ID: 1176185448

View in Genome Browser
Species Human (GRCh38)
Location 20:63775881-63775903
Sequence CTCTATGCACAGGTGGAGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 206}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176185448_1176185455 3 Left 1176185448 20:63775881-63775903 CCCTCCTCCACCTGTGCATAGAG 0: 1
1: 0
2: 1
3: 19
4: 206
Right 1176185455 20:63775907-63775929 GGCCCTCTCTCCTCGGCTGTCGG 0: 1
1: 0
2: 3
3: 16
4: 187
1176185448_1176185454 -4 Left 1176185448 20:63775881-63775903 CCCTCCTCCACCTGTGCATAGAG 0: 1
1: 0
2: 1
3: 19
4: 206
Right 1176185454 20:63775900-63775922 AGAGCTCGGCCCTCTCTCCTCGG 0: 1
1: 0
2: 2
3: 16
4: 170
1176185448_1176185460 18 Left 1176185448 20:63775881-63775903 CCCTCCTCCACCTGTGCATAGAG 0: 1
1: 0
2: 1
3: 19
4: 206
Right 1176185460 20:63775922-63775944 GCTGTCGGAGCTGCTGGCTTCGG 0: 1
1: 0
2: 3
3: 22
4: 201
1176185448_1176185458 12 Left 1176185448 20:63775881-63775903 CCCTCCTCCACCTGTGCATAGAG 0: 1
1: 0
2: 1
3: 19
4: 206
Right 1176185458 20:63775916-63775938 TCCTCGGCTGTCGGAGCTGCTGG 0: 1
1: 0
2: 0
3: 9
4: 127
1176185448_1176185461 24 Left 1176185448 20:63775881-63775903 CCCTCCTCCACCTGTGCATAGAG 0: 1
1: 0
2: 1
3: 19
4: 206
Right 1176185461 20:63775928-63775950 GGAGCTGCTGGCTTCGGTGACGG 0: 1
1: 0
2: 1
3: 27
4: 242
1176185448_1176185462 29 Left 1176185448 20:63775881-63775903 CCCTCCTCCACCTGTGCATAGAG 0: 1
1: 0
2: 1
3: 19
4: 206
Right 1176185462 20:63775933-63775955 TGCTGGCTTCGGTGACGGACAGG 0: 1
1: 0
2: 1
3: 3
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176185448 Original CRISPR CTCTATGCACAGGTGGAGGA GGG (reversed) Exonic
904571732 1:31471117-31471139 CTCTGTGCACAGACCGAGGAAGG - Intergenic
905694904 1:39967074-39967096 CTCCATGCCCAGCTGGTGGAGGG + Exonic
906613578 1:47219967-47219989 CTCAATGACCAGGAGGAGGAGGG - Exonic
907046006 1:51300369-51300391 CTCCATGCAGAGGAGGGGGAGGG + Intronic
909335861 1:74473013-74473035 CTATAGGCACATGTGGAAGAAGG + Intronic
914910750 1:151784142-151784164 ATTTAGGCACAGGTGGAGGAAGG - Intronic
915866021 1:159500355-159500377 CTCTATGCACCCATGCAGGATGG - Intergenic
917854926 1:179092172-179092194 CTCTACGCAATGGTGGAGGCAGG + Intronic
920223890 1:204424236-204424258 CTCTAAGGACAGGTTGGGGAGGG - Exonic
920267728 1:204736877-204736899 CTCTAGGCACAGGAAGAGGCAGG + Intergenic
920563835 1:206958410-206958432 CTCTTCCCACAGGTGGAGGAAGG + Exonic
920681692 1:208077864-208077886 CTCTCTGCACAGATGAATGAGGG + Intronic
920987880 1:210907610-210907632 GGCTGAGCACAGGTGGAGGAGGG + Intronic
1063447697 10:6130027-6130049 CTGTGTGCAGAGGAGGAGGAGGG - Intergenic
1070597806 10:77844952-77844974 CCCAATGCACAGGGGGAGGTGGG + Intronic
1071513742 10:86283284-86283306 CTATTTGCACAGGTTGGGGAGGG + Intronic
1074473085 10:113744814-113744836 CTGTCTGCAGAGGTGGAGGCAGG - Intergenic
1075698644 10:124453971-124453993 CTCTATGCACAGAGGGAAGGTGG - Intergenic
1076826231 10:132971023-132971045 CTCCATGCTCAGGAGGAGGGAGG + Intergenic
1077024313 11:432545-432567 CTGTAGGCACAGGGGGAGGCTGG - Intronic
1077219258 11:1408172-1408194 CTCTAGGAACAGGCGGAGGGAGG - Intronic
1077287250 11:1773083-1773105 GTCCAGGCACAGGTGGGGGAGGG + Intergenic
1078480318 11:11669638-11669660 CTCTATGCACAGGCTCAGCATGG + Intergenic
1081386177 11:42476231-42476253 CTCTACCCACAGTGGGAGGAGGG - Intergenic
1081477553 11:43449408-43449430 GCCTCTGCACTGGTGGAGGAGGG - Intronic
1081525231 11:43923699-43923721 CTCTATTCACAGGCTGGGGAAGG - Intergenic
1082771427 11:57210796-57210818 CTGTCTGCACCGTTGGAGGATGG - Intergenic
1083336220 11:61923397-61923419 CTCTATGCAGAGGCAGGGGAAGG - Intergenic
1083610763 11:64003116-64003138 TTCTGGCCACAGGTGGAGGAAGG - Intronic
1085760154 11:79234607-79234629 CACTCTGCAGAGGTGGAAGAAGG - Intronic
1089397174 11:118144053-118144075 CTCTATGAGCTGGTGGAGGAAGG + Exonic
1090661649 11:128886514-128886536 CTCTTTGAGCAGGTGGAGGGTGG + Intergenic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1092119457 12:6033869-6033891 CTCCATTCCCAGGAGGAGGAGGG - Intronic
1094328864 12:29270739-29270761 CTACCTGCACAGGTAGAGGAAGG + Intronic
1098197058 12:68013277-68013299 CTCAATGCATTGGTGGAGGTTGG + Intergenic
1100547802 12:95619968-95619990 TTCTATGCACTGGTGGGGAAGGG + Intergenic
1102540577 12:113616380-113616402 CTCTGTGTAAAGGTGGAGCAGGG + Intergenic
1103859434 12:124000359-124000381 CTCTATGAACAGGCGAAGGTAGG - Intronic
1106123349 13:26880307-26880329 CTCTGAGCTCAGGTGGAGGCAGG - Intergenic
1107464514 13:40637047-40637069 CTTCATTCACAAGTGGAGGAAGG + Intronic
1108495932 13:51025476-51025498 CTCTGTGCAAGGGTGGAGGCGGG - Intergenic
1108840728 13:54611319-54611341 CACTATGCAAATGTGGAGGAAGG + Intergenic
1112431301 13:99352736-99352758 CTCTAAGCTCAGGGAGAGGAGGG - Intronic
1113219211 13:108079551-108079573 CTCTAAGCAGTGGTGGAGCAGGG - Intergenic
1113512261 13:110865606-110865628 CTCTTAGCACAGGTCTAGGAGGG - Intergenic
1113824792 13:113243341-113243363 CTGCATGCATGGGTGGAGGAGGG + Intronic
1113984555 13:114303452-114303474 CTGTATACACAGATGGAGCATGG - Intronic
1114216826 14:20663516-20663538 AGAGATGCACAGGTGGAGGAAGG - Intergenic
1117226058 14:53660331-53660353 GTCTATGCAAATGTGGGGGAAGG - Intergenic
1119613106 14:76080355-76080377 CTTTGTGCACATTTGGAGGAGGG + Intronic
1121504323 14:94464845-94464867 CTCTATCCACCTGTGGAGTAGGG + Exonic
1121679085 14:95777553-95777575 CTCCAGGCCCAGGGGGAGGAAGG - Intergenic
1122768026 14:104085130-104085152 CTCTGTGCTCAGGTCGTGGAGGG + Intergenic
1123000873 14:105293454-105293476 CTCCTTGCACAGGACGAGGAGGG + Intronic
1124507537 15:30291399-30291421 GTCTAAGCACAGGTGGTGGTGGG + Intergenic
1124736018 15:32247259-32247281 GTCTAAGCACAGGTGGTGGTGGG - Intergenic
1125686856 15:41568647-41568669 CGGAATGCACAGGTGGGGGATGG - Intronic
1128458521 15:67847941-67847963 CTGTATCCACATGTGGAGGTAGG + Intergenic
1131335338 15:91543704-91543726 CTCTGCGCACAGGTGGTGAATGG + Intergenic
1134811463 16:17170542-17170564 CTCTAGGCAAAGGTGTAGGAAGG - Intronic
1134901619 16:17943281-17943303 CTCTCCGCAGAGGAGGAGGAGGG - Intergenic
1135664801 16:24326725-24326747 CTCTCTGCACAGGCTGAAGAGGG + Intronic
1136547996 16:30966075-30966097 CTATATGCACAGGGGCAGGAGGG + Exonic
1138267921 16:55673352-55673374 CTCTCTACACAGGAGGAGGCTGG - Intronic
1139125643 16:64073058-64073080 CTCTAAACAAAGGTGGAGAAAGG - Intergenic
1139403034 16:66696932-66696954 CTCTAGGCGCAGGTGGGGGCGGG - Intergenic
1140258046 16:73353633-73353655 CTCTCTGCAGAGGGGCAGGATGG - Intergenic
1140720681 16:77768972-77768994 CTCTATGCAAATGTGCAGGCTGG + Intergenic
1141400350 16:83741954-83741976 TTCCATGAACAGGTGGGGGATGG - Intronic
1141874470 16:86813138-86813160 ATCTATGAACAGTTGAAGGAAGG + Intergenic
1142889347 17:2932941-2932963 CTCCAGGCACAGGTCGAGGCTGG + Intronic
1143254850 17:5548390-5548412 CTCTATCCTCAGAGGGAGGAGGG - Intronic
1143284912 17:5781744-5781766 CTGCAGGTACAGGTGGAGGATGG + Intronic
1147182635 17:38696195-38696217 CTGTGTGCCCTGGTGGAGGAGGG - Intergenic
1147331757 17:39703396-39703418 CTCTCTTCCCAGGGGGAGGATGG - Intronic
1147607840 17:41784542-41784564 CTCTGTGCCAAGGTGGAGGAGGG - Intronic
1148740374 17:49889549-49889571 CTCTCGGCACGGGTGGGGGATGG + Intergenic
1150853179 17:68725255-68725277 CCCTTTGCACTGGTGGAGAATGG + Intergenic
1151430872 17:74061857-74061879 CTCTGTGCCCAGGTGGAGGCTGG + Intergenic
1151750186 17:76032746-76032768 CTCTAGGCCCAGCTGGAGGAGGG - Intergenic
1152742385 17:82023992-82024014 CTCTACTCCCAGGTGCAGGAAGG - Intronic
1153501688 18:5756205-5756227 TTCTAGGCACAGGAGAAGGAGGG - Intergenic
1156744194 18:40369466-40369488 CTCTATTCACAGGAGGAAAAAGG + Intergenic
1159160148 18:64633323-64633345 CACTAGGCACATGTGGAAGATGG - Intergenic
1162081852 19:8222831-8222853 CTCACAGCACAGGTGGAAGACGG + Intronic
1162315905 19:9937699-9937721 ATGTAGGCAGAGGTGGAGGAGGG + Intergenic
1162500788 19:11052473-11052495 CAGTATGGCCAGGTGGAGGAAGG - Intronic
1163091138 19:15021266-15021288 CTCTATTCTCAGGTGGTGGTGGG - Intronic
1165360055 19:35330798-35330820 CTCTATGCAGAGGTCAGGGATGG + Intronic
926663982 2:15499604-15499626 GTCTATGAGCAGGTGGAGGGTGG + Intronic
927827266 2:26317469-26317491 GTGTATGGACAGGAGGAGGAGGG - Intronic
930869476 2:56155409-56155431 CTCTGTGCCCACGTGGAGGCTGG + Intergenic
933264554 2:80168391-80168413 TTCTATGGGCAGGTGGGGGATGG - Intronic
935673685 2:105576288-105576310 CTCTGTGAGCAGGGGGAGGAGGG + Intergenic
937639660 2:124197225-124197247 CGATCTGCAAAGGTGGAGGAAGG - Intronic
938750127 2:134320486-134320508 CTTTATGGACTGGGGGAGGAAGG + Intronic
939422417 2:141990593-141990615 GTCTATGCACAGGTAGAGCTAGG + Intronic
941857233 2:170243387-170243409 TTCTAAGCACAGATAGAGGAAGG + Intronic
942463538 2:176186385-176186407 ATCTAGCCAGAGGTGGAGGAGGG + Intergenic
944012630 2:194992188-194992210 CTCTCTGGGCAGGTGGGGGAGGG + Intergenic
945690793 2:213032770-213032792 ATCTTTCCACTGGTGGAGGAGGG + Intronic
946768001 2:223057913-223057935 CTCTATTCACAGGTATGGGAGGG + Intronic
946768290 2:223060618-223060640 CTCTCTGCACTGGGGGAGGAGGG - Intronic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1170897819 20:20431910-20431932 CTCTATGCAAAGTTGAAGTAGGG + Intronic
1172948172 20:38704323-38704345 CCCTATGCAGAGGGGCAGGATGG + Intergenic
1173047836 20:39529482-39529504 CTCTAGGGACAAGTGCAGGAGGG + Intergenic
1173279671 20:41617815-41617837 CTGTTTGCAGGGGTGGAGGAGGG - Intronic
1174132701 20:48357326-48357348 CTCCTCCCACAGGTGGAGGAGGG - Intergenic
1175515668 20:59568384-59568406 CTCTGTGCCCAGGTGGAGGAGGG + Intergenic
1176185448 20:63775881-63775903 CTCTATGCACAGGTGGAGGAGGG - Exonic
1179109865 21:38437321-38437343 CTCTTTGGACAGGTGGGGGTGGG + Intronic
1180162644 21:46005247-46005269 CTCTGTCCACAGGTGCAGCATGG - Intergenic
1181333581 22:22113414-22113436 TTCTCTGCACAGGTGAAAGAAGG + Intergenic
1182716226 22:32357916-32357938 CTCTGAGCTGAGGTGGAGGAAGG - Exonic
1182716457 22:32359691-32359713 CTCTAAGGCCAGGTGGAGGAGGG - Intronic
1183377289 22:37472590-37472612 ATCCTGGCACAGGTGGAGGAGGG + Intronic
1184069298 22:42138234-42138256 CTCTCTGGACTGGTGGAGGCTGG + Intergenic
1184108547 22:42382505-42382527 CACTATGAATGGGTGGAGGAGGG - Exonic
949940457 3:9150466-9150488 TTCCATGCACAGATGGAGAAAGG + Intronic
950102573 3:10367045-10367067 CCCCAGGCACGGGTGGAGGAGGG - Intronic
951702662 3:25511791-25511813 CTCTGTGCACAACTTGAGGATGG + Intronic
953827907 3:46270207-46270229 CTGGATGCATAGGTAGAGGAGGG - Intergenic
954034089 3:47841173-47841195 CTCAAGGTACAGATGGAGGATGG + Exonic
954413924 3:50383700-50383722 TTCTATGCCCAGGAGAAGGAGGG + Intronic
954437185 3:50502631-50502653 CTCTCTCCTCAGGTGGAGGGGGG + Intronic
954801702 3:53190736-53190758 CTGTGTGCCCTGGTGGAGGAGGG - Intronic
955119472 3:56042130-56042152 CTATATGTGCAGGTGCAGGAAGG - Intronic
957359914 3:79141616-79141638 CTCTATGGAGAAGTGGGGGAGGG - Intronic
958145599 3:89620583-89620605 CTGTATTCACAGGTGTAGCAAGG - Intergenic
959575922 3:107933630-107933652 ATCAAAGCAGAGGTGGAGGAAGG - Intergenic
960246737 3:115408015-115408037 CTATATGCATTGGTGGAGAAAGG + Intergenic
960810266 3:121621560-121621582 CTCTTTGCACATGTGGAAGGTGG - Exonic
960903031 3:122571025-122571047 CTCTGTGGACTGGTGGGGGAAGG - Intronic
961562400 3:127739832-127739854 CTGCATGCACACTTGGAGGATGG - Intronic
961934154 3:130565414-130565436 CTCTATGCCCAGGGTGAAGATGG - Exonic
963351177 3:144153088-144153110 CTCTATGGAGATGTGGAAGATGG + Intergenic
967887508 3:194343081-194343103 CTCTTTGCACAGTTGGTGGAGGG + Intronic
968399928 4:285237-285259 GTCAGTGCACAGGTGGAGAAAGG + Intronic
969182449 4:5452457-5452479 CTCCATTCAAAGGAGGAGGAAGG + Intronic
969409603 4:7019495-7019517 CTTTATGGGCATGTGGAGGAGGG + Intronic
969435536 4:7187072-7187094 GTGTATCCACATGTGGAGGAAGG - Intergenic
971220877 4:24705002-24705024 CTCTCTTCACAGCTGGAAGATGG + Intergenic
972254022 4:37334377-37334399 CTCCAAGCACAGGCTGAGGATGG - Intronic
972653790 4:41046816-41046838 CTCTATTCACAGGGGTGGGAAGG + Intronic
972733004 4:41813694-41813716 CTCCATCCTCATGTGGAGGAAGG + Intergenic
974583415 4:63836867-63836889 CCCTATGGTCAGGTGGTGGATGG + Intergenic
975374189 4:73623795-73623817 CGCTAGCCACAGGTGGAGAATGG - Intergenic
976058039 4:81092388-81092410 CTCTTTGCAAAGGTGATGGAAGG + Exonic
977432744 4:96952792-96952814 TTCTGTACACAGGTGGAGGTGGG + Intergenic
978313698 4:107413792-107413814 CTCTGTGCACAGATCAAGGAAGG + Intergenic
981002440 4:139840659-139840681 CCTTATGAACAGGTGGAGGTGGG + Intronic
981072094 4:140553365-140553387 CTCTATGAACAGGTGTGGGGAGG + Exonic
981268083 4:142811172-142811194 ATATATGCACAGGTGGAGGTAGG - Intronic
981330134 4:143498747-143498769 GTCTATCCTCAGGTGAAGGAAGG + Intergenic
983097827 4:163585824-163585846 CTTTATCCACTGGTGGAGGCAGG + Exonic
983647133 4:170003420-170003442 CTCAATACACAGATGAAGGAGGG + Intronic
985299685 4:188474992-188475014 CACTAAGCACAAGAGGAGGAAGG - Intergenic
985763740 5:1765478-1765500 CCCACTGCACAGGTGGGGGATGG + Intergenic
985819869 5:2152331-2152353 CTCATTGCACAGATGGAAGATGG + Intergenic
985819872 5:2152366-2152388 CTCATTGCACAGATGGAAGATGG + Intergenic
985819875 5:2152401-2152423 CTCATTGCACAGATGGAAGATGG + Intergenic
985819878 5:2152436-2152458 CTCACTGCACAGATGGAAGATGG + Intergenic
985819881 5:2152471-2152493 CTCACTGCACAGATGGAAGATGG + Intergenic
985819884 5:2152506-2152528 CTCACTGCACAGATGGAAGATGG + Intergenic
985819887 5:2152541-2152563 CTCACTGCACAGATGGAAGATGG + Intergenic
985819890 5:2152576-2152598 CTCACTGCACAGATGGAAGATGG + Intergenic
985999807 5:3621378-3621400 CTCTAGGCACAGGAGGAGTGGGG + Intergenic
987417144 5:17674247-17674269 CTCTGTCCTCATGTGGAGGAAGG + Intergenic
992085316 5:73273138-73273160 CTGAATCCACAGATGGAGGAGGG - Intergenic
996848931 5:127931492-127931514 CAATATGCACAGCTGGAGGAGGG - Intergenic
996923551 5:128796773-128796795 AACTAGGCACAGGTGGAGAAGGG - Intronic
999809481 5:155114595-155114617 TTCTTTGCACTGGTTGAGGATGG - Intergenic
1000102130 5:158026223-158026245 GTCTGTTCACAGGTAGAGGAAGG + Intergenic
1000251458 5:159499535-159499557 CTGTATGCACACGTGGAAAATGG + Intergenic
1001563725 5:172686424-172686446 CTGTATGCTCAGCTGGAGGGAGG + Intronic
1002889977 6:1324012-1324034 CTCTGTGCCCAGCTGGAGGATGG + Intergenic
1003513676 6:6801823-6801845 CTCTCACCACAGGTGCAGGAAGG - Intergenic
1007628149 6:43258123-43258145 CTCTATGCTCAGATTGAGGGTGG - Intronic
1008452195 6:51665923-51665945 GTGTAAGCACAGGTGGAGGTGGG + Intronic
1008674196 6:53802190-53802212 GTCTATGCAGAGGTGAAGTATGG + Intronic
1008999749 6:57699862-57699884 CTGTAGGAACAGGTTGAGGAGGG + Intergenic
1010106388 6:72174117-72174139 CTCAAATCACAGATGGAGGAGGG - Intronic
1010121666 6:72382829-72382851 CTCTGTGTAGAGGTAGAGGACGG - Intronic
1010472260 6:76242504-76242526 ATCTAGGGTCAGGTGGAGGAGGG + Intergenic
1012269578 6:97192127-97192149 GTCTGTGCATATGTGGAGGAGGG + Intronic
1013796915 6:113898550-113898572 CTCTCTTCAGAGTTGGAGGATGG + Intergenic
1013947499 6:115738461-115738483 CTCTATTCACTAGTGGAGCATGG + Intergenic
1013998304 6:116335366-116335388 GTCTATGCAAGGGTGGAGGGTGG + Intronic
1015543799 6:134342302-134342324 CTCTCTGCACAGCTTGAGGTTGG - Intergenic
1016012956 6:139157814-139157836 GGCGAGGCACAGGTGGAGGAGGG + Intronic
1024237815 7:47411334-47411356 TTCCATGGACTGGTGGAGGATGG + Intronic
1025956746 7:66189034-66189056 CTAGATGGACAGGTAGAGGATGG - Intergenic
1027508544 7:79050191-79050213 CTCCATGCACACGTGGGGGCTGG + Intronic
1028844975 7:95470087-95470109 CTCTATGCACAGTATCAGGATGG - Intergenic
1029318823 7:99739032-99739054 CTCTAGGCACTGGAGGAGGTAGG + Intergenic
1032980295 7:137274206-137274228 CTCTAGGCACAGCTGGGGTAAGG - Intronic
1034525114 7:151654442-151654464 CTATATGGACAGTGGGAGGAAGG - Intronic
1034954707 7:155327375-155327397 CTTTCTGTCCAGGTGGAGGAGGG - Intergenic
1034970985 7:155418959-155418981 CTCTGTGAGGAGGTGGAGGAAGG + Intergenic
1035986950 8:4444700-4444722 CTCTAAGCACAGGTGCATGAAGG + Intronic
1036784004 8:11673337-11673359 TTGTAGGCACATGTGGAGGAGGG + Intergenic
1037403697 8:18519494-18519516 CTTTATGGAAAGGTGGGGGAAGG + Intergenic
1037706030 8:21315950-21315972 ATCTATGCACAGATTGAGGTTGG - Intergenic
1037980546 8:23250286-23250308 CTCTGAGCACAGGAGGAGGTGGG - Intronic
1038620138 8:29134861-29134883 CTCTATGCAGATTTGGGGGAAGG + Intronic
1039819352 8:41122441-41122463 CTCTATCCAAAGGTGGAACAAGG - Intergenic
1040692241 8:49953253-49953275 ATCTATGGACAAGAGGAGGAGGG - Intronic
1041116164 8:54539627-54539649 CTCTATTAACAGATGGAGGAAGG - Intergenic
1042088416 8:65132777-65132799 CTCTGTGCACAGATCAAGGAAGG - Intergenic
1048266513 8:132992005-132992027 TTCTCTCCACAGGTGCAGGAGGG + Intronic
1048541249 8:135344129-135344151 CTCTGTCCACTGGTAGAGGAGGG - Intergenic
1049030668 8:140035042-140035064 CTGTATACACAGCTGGAGGAGGG + Intronic
1058130759 9:101250323-101250345 CTCTTTGAAAAGGAGGAGGATGG - Intronic
1060797894 9:126524885-126524907 CTCTATGCCCAGGAGCATGAAGG + Intergenic
1061893017 9:133632706-133632728 CCCTATGCTCAGGACGAGGAGGG + Intergenic
1061927299 9:133812213-133812235 CTCGCTGCACAGGAGGAGGCGGG + Exonic
1062076693 9:134593580-134593602 CTCCAGGCGCAGGTGGAGGATGG - Intergenic
1186195666 X:7108476-7108498 GTCAGTGCACAGGGGGAGGAAGG - Intronic
1187483494 X:19679938-19679960 ATCTATTCACAGTTGGTGGAGGG + Intronic
1192175990 X:68885858-68885880 CTCCAGGCAAAGGTGGTGGAAGG + Intergenic
1194057277 X:89151320-89151342 CTCTGTGCCCAGGTGGTGTATGG + Intergenic
1195596272 X:106693781-106693803 CTGTGTGTACAGCTGGAGGAGGG + Intronic
1199862678 X:151816005-151816027 CTCTATGTAGAGGTGGCGGTGGG + Intergenic
1200065609 X:153502923-153502945 CTCTGTCCACAGGTGTGGGAGGG + Intronic
1200629889 Y:5570182-5570204 TTATATGCACAGGAAGAGGAGGG - Intronic