGG - Intronic
936598762 2:113874987-113875009 CCTATTCAGGAGGCTGAGGCAGG + Intergenic
936809331 2:116377720-116377742 CCTTTCCAGGAAGATGTGTCAGG - Intergenic
937302049 2:120848556-120848578 CTTTTGCAGAAGGCGCTGGCAGG + Intronic
937437195 2:121890279-121890301 CCTTTCCTGAAGGCAGTGCCTGG - Intergenic
937901695 2:127024877-127024899 CTCTCCCAGGAGGCGGCGGCAGG + Intergenic
938276176 2:130026120-130026142 TCTTGCCAGCAGGAGGTGGCAGG + Intergenic
938510756 2:131940573-131940595 CCTACCCAGGAGGCTGAGGCAGG - Intergenic
940172316 2:150842749-150842771 CCTGTTCTGGAGGAGGTGGCAGG + Intergenic
940382965 2:153037003-153037025 CCTTCTCAGGAGGCTGAGGCAGG - Intergenic
942465746 2:176205692-176205714 CCTACTCAGGAGGCAGTGGCAGG + Intergenic
942491660 2:176495537-176495559 GCTTTGCAGGAGGCTGAGGCAGG - Intergenic
943889535 2:193268997-193269019 GCTATCCAGGAGGCTGAGGCAGG + Intergenic
944501821 2:200369268-200369290 GCTATCCAGGAGGCTGAGGCAGG - Intronic
944561959 2:200948672-200948694 GCTATCCAGGAGGCTGAGGCAGG - Intronic
944664420 2:201948025-201948047 GCTATCCAGGAGGCTGAGGCAGG - Intergenic
944685238 2:202112208-202112230 CCTTTCCTGGAGGTTGTGGCTGG - Intronic
944769445 2:202898863-202898885 CCTATTCAGGAGGCTGAGGCAGG + Intronic
946403863 2:219482831-219482853 CCTCTCCCGGCGGAGGTGGCAGG + Exonic
946846209 2:223860998-223861020 CCTTCTCAGGAGGCTGAGGCAGG - Intronic
948796143 2:240402873-240402895 CCTTTCCTGGGAGCGGGGGCAGG - Intergenic
948890142 2:240903487-240903509 CCTTTCCAGGGCGCGAGGGCTGG - Intergenic
949011436 2:241681441-241681463 GCTTTCAAGGAGGCAGAGGCAGG + Intronic
1170305232 20:14930916-14930938 GCTTCCCAGGAGGCTGAGGCAGG + Intronic
1170344369 20:15367137-15367159 GCTACCCAGGAGGCTGTGGCAGG - Intronic
1172402039 20:34659008-34659030 ACTTCCCAGTAGGGGGTGGCCGG - Intronic
1172605195 20:36209203-36209225 CCTGTCCAGGAGTCACTGGCAGG + Intronic
1173136414 20:40443118-40443140 CCATTCCTGGAGGCTGTGGTGGG - Intergenic
1173162320 20:40662210-40662232 GCTATTCAGGAGGCGGAGGCAGG - Intergenic
1173788573 20:45812878-45812900 CCGCTCCAGGAGGTGGCGGCGGG - Intronic
1173923809 20:46765640-46765662 CCTTGGCAGCAGGCGGTGGGAGG + Intergenic
1174536318 20:51254201-51254223 CTTTTCCAGAAGGCGGCAGCAGG + Intergenic
1175054549 20:56186129-56186151 CCTATTCAGGAGGCTGAGGCAGG + Intergenic
1175294226 20:57897392-57897414 CCTTGCCAGGATGCGGTCCCGGG + Intergenic
1175377145 20:58535855-58535877 CAATTCCAGGAGGCTGAGGCAGG - Intergenic
1175843411 20:62045693-62045715 CCTTTCCAGGAGCAGGTGTGTGG - Intronic
1176045510 20:63090757-63090779 CCCTTGCGGGAGGCGTTGGCTGG + Intergenic
1176185073 20:63773848-63773870 CCTTTCCAGGAGGCGGTGGCAGG - Intronic
1176671962 21:9743771-9743793 CCTCTCCAGGTGCCGGGGGCTGG + Intergenic
1176783077 21:13222728-13222750 CCTACCCAGGAGGCTGAGGCAGG + Intergenic
1176793371 21:13346901-13346923 ACTTTACAGGAGGTGATGGCTGG - Intergenic
1177328646 21:19627998-19628020 GCTATCCAGGAGGCTGAGGCAGG + Intergenic
1177980717 21:27911535-27911557 CCTATTCAGGAGGCTGAGGCAGG + Intergenic
1178053023 21:28768572-28768594 CCTATCCAGGAGTGGGTGGTAGG - Intergenic
1178080206 21:29055561-29055583 GCTTTTCAGGAGGCGGAGGTGGG + Intergenic
1178118439 21:29442267-29442289 GCTTCTCAGGAGGCGGAGGCAGG - Intronic
1178344173 21:31810956-31810978 CCTATTCAGGAGGCTGAGGCAGG - Intergenic
1178543449 21:33474661-33474683 CCTATTCAGGAGGCTGAGGCAGG + Intronic
1179413821 21:41182045-41182067 GTTTCCCAGGAGGAGGTGGCTGG + Intronic
1179801073 21:43811722-43811744 TCTTTCCAGGGGGCGGCGGATGG - Intergenic
1179942485 21:44649104-44649126 TCTGTCCAGCAGGCGGTGGAGGG - Intronic
1180156587 21:45981281-45981303 CCTCTGCAGGAGGCGGTTGGTGG + Intergenic
1180539618 22:16431725-16431747 CCTATCAAGGGGGCGGGGGCAGG + Intergenic
1181300568 22:21877869-21877891 GCTATCCAGGAGGCTGAGGCAGG + Intergenic
1181564347 22:23725470-23725492 GCTTCTCAGGAGGCTGTGGCAGG - Intergenic
1182099957 22:27650807-27650829 CGTGTCCAGGAGGCGGGGGGTGG - Intergenic
1182356454 22:29724320-29724342 CCTTTCCTGTTGGCGGTCGCTGG - Intronic
1182418541 22:30236987-30237009 CCTGTGCAGAAGGCTGTGGCTGG + Intergenic
1182619291 22:31609985-31610007 CCTTAGAGGGAGGCGGTGGCAGG + Intronic
1182693866 22:32183168-32183190 GCTATCCAGGAGGCTGAGGCAGG - Intergenic
1182892000 22:33826951-33826973 CCTTTTCAGGTGGAGGAGGCTGG - Intronic
1184367448 22:44061317-44061339 CCTATTCAGGAGGCTGAGGCTGG + Intronic
1184473238 22:44707510-44707532 CCCTGCCAGGAGGCAGAGGCTGG - Intronic
1184524937 22:45016700-45016722 GCTATTCAGGAGGCGGAGGCAGG - Intergenic
1185389989 22:50554580-50554602 CCTACCCAGGAGGCTGAGGCAGG + Intronic
949361989 3:3242191-3242213 GCTATCCAGGAGGCTGAGGCAGG - Intergenic
949892434 3:8743400-8743422 GGCTTCCAGGAGGTGGTGGCTGG - Intronic
949944723 3:9180817-9180839 CATTTGCAGGAGGTGCTGGCGGG - Intronic
949984629 3:9530841-9530863 ACTTTGCAGGAGGCTGAGGCAGG - Intronic
950840784 3:15966480-15966502 GCTATTCAGGAGGCTGTGGCAGG - Intergenic
951692664 3:25412905-25412927 CCTATTCAGGAGGCTGAGGCAGG + Intronic
952300430 3:32100017-32100039 CCTATTCAGGAGGCTGAGGCAGG - Intergenic
952828408 3:37543200-37543222 CCCTTGCAGCAGGCGCTGGCAGG + Intronic
953360765 3:42294345-42294367 CCTATTCAGGAGGCTGAGGCAGG - Intergenic
953630483 3:44611901-44611923 GCTATCCAGGAGGCTGAGGCAGG - Intronic
953665892 3:44926249-44926271 ACTGCCCAGGAGGCAGTGGCGGG - Exonic
953750222 3:45602950-45602972 GCTATCCAGGAGGCTGAGGCAGG - Intronic
953980196 3:47409813-47409835 CCTGTCCAGGAGCTGCTGGCGGG - Exonic
953999749 3:47546719-47546741 GCTTTGCAGGAGGCTGAGGCGGG + Intergenic
954021502 3:47746332-47746354 CCTATCCAGGAGGCTGGGGTGGG + Intronic
954498138 3:50983991-50984013 GCTCTCCATGAGGCTGTGGCTGG - Intronic
954838550 3:53492641-53492663 CCTATTCAGGAGGCTGAGGCAGG + Intergenic
955009181 3:54997612-54997634 GCTATCCAGGAGGCTGAGGCAGG + Intronic
955219996 3:57015543-57015565 CCTACCCAGGAGGCTGAGGCGGG - Intronic
955388680 3:58501641-58501663 TCTTTCCAGGAACCTGTGGCAGG - Exonic
956101109 3:65769375-65769397 CCTATTCAGGAGGCTGAGGCAGG + Intronic
956684407 3:71810939-71810961 GCTATCCAGGAGGCTGAGGCAGG + Intergenic
958476641 3:94592290-94592312 CCTACTCAGGAGGCGGAGGCAGG + Intergenic
959419224 3:106111564-106111586 CCTGTCCGGGAGGAGGTGGGGGG - Intergenic
960063069 3:113343171-113343193 GCTACCCAGGAGGCTGTGGCGGG - Intronic
961067307 3:123886507-123886529 CCTATTCAGGAGGCTGAGGCAGG - Intergenic
965040782 3:163503715-163503737 CCTATTCAGGAGGCTGAGGCAGG + Intergenic
965568280 3:170144815-170144837 GCTTTTCAGGAGGCTGAGGCAGG - Intronic
965777757 3:172250926-172250948 GCTATCCAGGAGGCTGAGGCAGG - Intronic
966195835 3:177313045-177313067 GCTCTCCAGGAGGCTGAGGCAGG - Intergenic
966794568 3:183701190-183701212 CCTACCCAGGAGGCTGAGGCAGG - Intronic
967030084 3:185597763-185597785 CCTATTCAGGAGGCTGAGGCAGG - Intronic
967273408 3:187749770-187749792 CCTTTTCAGAAGGCAGTAGCTGG - Intergenic
967400970 3:189060118-189060140 GCTTTTCAGGAGGCTGAGGCAGG + Intronic
967567027 3:190985584-190985606 GCTTTTCAGGAGGCTGAGGCAGG - Intergenic
967862487 3:194162367-194162389 GCTATCCAGGAGGCTGAGGCGGG + Intergenic
967875253 3:194264514-194264536 CCTACTCAGGAGGCGGAGGCAGG + Intergenic
968082387 3:195855381-195855403 CCTATTCAGGAGGCTGAGGCAGG + Intergenic
968934636 4:3603609-3603631 GGCTTCCAGGAGGAGGTGGCGGG + Intergenic
969652816 4:8477908-8477930 CCCTTCCAGGAGGCGGCGGCAGG - Intronic
969850188 4:9949974-9949996 CCTTCCCAGGAGGCAGTTGTTGG - Intronic
970515454 4:16825074-16825096 GCCTTCCTGGAGGGGGTGGCTGG + Intronic
970713549 4:18893322-18893344 GCTATCCAGGAGGCTGAGGCAGG + Intergenic
970781685 4:19745373-19745395 GCTATTCAGGAGGCTGTGGCAGG - Intergenic
970784143 4:19775703-19775725 GCTACCCAGGAGGCGGAGGCAGG + Intergenic
972544822 4:40070558-40070580 CCACTCCAGGAGGCTGAGGCAGG - Intronic
972763684 4:42131905-42131927 CCTTTGCAGCAGGCCTTGGCTGG - Intronic
973680980 4:53319641-53319663 GCTATCCAGGAGGCTGAGGCAGG - Intronic
973685501 4:53365790-53365812 CGTCTCCTGGAGGCGGTGGGGGG - Exonic
974107497 4:57486823-57486845 GCTATCCAGGAGGCCGAGGCAGG + Intergenic
974349209 4:60723017-60723039 CCACTCCAGGGGGCGGAGGCAGG + Intergenic
974802536 4:66836907-66836929 CCCTTGCAGGATGCAGTGGCTGG - Intergenic
974907719 4:68078068-68078090 CCCTCCCAGGAAGCGGTGGATGG + Intronic
974922130 4:68254863-68254885 CCTATTCAGGAGGCTGAGGCAGG + Intergenic
975811769 4:78177197-78177219 CATTTCCAGGAGGCTGAGGCAGG - Intronic
975959492 4:79884732-79884754 GCTATTCAGGAGGCTGTGGCAGG - Intergenic
975969860 4:80020272-80020294 ACTATTCAGGAGGCTGTGGCAGG + Intronic
976430237 4:84955089-84955111 GCTATTCAGGAGGCTGTGGCAGG + Intronic
976749426 4:88439260-88439282 CCTACTCAGGAGGCTGTGGCGGG + Intronic
977237316 4:94524255-94524277 GCTATCCAGGAGGCTGAGGCAGG + Intronic
977588934 4:98805398-98805420 GCTATCCAGGAGGCTGAGGCAGG + Intergenic
977638499 4:99328324-99328346 GCATTCTAGGAGGCTGTGGCAGG - Intergenic
978308950 4:107364410-107364432 GCTATCCAGGAGGCTGAGGCAGG - Intergenic
978529654 4:109701206-109701228 CACTTCCAGGAGGCTGAGGCAGG - Intronic
979861193 4:125695854-125695876 CCTACTCAGGAGGCTGTGGCAGG + Intergenic
980810387 4:137870570-137870592 GCTATCCAGGAGGCTGAGGCAGG - Intergenic
980990303 4:139733794-139733816 CCTACCCAGGAGGCTGAGGCAGG - Intronic
982267429 4:153551467-153551489 CCTATTCAGGAGGCTGAGGCAGG - Intronic
983149403 4:164259430-164259452 GCTATCCAGGAGGCTGAGGCAGG + Intronic
984021334 4:174487785-174487807 GCTTTTCAGGAGGCTGAGGCAGG - Intergenic
984661023 4:182375651-182375673 GCTGCCCAGGAGGCGGAGGCAGG - Intronic
985647981 5:1093999-1094021 CCTGTCCTGAAGGCTGTGGCGGG - Intronic
988549194 5:32185091-32185113 CCTATTCAGGAGGCTGAGGCAGG + Intergenic
990241017 5:53816796-53816818 CCTTTCCAGGGTGAGGTGGGGGG + Intergenic
990376217 5:55173345-55173367 CCTCGGCCGGAGGCGGTGGCGGG - Intergenic
990779927 5:59348967-59348989 GCTACCCAGGAGGCTGTGGCTGG + Intronic
990963979 5:61424837-61424859 GCTATCCAGGAGGCTGAGGCAGG - Intronic
991563206 5:67976892-67976914 GCTTTCCCAGAGGGGGTGGCTGG + Intergenic
991673844 5:69073956-69073978 GCTATCCAGGAGGCTGAGGCAGG - Intergenic
992841571 5:80700267-80700289 CCTTCTCAGGAGGCTGAGGCAGG + Intronic
993144880 5:84081137-84081159 CATTTCCAGGAGTCGGGGCCAGG + Intronic
993983022 5:94565451-94565473 GCTATCCAGGAGGCTGAGGCAGG - Intronic
994267884 5:97739341-97739363 ACTGCCCAGGAGGCAGTGGCTGG + Intergenic
994372131 5:98979216-98979238 GCTATCCAGGAGGCTGAGGCAGG - Intergenic
997503948 5:134401202-134401224 GCTATCCAGGAGGCTGGGGCAGG - Intergenic
998336614 5:141377357-141377379 CCTCTTCAGGAGGCTGAGGCAGG + Intronic
999256280 5:150211513-150211535 CCCTGCCAGGAGGGGGTGGGTGG - Intronic
1000105238 5:158053024-158053046 GCTATCCAGGAGGCTGAGGCAGG + Intergenic
1001303755 5:170556520-170556542 CCTCTCCAGGAGGTGGGGGGTGG + Intronic
1001464435 5:171950773-171950795 CCTATTCAGGAGGCTGAGGCAGG + Intronic
1001732724 5:173972432-173972454 CCTGTTCAGGAGGCTGGGGCGGG - Intergenic
1001746667 5:174098000-174098022 CCTTCCCAGCAGAAGGTGGCTGG + Intronic
1002378621 5:178807922-178807944 CCTACCCAGGAGGCTGAGGCAGG + Intergenic
1002524082 5:179806150-179806172 CCTGCCCAGGTGGCTGTGGCTGG + Intronic
1003280785 6:4689717-4689739 CCTATTCAGGAGGCTGAGGCAGG + Intergenic
1004191747 6:13470277-13470299 CCATGCCAGCAGGCTGTGGCTGG + Intronic
1004754106 6:18593197-18593219 CCTACCCAGGAGGCTGAGGCAGG - Intergenic
1005051322 6:21686512-21686534 GCTATTCAGGAGGCGGAGGCAGG + Intergenic
1005755622 6:28923220-28923242 CCGCTCGAGGAGGCGGTGGAGGG - Exonic
1005881044 6:30061300-30061322 CCTTTCCAGGGGCCGGTGAGAGG - Exonic
1005980734 6:30834588-30834610 CCACTCCAGCAGGCAGTGGCAGG - Intergenic
1006290900 6:33135939-33135961 CCTATTCAGGAGGCTGAGGCAGG - Intergenic
1006676981 6:35771520-35771542 CCAGTCCAGGAGGAGGCGGCAGG + Intergenic
1006861820 6:37176723-37176745 CCTATGCAGGAGGCTGAGGCAGG + Intergenic
1006957416 6:37886124-37886146 GCTATTCAGGAGGCTGTGGCAGG + Intronic
1007248958 6:40482755-40482777 CCTGGCCAGGAGGGGGAGGCAGG - Intronic
1007781556 6:44257480-44257502 CCGCTCCTGGAGGCGGCGGCGGG - Exonic
1010578938 6:77569640-77569662 GCTATCCAGGAGGCTGAGGCAGG + Intergenic
1012273221 6:97240736-97240758 TCTTCTCAGGAGGCTGTGGCAGG - Intronic
1013123814 6:107163712-107163734 CCTACCCAGGAGGCTGAGGCAGG - Intronic
1015945030 6:138490742-138490764 CCTTCTCAGGAGGCTGAGGCAGG - Intronic
1016830522 6:148429272-148429294 GCTATCCAGGAGGCTGAGGCAGG + Intronic
1018986304 6:168639895-168639917 CCCTCTCAGGAGGCTGTGGCTGG - Intronic
1019292990 7:259291-259313 CCCTTGCAGGATGTGGTGGCCGG - Intronic
1019325013 7:433728-433750 CACTTCCAGGAGGAGGCGGCTGG - Intergenic
1019475828 7:1243830-1243852 CCTCTCCTGGCGGCGGGGGCGGG + Intergenic
1019521612 7:1463198-1463220 CCTATCCAGGAGGCTGAGGCAGG + Intergenic
1019583335 7:1780545-1780567 GCTTCCCAGGAGGCTGAGGCAGG + Intergenic
1019991499 7:4694947-4694969 CCTTACCAAGAAGCTGTGGCTGG + Intronic
1020024372 7:4888551-4888573 CCTTTCCTGGAGTCAGTTGCCGG - Intergenic
1020031270 7:4934516-4934538 CGTTTCCAGCAGGCTGTGGCTGG + Intronic
1020169839 7:5836547-5836569 GCTTTTCAGGAGGCTGAGGCAGG - Intergenic
1020677660 7:11200093-11200115 GCTTTTCAGGAGGCTGAGGCAGG + Intergenic
1021714739 7:23451480-23451502 TCATTCCAGGAGGCTGAGGCAGG + Intronic
1022973449 7:35537167-35537189 CCAGTTCAGAAGGCGGTGGCTGG - Intergenic
1023903084 7:44499310-44499332 GCTATCCAGGAGGCAGAGGCAGG + Intergenic
1024308837 7:47950596-47950618 GCTATCCAGGAGGCTGAGGCAGG + Intronic
1025940212 7:66071303-66071325 CCTTGCCATGAGGCTGCGGCAGG - Intergenic
1026009841 7:66628474-66628496 CCTTTCCTGGAGGATGTGGCGGG - Intergenic
1026621622 7:71954538-71954560 CCTTCTCAGGAGGCTGAGGCAGG + Intronic
1027029031 7:74874964-74874986 CAATTCCAGGAGGCCGAGGCGGG + Intergenic
1027253161 7:76411944-76411966 GCTACCCAGGAGGCTGTGGCAGG + Intronic
1027345160 7:77252035-77252057 GCTATCCAGGAGGCTGAGGCAGG + Intronic
1027668223 7:81066076-81066098 GCTTTTCAGGAGGCTGAGGCAGG - Intergenic
1029571249 7:101371087-101371109 CATTTCCAAGAGGCAGTGGTGGG - Intronic
1029723814 7:102388868-102388890 GCTATTCAGGAGGCTGTGGCAGG + Intronic
1031458964 7:122021627-122021649 GCTTCCCAGGAGGCTGAGGCTGG + Intronic
1031668360 7:124513539-124513561 GCTATTCAGGAGGCTGTGGCAGG + Intergenic
1032117668 7:129130299-129130321 CCTTCCCCAGAGGCTGTGGCTGG + Intergenic
1032196420 7:129791644-129791666 GCTATCCAGGAGGCTGAGGCAGG + Intergenic
1032827162 7:135582172-135582194 CCTTCTCAGGAGGCTGAGGCTGG + Intronic
1033172780 7:139098553-139098575 CCTATTCAGGAGGCTGGGGCAGG + Intronic
1033333318 7:140432822-140432844 CCTACCCAGGAGGCTGAGGCAGG + Intergenic
1034638451 7:152585540-152585562 CCCTTCCGGGAGGAGGTGGGGGG - Intergenic
1035582865 8:751021-751043 CCTTTCCGTGAGAGGGTGGCCGG - Intergenic
1035582934 8:751301-751323 CCTTTCCGTGAGAGGGTGGCCGG - Intergenic
1035582943 8:751341-751363 CCTTTCCACGAGAGGATGGCCGG - Intergenic
1037105113 8:15097060-15097082 CCTATTCAGGAGGCTGAGGCAGG - Intronic
1037135063 8:15450556-15450578 GCTTTTCAGGAGGCTGAGGCAGG + Intronic
1037550951 8:19970908-19970930 CCTTCTCAGGAGGCTGAGGCAGG - Intergenic
1037804960 8:22053973-22053995 CCTTCCCAGGGGGAGGAGGCCGG + Intronic
1038764006 8:30410845-30410867 GCTTTCCAGGAGGCTGGGGTAGG - Intronic
1038806242 8:30794712-30794734 GCTTCCCAGGAGGCTGAGGCAGG - Intronic
1039217117 8:35284664-35284686 GCTATCCAGGAGGCTGAGGCAGG - Intronic
1039774894 8:40725657-40725679 GATTTCCAGGAGGCTGAGGCAGG + Intronic
1039857462 8:41428412-41428434 CCTATTCAGGAGGCTGAGGCAGG + Intergenic
1039920069 8:41887360-41887382 CCTACTCAGGAGGCTGTGGCAGG - Intronic
1040037497 8:42884811-42884833 CCTACCCAGGAGGCTGAGGCAGG - Intronic
1040858276 8:51972747-51972769 CCTATTCAGGAGGCCGAGGCAGG + Intergenic
1042210507 8:66376032-66376054 CATTTCCACAAAGCGGTGGCTGG - Intergenic
1042856240 8:73271074-73271096 CTTATCCAGGAAGGGGTGGCAGG - Intergenic
1043464032 8:80487181-80487203 CCTTCCGAGGCGGCGGCGGCGGG + Exonic
1043908765 8:85836472-85836494 CCTATTCAGGAGGCTGAGGCAGG - Intergenic
1044617366 8:94156061-94156083 CCATTCCAAGAGGCAGTGACGGG - Intronic
1045342208 8:101264995-101265017 CCTGTCCAGGATGGGGTAGCAGG + Intergenic
1047485545 8:125327152-125327174 GCTATCCAGGAGGCTGAGGCAGG + Intronic
1047571801 8:126107047-126107069 GCTACCCAGGAGGCGGAGGCAGG - Intergenic
1048388067 8:133932116-133932138 GCTATTCAGGAGGCGGAGGCAGG - Intergenic
1049206857 8:141367533-141367555 ACCATCCAGGAGGTGGTGGCTGG + Intergenic
1049206911 8:141367807-141367829 ACCATCCAGGAGACGGTGGCTGG + Intergenic
1049478639 8:142809528-142809550 CTTCTCCAGGAAGCGGCGGCTGG - Intergenic
1049534033 8:143169784-143169806 CCTTTCCAGGGGACGGAGCCAGG - Intergenic
1049694119 8:143975362-143975384 CCCTTCCAGGAGGCCATGTCGGG - Intronic
1049779233 8:144420577-144420599 CCTATTCAGGAGGCTGAGGCAGG + Intergenic
1050552094 9:6757713-6757735 CCTTGCCCGGAAGCGCTGGCTGG - Intronic
1050744020 9:8857249-8857271 CCTTTAAAAAAGGCGGTGGCAGG + Intronic
1051483523 9:17584389-17584411 CCTACCCAGGAGGCTGAGGCAGG + Intronic
1052346667 9:27416780-27416802 GCTTTTCAGGAGGCTGAGGCAGG - Intronic
1052807097 9:33023333-33023355 CCTTCTCAGGAGGCTGTGGCAGG - Intronic
1053593258 9:39534154-39534176 CCTTTCCAGGAGGGGGTGGTGGG - Intergenic
1053822012 9:41977729-41977751 GCTTCCCAGGAGGCTGAGGCAGG - Intronic
1053850992 9:42288862-42288884 CCTTTCCAGGAGGGGTTGGTGGG - Intergenic
1054455531 9:65428369-65428391 GGCTTCCAGGAGGAGGTGGCTGG - Intergenic
1054573048 9:66831123-66831145 CCTTTCCAGGAGGGGGTGGTGGG + Intergenic
1054608561 9:67209680-67209702 GCTTCCCAGGAGGCTGAGGCAGG + Intergenic
1055945522 9:81688700-81688722 GCTTTCCCCGAGGCGGCGGCGGG + Exonic
1055980686 9:81997117-81997139 CCTATGCAGGAGGCTGAGGCAGG - Intergenic
1056166048 9:83941799-83941821 GCTATCCAGGAGGCTGAGGCAGG + Intronic
1056257672 9:84816665-84816687 CCTATTCAGGAGGCTGAGGCAGG + Intronic
1057008928 9:91584433-91584455 CCTTGCCAGGTGGCAGTGACGGG - Intronic
1057472848 9:95373212-95373234 GCTTTCCAGGAGGCTATGCCTGG + Intergenic
1058099306 9:100901215-100901237 CCTTTGCAGGAAGTGGTGCCTGG - Intergenic
1058703478 9:107620055-107620077 TCTCTCCAGGAGGCTGTGGGAGG + Intergenic
1059831617 9:118102267-118102289 GCTATTCAGGAGGCGGAGGCAGG + Intergenic
1060593222 9:124832455-124832477 GCTTTTCAGGAGGCTGAGGCAGG + Intergenic
1060873753 9:127065049-127065071 GCTATTCAGGAGGCTGTGGCGGG - Intronic
1061020469 9:128011133-128011155 TCTTTACAGGAGGCAGGGGCTGG + Intergenic
1061071275 9:128312247-128312269 GCTTTTCAGGAGGCTGAGGCAGG - Intronic
1061708715 9:132472653-132472675 GCTATGCAGGAGGCTGTGGCGGG + Intronic
1061858525 9:133456060-133456082 CCTTTTCAGGTGCCTGTGGCAGG + Exonic
1061937746 9:133867546-133867568 CCTTTCCAGGACCCCCTGGCAGG + Intronic
1061997379 9:134193403-134193425 CCCTGGCAGGAGGCAGTGGCTGG - Intergenic
1062609703 9:137368466-137368488 CCTTCCCACGAGGCGGAGACGGG + Intronic
1185614928 X:1415050-1415072 CCTATTCAGGAGGCTGAGGCAGG - Intronic
1185729644 X:2451119-2451141 CCTACTCAGGAGGCTGTGGCAGG + Intronic
1186981719 X:14964201-14964223 CCTTCCCAGAAGTCTGTGGCTGG - Intergenic
1187178666 X:16921087-16921109 GCTATTCAGGAGGCGGAGGCAGG + Intergenic
1187503307 X:19857930-19857952 CCATTTCAGGAGGCCGAGGCGGG + Intronic
1187892517 X:23949728-23949750 GCTTTTCAGGAGGCTGAGGCAGG - Intergenic
1187911112 X:24112126-24112148 GCTATCCAGGAGGCTGAGGCAGG - Intergenic
1187946138 X:24427914-24427936 CCCTTCCTGGAGGCTGTGCCTGG - Intergenic
1189416860 X:40822847-40822869 GCTATTCAGGAGGCTGTGGCGGG + Intergenic
1189516762 X:41720322-41720344 CCTCTCCAGGAAGTGGTGTCTGG - Intronic
1189571107 X:42298388-42298410 CCTTTCGTGGAGGTGGTGGAGGG + Intergenic
1190231871 X:48588460-48588482 GCTATCCAGGAGGCTGAGGCGGG - Intergenic
1190273322 X:48884057-48884079 GCTATCCAGGAGGCTGAGGCAGG + Intergenic
1190286165 X:48962659-48962681 CCTCCCCTGGCGGCGGTGGCAGG - Exonic
1192103479 X:68290485-68290507 CCTACCCAGGAGGCTGAGGCAGG + Intronic
1192443201 X:71190325-71190347 GCTATCCAGGAGGCTGAGGCAGG - Intergenic
1192448466 X:71227569-71227591 CCTCTCCAGGGGGCAGTGGTGGG + Intergenic
1192929630 X:75792166-75792188 CCTGTCCTGGTGGAGGTGGCAGG - Intergenic
1194716489 X:97292138-97292160 CCTATTCAGGAGGCTGAGGCAGG - Intronic
1195253362 X:103069823-103069845 GCTATCCAGGAGGCTGAGGCAGG + Intergenic
1198557261 X:137808354-137808376 GCTATCCAGGAGGCTGGGGCAGG + Intergenic
1198567143 X:137916364-137916386 CCTACCCAGCAGGTGGTGGCAGG + Intergenic
1199640476 X:149856459-149856481 GCTTTTCAGGAGGCTGAGGCAGG - Intergenic
1200276514 X:154737876-154737898 GCTTTTCAGGAGGCTGAGGCAGG + Intronic