ID: 1176186408

View in Genome Browser
Species Human (GRCh38)
Location 20:63782339-63782361
Sequence GAGGGTGACAGAAGCGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 719
Summary {0: 1, 1: 0, 2: 6, 3: 52, 4: 660}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176186394_1176186408 22 Left 1176186394 20:63782294-63782316 CCCTAAACGGACCCACCAGGGCC 0: 1
1: 0
2: 0
3: 6
4: 57
Right 1176186408 20:63782339-63782361 GAGGGTGACAGAAGCGAGGATGG 0: 1
1: 0
2: 6
3: 52
4: 660
1176186398_1176186408 7 Left 1176186398 20:63782309-63782331 CCAGGGCCCCGTCAGCAGAGAAG 0: 1
1: 0
2: 1
3: 18
4: 172
Right 1176186408 20:63782339-63782361 GAGGGTGACAGAAGCGAGGATGG 0: 1
1: 0
2: 6
3: 52
4: 660
1176186395_1176186408 21 Left 1176186395 20:63782295-63782317 CCTAAACGGACCCACCAGGGCCC 0: 1
1: 0
2: 1
3: 6
4: 92
Right 1176186408 20:63782339-63782361 GAGGGTGACAGAAGCGAGGATGG 0: 1
1: 0
2: 6
3: 52
4: 660
1176186397_1176186408 10 Left 1176186397 20:63782306-63782328 CCACCAGGGCCCCGTCAGCAGAG 0: 1
1: 0
2: 1
3: 15
4: 203
Right 1176186408 20:63782339-63782361 GAGGGTGACAGAAGCGAGGATGG 0: 1
1: 0
2: 6
3: 52
4: 660
1176186396_1176186408 11 Left 1176186396 20:63782305-63782327 CCCACCAGGGCCCCGTCAGCAGA 0: 1
1: 1
2: 2
3: 10
4: 145
Right 1176186408 20:63782339-63782361 GAGGGTGACAGAAGCGAGGATGG 0: 1
1: 0
2: 6
3: 52
4: 660
1176186403_1176186408 -1 Left 1176186403 20:63782317-63782339 CCGTCAGCAGAGAAGGAGGCAGG 0: 1
1: 0
2: 2
3: 46
4: 492
Right 1176186408 20:63782339-63782361 GAGGGTGACAGAAGCGAGGATGG 0: 1
1: 0
2: 6
3: 52
4: 660
1176186401_1176186408 1 Left 1176186401 20:63782315-63782337 CCCCGTCAGCAGAGAAGGAGGCA No data
Right 1176186408 20:63782339-63782361 GAGGGTGACAGAAGCGAGGATGG 0: 1
1: 0
2: 6
3: 52
4: 660
1176186402_1176186408 0 Left 1176186402 20:63782316-63782338 CCCGTCAGCAGAGAAGGAGGCAG No data
Right 1176186408 20:63782339-63782361 GAGGGTGACAGAAGCGAGGATGG 0: 1
1: 0
2: 6
3: 52
4: 660

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176186408 Original CRISPR GAGGGTGACAGAAGCGAGGA TGG Intronic
900230683 1:1555527-1555549 GAGTGTGCCACAAGCGTGGACGG + Intronic
900503211 1:3016654-3016676 GAGGGAGAAAGGAGAGAGGAAGG + Intergenic
900544379 1:3220387-3220409 GAAGGTGGCAGACGCGGGGAGGG - Intronic
900557990 1:3289649-3289671 GCTGCTGGCAGAAGCGAGGATGG + Intronic
901001409 1:6150689-6150711 GGGGGTGACTGAAGGGAGGATGG + Intronic
902393406 1:16119150-16119172 GAGGGTGCCAGGAGTGGGGAGGG + Intergenic
903132973 1:21291061-21291083 GGGGGAGTCAGAAGCCAGGAAGG + Intronic
903225839 1:21893917-21893939 GAGGGCGACAGAAGCAGAGATGG + Intronic
903469429 1:23575566-23575588 GAGGGTGTCACAAGAGTGGAGGG - Intergenic
903503744 1:23817878-23817900 TTGGGAGACAGAAGCGAGGAGGG - Intronic
904393014 1:30198099-30198121 GAGAGAGACAGAGGGGAGGAGGG + Intergenic
904546679 1:31279771-31279793 GAGGTTGAAAGAAGTGACGAAGG + Intronic
905690147 1:39936972-39936994 GAGGGTCACAGAAGGGAGAGTGG - Intergenic
905691253 1:39944662-39944684 GGGGGAGATAAAAGCGAGGAGGG - Intergenic
905920718 1:41716861-41716883 GAGAGTGACAGAGAGGAGGAAGG - Intronic
907476992 1:54712504-54712526 GTGGTTGACAGAATGGAGGAGGG + Intronic
907652366 1:56307558-56307580 GAGGGAGAGAGAAGGGAGAATGG - Intergenic
908090152 1:60677321-60677343 GAGGGACACAGGAGTGAGGATGG + Intergenic
909230204 1:73079432-73079454 GAGGGTGATAGAAGTCAAGATGG + Intergenic
909289516 1:73864610-73864632 GAGGGTGACAGGAGGGTGGAGGG + Intergenic
909352098 1:74665859-74665881 GAGGCAGACAGAAGGGAGGGTGG + Intronic
909352655 1:74673281-74673303 GTGGGTGAAAGAAACGAAGAAGG + Intronic
909695131 1:78459636-78459658 GAGGGTGAAAGGTGGGAGGAGGG - Intronic
909737756 1:78986021-78986043 GGGGGTGGAAGAAGGGAGGAGGG + Intronic
910786982 1:91010005-91010027 GAGGGAGATTGAAGTGAGGAAGG - Intronic
911379722 1:97097604-97097626 GAGGGTGACAGAAAAAAAGAAGG + Intronic
911390067 1:97230483-97230505 GAGGGTGAAGGATGGGAGGAGGG + Intronic
911582152 1:99646216-99646238 GGGGGTGACAGAAGAGAAGCAGG - Exonic
911838833 1:102656051-102656073 GATGGGGACAGAAGAAAGGATGG + Intergenic
911980811 1:104563145-104563167 GAGGGTGAAGGATGGGAGGAGGG + Intergenic
912109674 1:106325783-106325805 GAGGGAGAGAGAGGAGAGGAAGG - Intergenic
912490199 1:110058501-110058523 GAGGCTGGCAGAGGCCAGGAGGG - Intronic
913219028 1:116644636-116644658 CAAGGTGACAGCAGAGAGGATGG + Intronic
913674538 1:121128739-121128761 GAAGCTGAAAGAAGCAAGGAAGG + Intergenic
914026321 1:143916048-143916070 GAAGCTGAAAGAAGCAAGGAAGG + Intergenic
914352229 1:146850331-146850353 GAGAGTGAAAGAAGTGAGAATGG + Intergenic
914403103 1:147342366-147342388 CAGTGTGACAGAAGCTAGCATGG + Intergenic
914664758 1:149823801-149823823 GAAGCTGAAAGAAGCAAGGAAGG + Intergenic
914671007 1:149870017-149870039 GAAGCTGAAAGAAGCAAGGAAGG - Intronic
914739215 1:150449575-150449597 GAGGGAGAAAGAAGGAAGGAGGG - Intronic
914912824 1:151801058-151801080 GAGGGTCACTGAGGTGAGGAAGG + Exonic
914924663 1:151873812-151873834 GAGGCTCCCAGAAGCCAGGAGGG + Exonic
914960158 1:152197889-152197911 GAGGGAGAAAGAAAAGAGGAAGG - Intergenic
915166146 1:153948784-153948806 CAGAGCGACAGAAGCGAGCACGG + Intronic
915431413 1:155869720-155869742 GAGGGAGAGAGAAGGCAGGATGG - Intronic
915525505 1:156473665-156473687 GTGGGTGACACAGGCCAGGATGG + Intronic
915554951 1:156656255-156656277 GAGGGGGAAAGAAGTGAGGCGGG - Intronic
915713412 1:157922506-157922528 GAAGGTGACAGGAGCTATGAGGG - Intergenic
916667079 1:166975890-166975912 GAGAGTGACAGCGGCGAGGGTGG + Intronic
918029707 1:180793865-180793887 GAGAGAGACAGAAGGAAGGAAGG - Intronic
918087524 1:181258161-181258183 GAGGGAGAAAGAAGAGAGAAAGG + Intergenic
918175793 1:182043931-182043953 GAGGATGAAACAAGCAAGGAAGG - Intergenic
918302571 1:183217264-183217286 GTGGGTGACAGAAGCAGGGATGG + Intronic
918476835 1:184934318-184934340 GAGGGAGAAGGAAGGGAGGAGGG + Intronic
919142256 1:193587279-193587301 GAGGGTGAAAGGTGCGAGGAGGG + Intergenic
919689428 1:200515777-200515799 GAAGGGGAAAGAAGGGAGGAAGG + Intergenic
920238265 1:204524069-204524091 GCAGGTGATAGAAGCTAGGAGGG + Intronic
920662763 1:207931562-207931584 GAGGGAGAGAGAAGGGAGAATGG + Intergenic
921162513 1:212483260-212483282 GAGGGTCACAGGAGCGAGGAAGG - Intergenic
922059250 1:222072017-222072039 GAGGGTGAGAGAAGCCTGGCTGG - Intergenic
923220085 1:231884936-231884958 GGGGGAGAGAGAAGAGAGGAGGG - Intronic
923286333 1:232499499-232499521 AAGGCTGACAGAGGTGAGGAAGG + Intronic
923342807 1:233022043-233022065 GAGTGGGAGAGAAGGGAGGAGGG - Intronic
923524026 1:234758626-234758648 GAGGGTGACTGCATCCAGGAAGG + Intergenic
924116532 1:240753185-240753207 GAGAGAGACAGAAGGGAGGGAGG - Intergenic
924712483 1:246541362-246541384 GAGGGTGAAGGATGGGAGGAGGG + Intronic
1063689204 10:8268245-8268267 GAGACTGTCAGGAGCGAGGAGGG - Intergenic
1063812800 10:9733124-9733146 GTGGGGGAGAGAAGAGAGGATGG + Intergenic
1064266513 10:13829820-13829842 GCAGGTGACAGAAGCAAAGATGG - Intronic
1064649992 10:17499377-17499399 GAGGGTGGCAGGTGGGAGGAGGG + Intergenic
1065996789 10:31066876-31066898 AAGAGTGACAGAAGAAAGGAAGG + Intergenic
1067551409 10:47238870-47238892 GAGGGTGTCACCTGCGAGGATGG + Intergenic
1068067611 10:52151227-52151249 GAGGGTGAAAGGTGAGAGGAGGG - Intronic
1068631655 10:59304598-59304620 GAGGGTGGCAGGTGGGAGGAGGG + Intronic
1068940005 10:62671296-62671318 GAGGGTGAGAGAGGGGAGGGAGG + Exonic
1069150799 10:64956680-64956702 GAGGGTGGCAGGTGGGAGGAGGG + Intergenic
1069849795 10:71397345-71397367 GAAGGAGAGGGAAGCGAGGAGGG - Intronic
1070167463 10:73909625-73909647 GAGAGTGACAGAAGGAAGGCAGG - Intronic
1070549920 10:77482961-77482983 GAGAGAGAGAGAAGAGAGGAAGG - Intronic
1070752941 10:78974480-78974502 GAGGGTAGCAAAAGAGAGGAGGG - Intergenic
1071718435 10:88119983-88120005 GAAGGGGACAGGAGCGAGGAAGG + Intergenic
1071955621 10:90756155-90756177 GCTGGTGACAGAAGCCAGAATGG + Intronic
1072269029 10:93757315-93757337 GAGGGTGGGAGAAGAGAGGGAGG + Intergenic
1072392921 10:95007219-95007241 AAGGGAAACAGAAACGAGGAGGG + Intergenic
1073433154 10:103499916-103499938 TATGGTGACTGAAGCGGGGAAGG - Intronic
1073985314 10:109201680-109201702 GAGGGTGAAGGATGGGAGGAAGG + Intergenic
1075091989 10:119448975-119448997 CAGGGAGTCAGAAGCCAGGAAGG + Intronic
1075239956 10:120769312-120769334 GGGGGTGAGAGCAGCAAGGAAGG + Intergenic
1076304864 10:129458837-129458859 GAGGGAGAGAGGAGGGAGGAGGG - Intergenic
1076762231 10:132611497-132611519 GAGGGTGACGGAGGTGAGGTGGG + Intronic
1076781328 10:132726381-132726403 GAGGGAGACAGACGGGAGGAGGG - Intronic
1077181030 11:1216650-1216672 GAGAGAGACAGAAGGAAGGAAGG - Intergenic
1077307161 11:1873575-1873597 GAGGGAGGAAGAAGGGAGGATGG + Intronic
1077918850 11:6628544-6628566 GAGGCTGACAGCAGCCAAGAAGG + Intronic
1078550401 11:12276187-12276209 GATGGGGACAGAAGCGGGGTTGG + Intronic
1079117476 11:17649496-17649518 CGGGATGACAGAAGCGAGGTTGG + Intergenic
1079459006 11:20663492-20663514 GAGGCTGGAAGAGGCGAGGAAGG - Intergenic
1079789465 11:24717742-24717764 GAGGGTGAAGGGAGGGAGGAGGG - Intronic
1079816209 11:25062126-25062148 GAGGGAGACAGGAGAAAGGAAGG + Intronic
1079964382 11:26963149-26963171 GAGGGAGAAAAAAGAGAGGAAGG + Intergenic
1080114569 11:28607226-28607248 GAGGGGGAGAGGAGGGAGGATGG - Intergenic
1080413825 11:32051300-32051322 GAGGGAGAAGGAAGCAAGGAAGG + Intronic
1081115008 11:39190234-39190256 GAGGGTCAAAGAAGAGAGGTGGG - Intergenic
1081594354 11:44448916-44448938 GAGAGTGACAGAGGCTGGGAGGG + Intergenic
1081653745 11:44842956-44842978 GAAGGTGATAGAAGCCAGAATGG - Intronic
1082013534 11:47467307-47467329 GATGGTGCCACAAGAGAGGAGGG + Intronic
1082258440 11:50058450-50058472 GGGGGAGACAAAAGAGAGGATGG - Intergenic
1083201073 11:61121438-61121460 GAGGGTGCCAGAAGGAGGGAAGG + Intronic
1083266121 11:61547648-61547670 GAGGGGGACAGAGGGGAGAAGGG + Intronic
1083328812 11:61887365-61887387 AAGGGTAAGAGAAGGGAGGATGG - Intronic
1083683955 11:64365141-64365163 GAGGGAGAGAGAAGCCAGGGAGG + Intronic
1083712782 11:64559330-64559352 GAGGGAGACGGAAGCAGGGATGG - Intronic
1083912868 11:65720319-65720341 GATGGTGACAGAAGAGAAGAAGG - Exonic
1083941119 11:65896504-65896526 GGGGGTGGCAGGAGCAAGGATGG - Intronic
1084208831 11:67611601-67611623 GAGGGAGACAGCAACCAGGAGGG - Intronic
1084374138 11:68764433-68764455 GAGGGTGCCAGAGGCAAGGCTGG + Intronic
1084423955 11:69074266-69074288 GAGGATGCCCGAAGTGAGGATGG - Intronic
1085345069 11:75763396-75763418 GAGGGAGGCAGATGAGAGGAAGG - Intronic
1085521173 11:77139681-77139703 GAGGGAGAAGGAAGGGAGGAAGG - Intronic
1085790527 11:79493695-79493717 GAGGGTGGCCGAAGCCAGGCGGG - Intergenic
1086157529 11:83684021-83684043 AAGGGTGAGAGAAGCCAAGATGG - Intronic
1086799130 11:91149709-91149731 GTGGTTGCCAGAAGCTAGGAAGG - Intergenic
1086955581 11:92931765-92931787 GAGGGAGAAAGATGGGAGGAAGG - Intergenic
1086955662 11:92932479-92932501 GAGGGAGAAAGAAGGGAGGAAGG - Intergenic
1086962432 11:92992454-92992476 GAGGGTGAAGGATGAGAGGAGGG - Intergenic
1087741144 11:101888355-101888377 GAGGGTGAAAGGTGGGAGGAGGG + Intergenic
1088146817 11:106690528-106690550 GAGGGTGAAGGATGGGAGGAGGG + Intronic
1088310742 11:108457680-108457702 GAGGGTGAAAGAAAGTAGGATGG + Intronic
1088707266 11:112475019-112475041 GAGGGTGGCAGAAGGGAGGGAGG - Intergenic
1089176272 11:116551112-116551134 GAGGGTGTGAGATGAGAGGATGG + Intergenic
1089196354 11:116696026-116696048 GAGAGAGAAAGAAGGGAGGAAGG - Intergenic
1090238238 11:125164965-125164987 GAGGGAGGCAGCAGGGAGGAGGG + Intronic
1090260082 11:125313138-125313160 GAAGGTGAAAGAAGGGAGAAAGG + Intronic
1090773022 11:129938511-129938533 CAGGGTGGCAAAAGCGGGGATGG - Intronic
1090925259 11:131244032-131244054 GTTGGTGACAGGAGCAAGGAAGG - Intergenic
1090991689 11:131822956-131822978 GAGGGAGACAGAAGGAAGGAAGG - Intronic
1091070609 11:132559144-132559166 GAGGGAGAGAGAAGCAAGAAGGG + Intronic
1092203756 12:6603354-6603376 GAGGGAGAGAGGAGGGAGGAGGG - Intronic
1092354531 12:7783552-7783574 GAGGGAGAGAGAAGGAAGGAAGG - Intergenic
1092475778 12:8817940-8817962 GGGTGTCACAGAAGCAAGGAGGG - Intergenic
1092791979 12:12078307-12078329 GAGGGAGAAGGAACCGAGGAAGG + Intronic
1093491203 12:19706733-19706755 GAGGGTGAAAAATGGGAGGAGGG + Intronic
1093659232 12:21735406-21735428 GAGGGTGGGAGATGGGAGGAGGG + Intronic
1094020714 12:25911214-25911236 GAGGGTGAAGGATGGGAGGAGGG - Intergenic
1094584790 12:31767924-31767946 GAGGGAGAGAGAAGGAAGGAAGG + Intergenic
1095750269 12:45702679-45702701 GAGGGTGGCAGGTGGGAGGAGGG + Intergenic
1095864466 12:46956565-46956587 GAGGGTAACTGAAGCTAGGTTGG - Intergenic
1095876132 12:47080781-47080803 GAGGGAGAGAGAAGAGGGGAAGG - Intronic
1095887388 12:47203453-47203475 GAGGGTGAGAGTTGGGAGGAGGG - Intronic
1095968139 12:47883091-47883113 CAGGGTGTCAGGAGGGAGGAAGG + Intronic
1095982598 12:47981668-47981690 GAGGGTGACAGTGGTGAGGGAGG + Intronic
1096230104 12:49892035-49892057 ATGGGTGAGAGAACCGAGGAAGG - Intronic
1096336230 12:50758808-50758830 GATGGTGACTGAAGCTATGAGGG - Intergenic
1096584205 12:52608961-52608983 GGGGGTGACAGAAGAGGGGAGGG + Intronic
1096750979 12:53758676-53758698 GAGGGTGACGGAGGCAAAGAAGG - Intergenic
1097640228 12:62172238-62172260 GAGGATGAAGGAAGGGAGGAAGG - Intronic
1097973968 12:65665005-65665027 GGTGGTGACAGAAGCCAGAAAGG - Intergenic
1098682174 12:73369966-73369988 GAGGGAGACAGAAGAAAGGATGG + Intergenic
1099798350 12:87426057-87426079 GCAGGTGATAGAAGCTAGGAGGG - Intergenic
1100250415 12:92815980-92816002 GAGGAAGGCAGAAGGGAGGAGGG + Intronic
1100272895 12:93043473-93043495 GAGGGTGGGGGAAGGGAGGAAGG - Intergenic
1100827594 12:98489531-98489553 GAGGCTGAGAGGTGCGAGGATGG - Intronic
1101284327 12:103294904-103294926 GAGGGTGAAGGATGGGAGGAGGG - Intronic
1101315895 12:103628578-103628600 GAGGATGAAAGAAGCAAGGAAGG - Intronic
1101433513 12:104645879-104645901 GAGGGTGGAAGAAGAGATGATGG - Intronic
1101811792 12:108113615-108113637 GAGGGTGACAGAAGCTGAAAAGG + Intergenic
1101854178 12:108428340-108428362 GAGGTGGAAAGAAGCAAGGAAGG + Intergenic
1101950775 12:109173159-109173181 GAGGGTGAAAGGCGAGAGGAGGG + Intronic
1102602075 12:114039027-114039049 GAGGCTGACAGAAGCAAACAAGG + Intergenic
1102610816 12:114110571-114110593 GAATGTGACAGAAGCATGGAAGG + Intergenic
1103917815 12:124385025-124385047 GAGGGAGAAAGGAGGGAGGAAGG + Intronic
1104302281 12:127575378-127575400 GAAGGTGGGAGAGGCGAGGAAGG - Intergenic
1106141348 13:27014838-27014860 GATGGTCACAGCAGCAAGGAGGG + Intergenic
1106373298 13:29158577-29158599 GAGGGTGACAGAAGCCAAGAAGG - Intronic
1107584911 13:41835081-41835103 GAGGGTGAGAGGAGGGAGGAGGG + Intronic
1108493669 13:51004658-51004680 GAAGGTGACAGAAACAAGAAAGG - Intergenic
1108839786 13:54598224-54598246 GAGGGTGAAAGGTGAGAGGAGGG + Intergenic
1108856611 13:54800333-54800355 GATGGTGACAGAAACTAAGAAGG + Intergenic
1108909260 13:55522523-55522545 GAGGGAGACAGAAGAGGGAATGG + Intergenic
1110330608 13:74267983-74268005 GAAGCTGAAAGAAGCAAGGAAGG + Intergenic
1110972946 13:81789513-81789535 GAGGGAGAAAGAAGTGAGGGAGG - Intergenic
1111186614 13:84745248-84745270 GAGGGAGAGAGAAGGAAGGAAGG + Intergenic
1111399218 13:87710215-87710237 GAGAATGACAGAAGAAAGGAAGG - Intergenic
1111814098 13:93128965-93128987 GAGGGTGAAAGGTGTGAGGAGGG - Intergenic
1111874310 13:93874197-93874219 GAGGGTAGCAGATGGGAGGAGGG - Intronic
1112160672 13:96864161-96864183 GATGGTGATAGAAGTTAGGATGG - Intergenic
1113352649 13:109544548-109544570 GAGGATGAAAGAAGAGAGGGAGG + Intergenic
1114148536 14:20008037-20008059 GAGGGAGACAGAAGGAAGGGAGG + Intergenic
1114471565 14:22966614-22966636 GGGGGTGGAAGAAGGGAGGAAGG + Intronic
1114524392 14:23359205-23359227 AAGGGGGACAGAAGGGAGGCAGG + Intronic
1114798507 14:25743776-25743798 GAGAGAGAGAGAAGGGAGGAAGG - Intergenic
1114811177 14:25901408-25901430 TGGGGGGACAGAAGAGAGGAGGG - Intergenic
1116252937 14:42509987-42510009 GAGGGTGGAAGGAGGGAGGAGGG + Intergenic
1116427192 14:44805725-44805747 GAGGGTGATAGCAGTGAAGATGG + Intergenic
1117081533 14:52157091-52157113 GAGGCTGACAGCAGGGAGGGAGG - Intergenic
1117246348 14:53890371-53890393 GAGGCTAACAGAAGCTAGGGAGG + Intergenic
1118342840 14:64910336-64910358 GAGGTTGACAGATGGGAGAAAGG - Intergenic
1118426459 14:65669028-65669050 GAGGGTGAAAGGTGGGAGGAGGG + Intronic
1118536275 14:66769467-66769489 GAGGGTGGAAGACGGGAGGAGGG - Intronic
1120929858 14:89837327-89837349 GAGTGTGGGAGAAGAGAGGATGG + Intronic
1121430734 14:93885690-93885712 GGGGGTGACAGAAGGGAGGAAGG - Intergenic
1122638259 14:103140669-103140691 GATGGGGACAGAAGTTAGGAAGG + Intergenic
1123395779 15:19933575-19933597 GAGGGAGAAAGAAGGGAGGGAGG + Intergenic
1123464119 15:20501663-20501685 GATGGTGGCAGAAGAGAGGCAGG + Intergenic
1123653946 15:22498759-22498781 GATGGTGGCAGAAGAGAGGCAGG - Intergenic
1123737214 15:23196957-23196979 GAGGGTGAAAGCTGGGAGGAGGG - Intergenic
1123882673 15:24690177-24690199 GAGGGTGACAGGACCAAGGCAGG + Intergenic
1124274849 15:28317647-28317669 GATGGTGGCAGAAGAGAGGCAGG + Intronic
1124288430 15:28425619-28425641 GAGGGTGAAAGCTGGGAGGAGGG - Intergenic
1124294794 15:28491695-28491717 GAGGGTGAAAGCTGGGAGGAGGG + Intergenic
1124307853 15:28593958-28593980 GATGGTGGCAGAAGAGAGGCAGG - Intergenic
1126500028 15:49335208-49335230 GAGAGGGACAGAAGAAAGGAAGG - Intronic
1127872349 15:63083831-63083853 GAGGGAGAGAGGAGGGAGGAAGG + Intergenic
1127920760 15:63492397-63492419 GAGGGGAACAGAGGCCAGGAGGG - Intergenic
1129199312 15:73989328-73989350 GAGGAGGAGAGAAGTGAGGAAGG - Intronic
1129207106 15:74043907-74043929 GAGGCTGATAGAAGACAGGAGGG + Intronic
1129683450 15:77671340-77671362 GAGGGGGTGAGAAGGGAGGAAGG + Intronic
1129832155 15:78677842-78677864 GAGAGGGACAGAAGAGAGAAGGG + Intronic
1131559130 15:93424267-93424289 CAGGCTGACAGAAGCTGGGAAGG + Intergenic
1132295233 15:100729638-100729660 GAGGCTGGAAGAGGCGAGGAAGG + Intergenic
1132367073 15:101265433-101265455 GAAGCTGAAAGAAGCAAGGAAGG - Intergenic
1133125549 16:3643586-3643608 GTGCGTGACAGAAGGGCGGAGGG - Intronic
1133189481 16:4122916-4122938 GAGGCTGACAGAGGCAAGGCAGG + Intergenic
1133492110 16:6280282-6280304 GAAGTTGTGAGAAGCGAGGACGG - Intronic
1133774534 16:8886517-8886539 GCGGGTTATAGAAGCTAGGATGG + Intergenic
1134482865 16:14633530-14633552 TAGGGTGACCGAAGCGCAGAAGG + Intronic
1134888359 16:17815668-17815690 GATGGAGACAGAAATGAGGAGGG - Intergenic
1135174623 16:20216882-20216904 GAAGGGGAGAGAAGCGAGGCAGG + Intergenic
1135562528 16:23487681-23487703 GAGGGTGGGAGGAGCTAGGAAGG - Intronic
1135632625 16:24047962-24047984 AAGGGTGAGGGAAGGGAGGAGGG + Intronic
1135778823 16:25280714-25280736 GGGGGAGACAGTAGTGAGGAGGG + Intergenic
1135829918 16:25763967-25763989 TAGGGAGACAGAAGCAAGAATGG + Intronic
1135902951 16:26483076-26483098 GAGGGTGAAGGATGGGAGGAGGG - Intergenic
1136995483 16:35185952-35185974 GATGGTGTCAGTAGAGAGGAGGG + Intergenic
1137249383 16:46731139-46731161 GAGGGTGAGAGGAGAGAGGGTGG - Intronic
1137510501 16:49095509-49095531 GATGGTGACAGAAGCAGGGAGGG + Intergenic
1138980584 16:62263074-62263096 GAGGGTGGAAGATGGGAGGAGGG + Intergenic
1139381845 16:66537390-66537412 GTGGGTGGGAGAAGCCAGGAGGG + Intronic
1139981801 16:70865201-70865223 GAGAGTGAAAGAAGTGAGAATGG - Intronic
1140223360 16:73059190-73059212 GAGGGAGGCAGAGGGGAGGAAGG + Intronic
1140526797 16:75629931-75629953 GAGGGTGAGAGAGACCAGGAAGG + Intronic
1140584872 16:76277476-76277498 GAGGGAGAGAGAAGAGAGGGAGG + Intronic
1140944901 16:79758703-79758725 GAGTGTGAGAGAAAGGAGGACGG + Intergenic
1141492861 16:84386590-84386612 GAGTGTGACACCAGCGAGCAAGG - Intronic
1141747609 16:85936298-85936320 GAGGGTGGCAGAAGCGAGTCAGG - Intergenic
1141819809 16:86437524-86437546 GATGGTGATAGAAGAAAGGATGG - Intergenic
1141819840 16:86437713-86437735 GAGGATGATAGAAGAAAGGAAGG - Intergenic
1142624202 17:1181505-1181527 GAGGGTGACAGCTGCAGGGAGGG - Intronic
1143582130 17:7833833-7833855 GACGGGGAAAGAAGCGAGGGAGG + Intergenic
1144077155 17:11729656-11729678 GAGGGTGGCAGAAGGGGGGTGGG + Intronic
1144417003 17:15057835-15057857 GGGGGTGACAGACGAGAGGAGGG + Intergenic
1145878937 17:28340162-28340184 CAGGGTGACAGAGGCGGGGATGG - Intronic
1146274305 17:31506532-31506554 GAGGGTAGGAGAAGGGAGGACGG - Intronic
1146442544 17:32909927-32909949 GAGGGTGAGAGGAGTGAGAATGG + Intergenic
1146532751 17:33623884-33623906 GAGGGTGACAGATGGGAAGGTGG - Intronic
1146809335 17:35890752-35890774 CAAGGTGACAGAAGAGGGGAGGG - Intergenic
1146909474 17:36639318-36639340 GAGGAAGAAAGAAGGGAGGATGG - Intergenic
1146978261 17:37135015-37135037 GAGGGGGAGAGAAAGGAGGAAGG + Intronic
1146998950 17:37346371-37346393 GAGGGTAGCAGATGGGAGGAGGG + Intronic
1147690653 17:42312673-42312695 GGGGGTGGGAGAAGAGAGGAGGG + Intergenic
1148696222 17:49560673-49560695 GAGGGAGAGAGATGTGAGGATGG - Intergenic
1149027995 17:52052135-52052157 GAGGGTGGGGGAAGGGAGGAGGG + Intronic
1149098208 17:52870672-52870694 GAGGGGGAAAGAAGAGAGGAAGG + Intronic
1149445789 17:56712336-56712358 GAGGCTGGAAGAAGCAAGGAAGG + Intergenic
1149797077 17:59530497-59530519 GAGGGAGAGAGAAGGGAGGGAGG + Intergenic
1150060990 17:62068090-62068112 CAAGGAGACAGAAGCGAAGAAGG + Intergenic
1150478057 17:65488894-65488916 GAGGGAGAGAGAAGGAAGGAGGG + Intergenic
1150831142 17:68520279-68520301 AAGAGTGACAGAAGCAGGGAGGG + Intronic
1151683692 17:75634854-75634876 GAAGGTCACAGAAGTGAGGCTGG + Intronic
1151824023 17:76513542-76513564 AAGGCTGACAGAGGTGAGGAAGG + Intergenic
1152269039 17:79313174-79313196 GAAGGTGCCAGAAGCAAGGGGGG - Intronic
1152336277 17:79701467-79701489 GAGGGTGACAGGTGGGAGGGTGG + Intergenic
1152354399 17:79799654-79799676 GAGGGAGACGGAAGGAAGGAAGG - Intronic
1152829667 17:82489401-82489423 AAGGGTGACAGACACGAGAATGG + Exonic
1203183915 17_KI270729v1_random:93534-93556 GAGGGAGAAAGAAGGGAGGGAGG + Intergenic
1153285210 18:3450155-3450177 CAGAGTGAGAGAGGCGAGGAGGG - Intronic
1154319619 18:13336776-13336798 GAGGAAGACAGAAGAGAGGGAGG - Intronic
1155741556 18:29295324-29295346 GAGGGTGAAAGGTGGGAGGAGGG + Intergenic
1156473339 18:37390967-37390989 GACGGGGACAGGAGGGAGGACGG - Intronic
1156487768 18:37477461-37477483 GTGGGTGACAGAAGCCTGGGTGG + Intronic
1156528031 18:37786470-37786492 GAGGGTGGCAGGTGAGAGGAGGG - Intergenic
1156594775 18:38535847-38535869 GAGACTGAAAGAAGGGAGGAAGG - Intergenic
1157038418 18:44006609-44006631 GAGGGAAACAGAAGAGAGGAAGG + Intergenic
1157056268 18:44232684-44232706 GAGAGTGCCAGAAGGGAGGGAGG - Intergenic
1157120447 18:44905356-44905378 GAGGGTTACAGAAGCTTGAATGG + Intronic
1157855402 18:51100470-51100492 GGGGGAGCCAGAAGGGAGGATGG - Intergenic
1157988894 18:52471973-52471995 GAGGCTGAGAGAAGGGAGGAAGG + Intronic
1158602189 18:58864298-58864320 GAGAGGGACGGAAGGGAGGAGGG + Intronic
1160018724 18:75164209-75164231 GAGGGAGACAGAGGAGAGGGAGG + Intergenic
1160053595 18:75459244-75459266 GAGGCTGAAAGAGACGAGGAAGG + Intergenic
1160174962 18:76585869-76585891 GAGAGAGAAAGAAGGGAGGAAGG - Intergenic
1160500990 18:79400933-79400955 GAGGGTGACTGTGGGGAGGAAGG - Intronic
1160738121 19:674038-674060 GAGGGAGACAGAAGCCTGGGGGG + Intergenic
1160940424 19:1618203-1618225 GAGGGTGAGAGAAGGCAGGGTGG - Intronic
1160965268 19:1744608-1744630 GAGGGTGAGAAAGGGGAGGAAGG - Intergenic
1161198879 19:3003222-3003244 GAGGGAGAGAGGAGGGAGGAGGG + Intronic
1161278838 19:3434249-3434271 GAGGGTGACAGAGGAGAGTGAGG - Intronic
1161415744 19:4145483-4145505 GAGGGTGAGAGAGAGGAGGAGGG + Intergenic
1161613347 19:5256503-5256525 GAGGGTGCAAGAAGGGAGGGGGG - Intronic
1161803702 19:6430190-6430212 GACGGAGACAGAGGCGAGCAGGG - Intronic
1161878055 19:6927199-6927221 GAGGGAGGAAGAAGGGAGGAGGG - Intronic
1162237701 19:9321718-9321740 GAGGGTGGCAGGGGGGAGGAGGG - Intergenic
1162717043 19:12640726-12640748 GAGGGTGGAAGGAGGGAGGAAGG + Intergenic
1163324892 19:16597020-16597042 GAGGGTGACAGATGCCAGAGGGG + Intronic
1164536141 19:29087766-29087788 GGGGGTGGGAGAAGCAAGGAAGG + Intergenic
1165202922 19:34159789-34159811 TAGAGAGACAGAAGCGGGGAAGG + Intergenic
1165805812 19:38580094-38580116 GTGGGTGACAGAGGACAGGATGG - Exonic
1166333163 19:42090339-42090361 GAGGGTGACAGGGTTGAGGAGGG + Exonic
1166778099 19:45324399-45324421 GAGGGTCACAGATGAGGGGACGG + Intergenic
1166803997 19:45474045-45474067 GGGGGTGACAGAACCGAGAAGGG + Exonic
1167075126 19:47243918-47243940 GAGAGAGACAGAATCCAGGAGGG - Intergenic
1167520429 19:49951487-49951509 GTTGGTGTCAGAAGTGAGGATGG + Intronic
1167558086 19:50207969-50207991 GGAGATGACAGGAGCGAGGAAGG - Intronic
1167634628 19:50647365-50647387 GAGGGCGAGAGAATGGAGGATGG + Intronic
1167699527 19:51034368-51034390 GAGAGGGACAGAAGGGAAGAGGG + Intronic
1167857779 19:52256552-52256574 GAGAGAGACAGAGGCCAGGAGGG - Intergenic
1168293797 19:55369439-55369461 GAAGGAGCCAGAAGCCAGGACGG + Intronic
925577896 2:5379729-5379751 GAGGGTGAAAGGTGGGAGGAGGG + Intergenic
926010100 2:9400440-9400462 GAGGATGGCAGGAGGGAGGAGGG - Intronic
926163959 2:10506572-10506594 GATGGTGACAGAAGCCACGCTGG - Intergenic
926167793 2:10532342-10532364 CAGGGAGACAGAAGCAGGGACGG + Intergenic
926778748 2:16447779-16447801 GAGGGGGACAGAAGGGAAGGAGG + Intergenic
927012144 2:18914948-18914970 GAGGGTGAAAGAAGTGCGGAAGG + Intergenic
927101282 2:19789454-19789476 GAGGGTGAAAGCAGGGAGCAGGG + Intergenic
927167983 2:20344545-20344567 GAGGGTGACAAAAGAGAGATAGG - Intronic
927196555 2:20551729-20551751 GAGGCTGAGAGAAGCCAGGGAGG + Intergenic
927260455 2:21083405-21083427 GAGATGGACAGAAGAGAGGAAGG + Intergenic
927686406 2:25174416-25174438 GAGGGAGGAAGAAGCAAGGAAGG + Intergenic
927938333 2:27087508-27087530 CAGCATGACAGAAGAGAGGAAGG + Intronic
929004236 2:37379970-37379992 GAGGTTGGCAGAAGGAAGGAAGG + Intergenic
929013488 2:37471065-37471087 GAGGAAGAGAGAAGAGAGGAAGG - Intergenic
932115498 2:69042965-69042987 GAGAGTGTCAGCAGTGAGGAGGG - Intronic
932436099 2:71703322-71703344 GAGGAGGAGAGAAGGGAGGAGGG + Intergenic
933508244 2:83205332-83205354 CAGGGTGACAGCAGAGAGAATGG + Intergenic
934783098 2:96985447-96985469 GAGGATGAGGGAAGCGGGGAGGG - Intronic
935531172 2:104234286-104234308 CAGGGAGACAGAAGTGAGGCAGG - Intergenic
935782583 2:106521064-106521086 GAGAGAGACAGATGCGAGAATGG + Intergenic
935819727 2:106882840-106882862 GAGGGCAGCAGAAGCCAGGATGG + Intronic
936278257 2:111118710-111118732 GAGGGAGGGAGAAGGGAGGATGG - Intergenic
937348552 2:121143725-121143747 GAGGGTGACGGAAGAGCGGTGGG + Intergenic
937760025 2:125589997-125590019 GATGTTAACAGAAGTGAGGAGGG - Intergenic
937870372 2:126781992-126782014 GAGGGTGACAGGTGCAAGGCTGG - Intergenic
937872192 2:126793853-126793875 AAGGGAGGCAGAAGAGAGGAAGG + Intergenic
938080447 2:128367303-128367325 GAGGGGGGCTGCAGCGAGGAGGG - Intergenic
938783241 2:134603900-134603922 GAGAGAGAAGGAAGCGAGGAAGG + Intronic
938934782 2:136118242-136118264 GAGAGGGGCAGACGCGAGGAAGG + Intergenic
940140797 2:150488542-150488564 GAGGAGGACAGAAGAGAGGGTGG - Intronic
941169419 2:162118705-162118727 GAGGGCATCAGAAGGGAGGAGGG + Intergenic
941364833 2:164597693-164597715 GAGGGAGACAGAAGGAAGAAAGG + Intronic
941771457 2:169350044-169350066 CAGGGTGGCAGAAGTGAAGATGG + Intronic
942211789 2:173678353-173678375 GAAGGGGAAAGAAGGGAGGAAGG + Intergenic
943573746 2:189606268-189606290 GAGGGAGACACAACCAAGGAAGG - Intergenic
943623340 2:190173939-190173961 GCAGGTGACAGAAGCTAGGAGGG - Intronic
944523820 2:200598127-200598149 GAGGGAGAGAGGAGGGAGGAAGG + Intronic
945851181 2:215009294-215009316 GAGGGGAACAGAAGGGTGGAGGG + Intronic
946038720 2:216765857-216765879 GAGTGAGAGAGAAGGGAGGAGGG - Intergenic
946068806 2:217013296-217013318 GAGAGTGAGAGAAGGGAGGCAGG + Intergenic
947253350 2:228134176-228134198 GAGGAAGACAGAAGGAAGGAGGG + Intronic
947380818 2:229543729-229543751 GGAGGTGCCAGAAGAGAGGAAGG - Intronic
947718260 2:232352486-232352508 GAGGGTCGCAGAAGGAAGGAGGG - Intergenic
947795338 2:232890744-232890766 GAGGGTGACGGAAACGGGGAAGG - Intronic
948648946 2:239426853-239426875 GAGGGTGACAGAAGGATGGAAGG - Intergenic
948684122 2:239659425-239659447 GAGGGACACAGAAGACAGGAGGG - Intergenic
949058533 2:241943166-241943188 GAGGCTGAGAGTGGCGAGGAAGG - Intergenic
1169788633 20:9386236-9386258 GAGGGAGACCGAAGAAAGGAGGG + Intronic
1170501865 20:16982606-16982628 GAGGGAGGAAGAAGGGAGGAAGG - Intergenic
1170520081 20:17175945-17175967 GATGGAGACAGACGCAAGGAAGG - Intergenic
1170664425 20:18374543-18374565 GAGGGTGAAGGATGGGAGGAGGG + Intergenic
1171010757 20:21508206-21508228 CAAGGAGACAGAAGAGAGGAAGG + Intergenic
1171460092 20:25293164-25293186 GGGGGTGGCAGAGGGGAGGAGGG + Intronic
1172123431 20:32611571-32611593 GAGGGAGGCAGATGGGAGGAGGG - Intergenic
1172129784 20:32647981-32648003 GAGGGTGAGAGAAGTGGGTAGGG - Intergenic
1173890889 20:46509367-46509389 GAGGGTGAGGGAAGTAAGGAAGG + Intronic
1174358137 20:50011716-50011738 GAGAGAGAGAGGAGCGAGGAGGG + Intergenic
1175135211 20:56818353-56818375 GGAGGTGACAGGAGGGAGGAGGG + Intergenic
1175345228 20:58268329-58268351 GAGACTGACAGAAGAGAGGAGGG + Intergenic
1175384325 20:58584641-58584663 GAGGGAGGGAGAAGGGAGGAAGG - Intergenic
1175799110 20:61790962-61790984 GAGGGTGAGAGCACTGAGGATGG - Intronic
1176186408 20:63782339-63782361 GAGGGTGACAGAAGCGAGGATGG + Intronic
1176268628 20:64223823-64223845 GAGCGTGACAGGAGAGGGGAGGG - Intronic
1176423694 21:6534871-6534893 GCAGCTGGCAGAAGCGAGGAAGG - Intergenic
1176591111 21:8651727-8651749 GAGGCGGACAGCGGCGAGGAGGG - Intergenic
1177461413 21:21415777-21415799 AAGGCTGACAGAGGTGAGGAAGG - Intronic
1178420739 21:32441342-32441364 GAGGCTGAATGAAGGGAGGAAGG + Intronic
1178480669 21:32977143-32977165 GAGGGAAAAAGAAGGGAGGAGGG - Intergenic
1178484956 21:33013266-33013288 GAGTCTGGAAGAAGCGAGGAAGG - Intergenic
1178684214 21:34698473-34698495 GAGAAAGACAGAAGGGAGGAAGG + Intronic
1179496800 21:41776856-41776878 GAGGCTGAGAGAGGCCAGGAAGG + Intergenic
1179699187 21:43143186-43143208 GCAGCTGGCAGAAGCGAGGAAGG - Intergenic
1180009756 21:45041521-45041543 GAGGGTTACACAACCCAGGACGG + Intergenic
1180034342 21:45236067-45236089 GAGTGTGGCAGCAGCCAGGAGGG + Intergenic
1180273939 22:10628760-10628782 GAGGCGGACAGCGGCGAGGAGGG - Intergenic
1180876760 22:19178409-19178431 GGGGGTGACAGACGGGAGGCGGG + Intronic
1180916720 22:19494028-19494050 GTGGGTGACAGCAGCTAGGGTGG + Intronic
1181410213 22:22713239-22713261 GAGGGTGACCGAGGCTGGGAGGG - Intergenic
1181417763 22:22772622-22772644 GAGGGTGACCGAGGCTGGGAGGG - Intronic
1181537194 22:23552596-23552618 GAGGGAGGTAGAAGAGAGGATGG - Intergenic
1181725845 22:24810446-24810468 GAGGGTAAAGGAAGCCAGGAAGG - Intronic
1181743638 22:24940673-24940695 GAGGGAGAGAGAAGGAAGGAGGG - Intronic
1182309310 22:29393444-29393466 GTGGGTGACAGAAGTGGGGAAGG + Intronic
1182394399 22:30025035-30025057 GAGGGTGAAAGAGGAGAGGTGGG - Intronic
1182836500 22:33346247-33346269 GAGAGAGAGAGAAGAGAGGAAGG - Intronic
1183217045 22:36487475-36487497 GCAGGTGACAGAGGCTAGGAGGG + Exonic
1183494103 22:38132737-38132759 GAGGGAGACAGTGGGGAGGAGGG + Intronic
1183718943 22:39551015-39551037 GAGGTGGACAGAAGCCAGCAGGG + Intergenic
1183752928 22:39732338-39732360 GAGGATGACAGAAGCAGGCAGGG - Intergenic
1184158065 22:42681879-42681901 GAGAGAGAGAGAAGGGAGGAAGG - Intergenic
949218132 3:1596224-1596246 GATGGTGCCAAAAGCGAAGAAGG - Intergenic
949336283 3:2978819-2978841 GAGGATGGCAGAGGGGAGGATGG - Intronic
949412746 3:3783713-3783735 CAGGGTGGCAGAAGGGAGGTGGG - Intronic
949751469 3:7356857-7356879 GAGGATGAGAGAAGCCAGTAGGG - Intronic
949768214 3:7550338-7550360 GAGGGAGGGAGAAGGGAGGAGGG - Intronic
949807423 3:7970877-7970899 GTGGGGGACAGAAGGGAGTAAGG + Intergenic
949963630 3:9336210-9336232 GAGGGAGAGAGAAGAGAGGGAGG - Intronic
950719347 3:14871573-14871595 GCGGGTGACAGAGGAGAGGGAGG + Intronic
951061861 3:18218150-18218172 GAGGAAGAAAGGAGCGAGGAAGG + Intronic
952841668 3:37651855-37651877 CAGGGTGACAGAGGTGAGGAGGG + Intronic
953189331 3:40669099-40669121 AAGGGTGAGAGAAGCTGGGATGG + Intergenic
954111282 3:48434807-48434829 AAAGGTGACAGAGGTGAGGAGGG - Exonic
954288449 3:49636263-49636285 GAGGGCAGCAGAAGCCAGGAGGG + Intronic
954409967 3:50366230-50366252 GAGAGTGAAAGAAGAGAGTAGGG - Intronic
954781466 3:53065263-53065285 GAGGGAGAAAGAAGGAAGGAAGG - Intronic
955525033 3:59811155-59811177 GAGGGTGACATAAGTGTGCAAGG - Intronic
956053832 3:65277630-65277652 GAGGCTGGGAGAAGTGAGGAAGG - Intergenic
956934923 3:74089809-74089831 GTAGGTGACAGATGGGAGGAGGG - Intergenic
958853683 3:99358750-99358772 GTGAGTGACTGAAGAGAGGAGGG - Intergenic
959369063 3:105500294-105500316 GTGAGTGAAAGAAGCTAGGAAGG - Intronic
960211228 3:114969239-114969261 GGGGTTGACAGAAGAAAGGAGGG + Intronic
960256079 3:115512776-115512798 GAAGGGAACAGAAGAGAGGATGG + Intergenic
960678072 3:120216644-120216666 GAGGGTGGAAGATGGGAGGAGGG - Intronic
961004634 3:123396708-123396730 GAGGGAGAGAGAAGGGAGGGAGG + Intronic
961254201 3:125533196-125533218 GAGGGAGAGAGAAGGGAGGGAGG - Intronic
961369601 3:126421496-126421518 AAGGGTGGCAGAAGCAGGGATGG + Intronic
961370343 3:126424788-126424810 GAGGGTGACAGCAGATGGGAGGG + Intronic
961637041 3:128340073-128340095 GAGGGAGACAGCAGGGAGGGAGG - Intronic
961924814 3:130467230-130467252 GTGGTTAACAGAAGCTAGGAAGG + Intronic
962057825 3:131891565-131891587 GAGGGTGAAAGGTGGGAGGAGGG - Intronic
962642940 3:137407233-137407255 GAGGGAGAGAGAAGAGAAGAGGG + Intergenic
962742273 3:138370469-138370491 CAGGGTGACAGAAATGGGGAGGG - Intronic
963115608 3:141726484-141726506 GAGGGGGAAAGAAGGAAGGAAGG + Intergenic
963851648 3:150215974-150215996 GAGGGGGAAAGGAGGGAGGATGG + Intergenic
964442808 3:156729411-156729433 GAGGGGGAGAGAAGGGAGTAAGG - Intergenic
965280740 3:166748854-166748876 GAGGGTGAAGGATGGGAGGAGGG - Intergenic
965324743 3:167289739-167289761 GAGTGAGACAGAAGCCAGGGGGG + Intronic
966165139 3:177008437-177008459 GTTGGTGTCAGAAGCGAGGGTGG + Intergenic
966643997 3:182222652-182222674 GAGGGTGGCAGTTGGGAGGAGGG - Intergenic
967528659 3:190523512-190523534 GAGGGTGATAGGTGGGAGGAGGG - Intronic
967637915 3:191825843-191825865 GAGGGTGGAAGATGGGAGGAGGG + Intergenic
967644232 3:191901781-191901803 GAGAGTGATGGAAGCGAGGCTGG - Intergenic
968530292 4:1087483-1087505 GAGGGTGAGAGAACCAAGGTTGG + Intronic
968689641 4:1983957-1983979 GTGGGTGTCAGAGGCGAGGTGGG + Exonic
968781274 4:2583505-2583527 GAGGGGACCAGAAGCCAGGAAGG - Intronic
968890345 4:3365360-3365382 GAGGGAGACAGGTGAGAGGAGGG + Intronic
968947877 4:3675060-3675082 GAGGGAGAAAGAAGGGAGGGAGG - Intergenic
968955519 4:3716895-3716917 GGGGGAGACAGAAGCCAGGCAGG + Intergenic
969221271 4:5760408-5760430 GAGGGTGACAGGTGTGACGAGGG + Intronic
969298732 4:6284976-6284998 CAGGGTGACGGCAGCAAGGAAGG + Intronic
969373317 4:6747657-6747679 GAGGTTGCCAGTAGCCAGGATGG + Intergenic
969837697 4:9856958-9856980 GAGGGTGAGGGATGGGAGGAGGG + Intronic
971370236 4:26013168-26013190 GAGGGAGAAAGAAGAGAGAAGGG - Intergenic
972335832 4:38106650-38106672 GAAGGTGACTGAATCCAGGAGGG - Intronic
974595268 4:64006297-64006319 GAAGGAGACAAAAGAGAGGAAGG + Intergenic
974755605 4:66203196-66203218 GAGGGTGACAGAGGGCAAGAGGG + Intergenic
974881777 4:67767484-67767506 GAGGGTGAAAGGTGGGAGGAAGG - Intergenic
976266355 4:83189092-83189114 GAGGGTGGCAAAAGGAAGGAGGG + Intergenic
976700564 4:87965754-87965776 GAGGGTGACAGCAGCAACGCGGG - Intergenic
977257791 4:94758815-94758837 GAGGGAGACAGACGCACGGAAGG - Intronic
978236103 4:106462855-106462877 GAGGGAGCCAGAAACAAGGAGGG + Intergenic
979045672 4:115859578-115859600 GAGGGTGAAAGGTGGGAGGAGGG + Intergenic
979287309 4:118940826-118940848 GGGGGTGACAGGAGAGAGGTGGG - Intronic
979301114 4:119088463-119088485 GAGGGTGATGGGAGGGAGGAGGG - Intergenic
979763277 4:124433778-124433800 GAATGTGGAAGAAGCGAGGAAGG + Intergenic
980318073 4:131231758-131231780 GAGGGTGAGAGAAGGAAAGAGGG - Intergenic
980786461 4:137562547-137562569 GAGGGTGCTGGAAGAGAGGATGG - Intergenic
981460040 4:145003006-145003028 GAGGGTGGAAGATGGGAGGAGGG - Intronic
982667989 4:158290596-158290618 GAGGGTGGAAGATGGGAGGAGGG - Intergenic
985183648 4:187292745-187292767 GAGGGAGAGAGAAGAGGGGAGGG + Intergenic
985295068 4:188428225-188428247 GAGGATGACAGAAGCAGGGAAGG - Intergenic
985659136 5:1147200-1147222 CACGGTGACAGAAGGGAGGAGGG + Intergenic
985783981 5:1884826-1884848 GAGGGTGGGAGAGGGGAGGAAGG - Intronic
986586745 5:9326150-9326172 GATGTTGACAGCAGTGAGGATGG - Intronic
986663291 5:10077904-10077926 GAGGGTCAGAGAAGGGAGGGGGG - Intergenic
987210896 5:15682111-15682133 GTGGGGGACAGAAGAGAGGAGGG + Intronic
987360759 5:17104407-17104429 GAGGGGGAAAGAAGGAAGGAAGG - Intronic
987661695 5:20886415-20886437 GAGGGTGAAGGATGGGAGGAAGG + Intergenic
987784129 5:22477236-22477258 GAGGGTGAAAGGTGAGAGGAGGG - Intronic
989180606 5:38572974-38572996 GAGAGTGACAGAAACAAAGATGG - Intronic
989517661 5:42362238-42362260 GAGGGAGACAGAGGTCAGGATGG + Intergenic
989604580 5:43231921-43231943 GTGGGTGAGAGAAGGGAGGAAGG - Intronic
990201155 5:53376366-53376388 GAGGAGGAGAGAAGAGAGGAGGG + Intergenic
990523139 5:56599069-56599091 AAGGGTGAGAGAGGTGAGGAAGG - Intronic
990998782 5:61761093-61761115 GAGGGTGAAGGGAGGGAGGAGGG + Intergenic
991257352 5:64629742-64629764 GAGCCTGACAGGAGGGAGGAGGG + Intergenic
991360655 5:65816381-65816403 GAAGGTGAAAGATGGGAGGAAGG + Intronic
992093566 5:73340150-73340172 GAGGCTGGGAGAGGCGAGGAAGG - Intergenic
992242104 5:74782867-74782889 GTTGGTGACATTAGCGAGGAGGG - Intronic
993146815 5:84104228-84104250 GAGGGTGAAGGATGGGAGGAGGG + Intronic
994055565 5:95410355-95410377 GAGAGTGACTGAAGCAAGTAGGG - Intronic
994423159 5:99547804-99547826 GAGGGTGAAAGGTGAGAGGAGGG + Intergenic
995367176 5:111375765-111375787 GAGGATGGCAGAACCAAGGATGG - Intronic
996376115 5:122809432-122809454 AAGGGGGACAGATGGGAGGATGG + Intronic
996491873 5:124107281-124107303 AAGAGTGACAGAAGTGAGCAAGG + Intergenic
996620694 5:125498856-125498878 GAAGGGGAGAGAAGAGAGGAAGG + Intergenic
996631321 5:125636442-125636464 GAGGGTGAAAGATGGGAGAAAGG - Intergenic
997082965 5:130762860-130762882 AAGGGTGAGGGAAGCCAGGAAGG - Intergenic
997113152 5:131097325-131097347 GAGAGTGACAGAAGCAGGAAAGG - Intergenic
997215308 5:132104995-132105017 GTGGGTGACAGAATGGAGGTGGG + Intergenic
999117363 5:149175594-149175616 GAGGAGGAAAGAAGAGAGGAAGG + Intronic
999270133 5:150291924-150291946 GAGGGTGGCAGAGGGGAAGAGGG + Intergenic
999420803 5:151440723-151440745 GAGGGAGGCAGAACCAAGGAGGG + Intronic
999472051 5:151863786-151863808 GAGGGTGAGAGTGGGGAGGAAGG - Intronic
999657249 5:153822684-153822706 GAGGCTGACAGGAGTCAGGATGG - Intergenic
999892700 5:155996270-155996292 GAGGGTGAAGGATGGGAGGAGGG - Intronic
1000112070 5:158117747-158117769 GAGGGTGACAGGAGACAGGTTGG + Intergenic
1000265646 5:159633692-159633714 GAGGGTGACAGAAGAAAGGCTGG - Intergenic
1000369278 5:160519462-160519484 GTGGGAGCCAGAAGAGAGGAAGG - Intergenic
1000391129 5:160724598-160724620 GAGGATCAGAGAAGAGAGGAGGG - Intronic
1000577127 5:162988377-162988399 TAGGGAGACAGTAGAGAGGAGGG - Intergenic
1001275092 5:170344963-170344985 GAGGGGGAGAGATGTGAGGATGG + Intergenic
1001368375 5:171168897-171168919 GAGGGTGACAGAAGGCAGGAAGG - Intronic
1001445523 5:171779776-171779798 GAGTGGGAATGAAGCGAGGAAGG + Intergenic
1002061478 5:176628369-176628391 GAGGGTGGCAGGGGCGAGGGTGG - Intronic
1002079921 5:176731644-176731666 GATGTTGACAGGAGCGAGGGAGG + Intergenic
1002118373 5:176983257-176983279 GAGGGAGACTGAAGAAAGGAGGG - Intronic
1002463406 5:179388317-179388339 GTGGGTGACAGAAGCAAGTGAGG + Intergenic
1002824828 6:763379-763401 GAGAGTGACAGAAGTGAGACAGG + Intergenic
1003142129 6:3480467-3480489 GAGGGAGAGGGAGGCGAGGAGGG + Intergenic
1003426172 6:5999678-5999700 GAGGGAGACAGAAGGGGCGAGGG - Intronic
1004245358 6:13970275-13970297 GAGGGAGAAAGAAGAGAGGTTGG - Intronic
1004428164 6:15520195-15520217 GAGGCTGACAGACGGGAGGGGGG - Exonic
1004619022 6:17317027-17317049 GATAGTGACAGAGGTGAGGAGGG - Intergenic
1005002234 6:21253559-21253581 GAGGGTGTGAGATGTGAGGAAGG - Intergenic
1005128180 6:22472634-22472656 GAGGGTGGAAGATGGGAGGAGGG + Intergenic
1005419237 6:25631783-25631805 GATGGGGAAAGAAGGGAGGAAGG + Intergenic
1005768311 6:29037369-29037391 GAGGGTGGCAGGAGGAAGGAGGG - Intergenic
1006295594 6:33168722-33168744 AAGGGTGACCGAGGCGAGGATGG - Exonic
1006838537 6:37013910-37013932 GAGGGTGAGAGAAGGGAGGTGGG - Intronic
1007519530 6:42440838-42440860 GAGGGGGTGAGAAGCGGGGATGG + Intronic
1007752959 6:44081190-44081212 GAGGGGGGCAGAAGCCAGGGAGG + Intergenic
1007769706 6:44183090-44183112 GAGGGAGAGAGAAGTGGGGAGGG - Intronic
1007944860 6:45817220-45817242 GAGAGAGAGAGAAGAGAGGAAGG + Intergenic
1008228931 6:48959731-48959753 GAGGGGAACAGAGGAGAGGAGGG - Intergenic
1008348525 6:50459584-50459606 GAGGTTGAAAGATGAGAGGAAGG - Intergenic
1008395983 6:51007348-51007370 GAGGGTGAAGGATGGGAGGAGGG + Intergenic
1008725646 6:54415178-54415200 GAGGGTGAATGATGGGAGGAGGG - Intergenic
1008729657 6:54465985-54466007 GAGAGAGACAGAAGGAAGGAAGG - Intergenic
1009440589 6:63673518-63673540 GAGGCTGACAGAAGTGAGCTAGG - Intronic
1009822436 6:68820625-68820647 GAGGGAGAGAGAAGCGGGGATGG - Intronic
1010467083 6:76180732-76180754 GAGGGTGAAGGATGGGAGGAGGG - Intergenic
1010704367 6:79090021-79090043 GAGGGGGGAAGAAGGGAGGAAGG - Intergenic
1011010538 6:82698719-82698741 GAGGCTAACAGAAGCAAGAAGGG + Intergenic
1011381932 6:86751288-86751310 GAAGGTGCCAGAAGCTAAGATGG + Intergenic
1011754307 6:90483473-90483495 GAGGGTGAAAGTGGGGAGGAAGG - Intergenic
1012377012 6:98574366-98574388 GAGGGTGTTAGAAGCTGGGAGGG - Intergenic
1012995572 6:105969872-105969894 GAGGCTGGGAGAAGGGAGGAAGG - Intergenic
1013964990 6:115944868-115944890 GAGGGTGAAGGTAGGGAGGAAGG - Intronic
1014567220 6:122964355-122964377 GAGGGTGAAGGATGGGAGGAGGG + Intergenic
1015195174 6:130517841-130517863 GAGGGTGCCAGCAGGTAGGATGG + Intergenic
1015526924 6:134182784-134182806 GAGGGAGACTGAATGGAGGAGGG - Intronic
1015770893 6:136767343-136767365 GAAGGAGAAAGAAGGGAGGAAGG + Intronic
1015843736 6:137497238-137497260 GAGGGTGACCGAGGAGCGGAGGG - Intergenic
1016466954 6:144335349-144335371 GCGGGTGGCAGATGGGAGGAGGG - Intronic
1017038612 6:150289417-150289439 GAGGGTGAGGGAAGAGGGGAGGG + Intergenic
1017134364 6:151135194-151135216 GAGGCTGAAAGAGACGAGGAAGG - Intergenic
1017954060 6:159163603-159163625 GAGGGAGACATCAGCCAGGAGGG + Intergenic
1018138756 6:160805880-160805902 GATGGTGACAGAAGCTGGGTAGG + Intergenic
1018679337 6:166251592-166251614 GAGGATGATAGAAGAGAGAATGG + Intergenic
1019513871 7:1431308-1431330 AAGGGTGACAGAGGTGAGGCTGG + Intronic
1019537634 7:1537523-1537545 GAGGGTGACAGTGGAGAGGCTGG - Intronic
1020180085 7:5915638-5915660 GTGGGTGTCAGAAGTGAGGATGG - Intronic
1020302848 7:6809244-6809266 GTGGGTGTCAGAAGTGAGGATGG + Intronic
1020744641 7:12066690-12066712 GAGGGTGATAGAGGTTAGGAGGG - Intergenic
1021027271 7:15685781-15685803 GAGGGTGGCAGCAGGGAAGATGG - Intronic
1022017861 7:26367588-26367610 GAGGGACACAGAAGGGAGGCTGG - Intronic
1022502239 7:30889097-30889119 GAGGGTGGCAGAAGGGAGGCAGG - Intronic
1023370374 7:39507038-39507060 GAGAGAGAGAGAAGAGAGGAAGG + Intergenic
1023743321 7:43300478-43300500 GAGGGTGGAAGAAGGGTGGAAGG + Intronic
1023917019 7:44597121-44597143 GAGAGTGAGGGAAGGGAGGAGGG + Intergenic
1024318972 7:48046348-48046370 GAGGGAGACAGAAGGAGGGAGGG + Intronic
1024455480 7:49601043-49601065 GAGGTTGACAGAATCCAGGATGG - Intergenic
1024859885 7:53826203-53826225 GAGAGAGACAGAAGGAAGGAAGG + Intergenic
1025198874 7:56949958-56949980 GAGGCTGGTAGAAGGGAGGAGGG - Intergenic
1025673072 7:63626975-63626997 GAGGCTGGTAGAAGGGAGGAGGG + Intergenic
1026013797 7:66656476-66656498 GATGGTGACAGAACCAGGGAAGG + Intronic
1026017764 7:66684100-66684122 GATGGTGACAGAACCAGGGAAGG + Intronic
1026284951 7:68954948-68954970 GAGACAGAAAGAAGCGAGGAAGG + Intergenic
1026549023 7:71351288-71351310 GAGGGTGATGGAAGGGAGGTAGG + Intronic
1026975580 7:74495715-74495737 GAGGGAGCCAGCAGCGGGGAAGG + Intronic
1027232527 7:76281029-76281051 GAGGGTGAGAGGAGAGAGCAAGG - Intronic
1027357565 7:77373079-77373101 GAGGGAGGCAGAAATGAGGATGG + Intronic
1027371569 7:77511304-77511326 GAGGGTGAAGGATGGGAGGAGGG + Intergenic
1027650191 7:80856987-80857009 GAGGGAGGAAGAAGGGAGGAAGG - Intronic
1028031065 7:85913442-85913464 GAGGGTGAAGGATGGGAGGAGGG + Intergenic
1028075345 7:86505847-86505869 GAGGGTGGGAGTAGGGAGGAAGG + Intergenic
1028337779 7:89678847-89678869 GAGGGTGAAGGATGGGAGGAGGG + Intergenic
1029456673 7:100675369-100675391 GGGGGTGACAGCGGCGGGGAAGG - Intronic
1029553452 7:101251378-101251400 TATGGTGACAGAATCGAGGCAGG - Intronic
1029619744 7:101682604-101682626 GTGGGTTACAGAAGCGATGGCGG + Intergenic
1029927578 7:104333719-104333741 GAGGGTGCCACAAGATAGGATGG - Intronic
1030313871 7:108094407-108094429 GTGGGGGAAAGAAGCAAGGAAGG - Intronic
1030327885 7:108240702-108240724 GAGGGTGACTACAGGGAGGAAGG - Intronic
1030828315 7:114188652-114188674 GAGGCTGCCATAAGCCAGGATGG - Intronic
1031414635 7:121480740-121480762 GAGGCTGCCAGAAGCTAAGAGGG - Intergenic
1032026534 7:128446853-128446875 GAAGGTGACAGCAAGGAGGAAGG + Intergenic
1032882026 7:136100277-136100299 CAGGGTGTCAGAAGCTAAGAGGG + Intergenic
1033080237 7:138289797-138289819 GCAGGTGATAGAAGCTAGGAGGG - Intergenic
1033150854 7:138913926-138913948 GAGGGAGACAGGAGGGAGGAGGG + Intronic
1033150859 7:138913944-138913966 GAGGGAGACAGGAAGGAGGAGGG + Intronic
1033543203 7:142376132-142376154 GAGGGTGACCCAGGAGAGGACGG + Intergenic
1033548087 7:142420781-142420803 GAGGGTGACCCAGGAGAGGAGGG + Intergenic
1034349616 7:150407560-150407582 TAGGGAGACAGAAGCGGGGGCGG - Intronic
1034421056 7:150991025-150991047 GCAGGTGATAGAAGCTAGGAGGG + Exonic
1034748672 7:153547670-153547692 GAGGGGGACAGAAGAGAGGATGG - Intergenic
1034748984 7:153550889-153550911 GAATGTGACAGAAGAGAGGACGG - Intergenic
1035214872 7:157358048-157358070 GTGGGTGACAGAATGGTGGAAGG + Intronic
1035284790 7:157799277-157799299 GAGGCTGACAGCAGAGAGCAGGG - Intronic
1035379654 7:158429578-158429600 GAGGGTGGCAGGAGGGAGGTGGG - Intronic
1035454673 7:159000192-159000214 GAGGGTGAAAGAACGGGGGACGG + Intergenic
1036039708 8:5062035-5062057 GATGGTGACAGAAGCAGGAAAGG - Intergenic
1037617740 8:20534666-20534688 GAGGGTGAAAGGTGGGAGGAGGG - Intergenic
1037792023 8:21953249-21953271 GATGGTGACAGAGGCAGGGAGGG - Intronic
1037821768 8:22138606-22138628 GAGGACGACAGGAGGGAGGAGGG - Intronic
1037894520 8:22642885-22642907 CAGCGAGACAGATGCGAGGAAGG + Intronic
1037900791 8:22687441-22687463 GAGGCTTACAGAAGGGTGGAGGG + Intergenic
1038282279 8:26176602-26176624 GAGGGTGAAGGATTCGAGGAGGG + Intergenic
1039369078 8:36966383-36966405 GAGGGACTCAGAAGCAAGGAGGG + Intergenic
1039736520 8:40338421-40338443 GAAGGTGAGAGAGGCTAGGAAGG - Intergenic
1040532912 8:48280174-48280196 TGGGGTGACAGAAGTGAGTAAGG + Intergenic
1040539550 8:48340040-48340062 GAGGGTGACAGGTGGGAGGAGGG - Intergenic
1040685921 8:49873077-49873099 GATGGTGTTAGAAGGGAGGAGGG - Intergenic
1041953599 8:63533084-63533106 GAGGGAGACAGAAGGGAGGAAGG - Intergenic
1042656972 8:71110355-71110377 GAGGCTGAGAGATGGGAGGAGGG + Intergenic
1042972240 8:74422385-74422407 GAGAGAGACAGAAGGAAGGAAGG - Intronic
1043601357 8:81942272-81942294 GAGGCTGAGAGAGGTGAGGAAGG + Intergenic
1044680411 8:94772306-94772328 GTTGGTGACAGAAGTAAGGATGG - Intronic
1044946709 8:97396376-97396398 TAGGGTGACATAAGATAGGATGG - Intergenic
1044954122 8:97462164-97462186 GAGAGTGACAGAAGAGCAGAGGG - Intergenic
1045317179 8:101053195-101053217 CAGGATGATAGAATCGAGGAGGG - Intergenic
1045478066 8:102569781-102569803 AAGAGTGAAAGAAGCAAGGAAGG - Intergenic
1045550868 8:103171207-103171229 GAGAGAGAAAGAAGCAAGGAAGG + Intronic
1046145970 8:110158708-110158730 GAGGAAGACAGAAGGAAGGAAGG - Intergenic
1046707252 8:117468685-117468707 GAGAGAAACAGAAGTGAGGAGGG - Intergenic
1047349271 8:124058134-124058156 GAGGGAGACAGAAAGGAGAAAGG + Intronic
1047354711 8:124109369-124109391 GTGGCTGACAGAAGGGAAGATGG + Intronic
1047538636 8:125743006-125743028 GAGGGAGACAGGAGAGTGGAGGG - Intergenic
1047806952 8:128370936-128370958 GAGAGGGAAAGAAGAGAGGAAGG - Intergenic
1047932146 8:129739285-129739307 GATGGGGACAGAAGCAAGCAAGG + Intergenic
1048054123 8:130847162-130847184 GAGGGAGAAAGAAATGAGGAAGG + Intronic
1048281865 8:133111884-133111906 CAGGATGACCGAAGCCAGGAGGG - Intronic
1048366419 8:133742630-133742652 GAGAGTGAAAGAGGGGAGGAAGG + Intergenic
1048531625 8:135255208-135255230 GAGGGAGAAAGAAGGAAGGAAGG - Intergenic
1049281656 8:141752666-141752688 GAGGGGGACGGAAATGAGGAGGG + Intergenic
1049521875 8:143095450-143095472 GAGGGTGAGGAAAGCGAGGAAGG + Intergenic
1051019880 9:12530922-12530944 GAGAGAGACAGAAGGAAGGAAGG + Intergenic
1051595808 9:18823550-18823572 GAGAGTGACAGAGGGGAGAAGGG - Intronic
1051845524 9:21447773-21447795 GAAGGTGGCAGAAGGAAGGAGGG - Intergenic
1052077281 9:24158822-24158844 GAGGGAGAGAGAAAGGAGGAAGG - Intergenic
1052143258 9:25015566-25015588 GAGGGTGTCAGATGTGATGACGG + Intergenic
1052151003 9:25115612-25115634 GAGGGTGAAGGATGGGAGGAGGG + Intergenic
1052682165 9:31707271-31707293 GAGGGTGAAGGATGGGAGGAGGG - Intergenic
1052935231 9:34087441-34087463 GAAGGAGAGAGAAGCTAGGATGG + Exonic
1052970407 9:34373800-34373822 GAGGGGGAGAGGAGGGAGGAAGG + Intronic
1054173216 9:61858409-61858431 GAGGGAGAGAGAAGAGAGAATGG - Intergenic
1054448074 9:65387486-65387508 GAGGGAGAGAGAAGAGAGAATGG - Intergenic
1054664326 9:67722372-67722394 GAGGGAGAGAGAAGAGAGAATGG + Intergenic
1055350185 9:75378562-75378584 GAGGGTGGCAGGAGGGGGGAGGG + Intergenic
1055541278 9:77308190-77308212 GAGGGAGAAAGAGGGGAGGAAGG - Intronic
1056952546 9:91054845-91054867 GAGGGTGGAAGATGGGAGGAGGG + Intergenic
1056964141 9:91152118-91152140 TGGGGTGACAGAGGGGAGGAAGG - Intergenic
1056999789 9:91497206-91497228 GCGGCTGACAGGAGGGAGGATGG - Intergenic
1057944566 9:99314137-99314159 GAGGGAGAAAGAAGGAAGGAAGG - Intergenic
1058658037 9:107242450-107242472 GAGGGAGAAAGAAGGGAGAAAGG + Intergenic
1058917235 9:109579285-109579307 GAGGGTCACAGAAGCCAAGGAGG + Intergenic
1058948479 9:109881028-109881050 GAGGGTGAAGGGAGGGAGGAGGG - Intronic
1058949485 9:109890373-109890395 GAGGGAAAGAGAAGCTAGGAAGG - Intronic
1059347089 9:113636399-113636421 GAGGGTGACAGCAGCAGGGCTGG - Intergenic
1059476087 9:114548869-114548891 GAGAGAGAGAGAAGGGAGGAAGG + Intergenic
1059557524 9:115296181-115296203 GCGGGGGACAGAGGGGAGGAGGG + Intronic
1059620135 9:115995144-115995166 GAGGGAGGAAGAAGGGAGGAAGG + Intergenic
1059626275 9:116070154-116070176 GAAGGTGACAGAAACCAGAATGG - Intergenic
1060110564 9:120903755-120903777 GAGGGTCAGAGAAGCCAGGGAGG + Exonic
1060740838 9:126096677-126096699 GAGGGCGAGAGAGGAGAGGAGGG + Intergenic
1061431307 9:130533016-130533038 GAGGAAGACAGGAGCCAGGAGGG + Intergenic
1061492370 9:130952816-130952838 GCAGGTGTCAGAAGCGGGGAAGG + Intergenic
1061786528 9:133031903-133031925 GCAGGTGATAGAAGCTAGGAAGG + Intronic
1062492444 9:136812858-136812880 GGTGGTGGCAGAAGCCAGGAAGG - Intronic
1062715152 9:138006461-138006483 GAGGTGGGCAGAGGCGAGGAGGG - Intronic
1185766832 X:2732479-2732501 GAGGGGGAAAGAAAGGAGGAGGG - Intronic
1185965024 X:4590542-4590564 GAGGGTGGAAGAAGGGAGGAAGG + Intergenic
1186077624 X:5898077-5898099 AAGGGAGAAAGAAGAGAGGAAGG - Intronic
1186101360 X:6160013-6160035 GAGAGAGAGAGAAGTGAGGATGG + Intronic
1186989194 X:15049431-15049453 GAAGGTGGAAGAAGCAAGGAAGG + Intergenic
1187701378 X:21967366-21967388 GAGGGTGACAGAGTGGAGGATGG + Intronic
1188295922 X:28448122-28448144 GAGGGTGGAAGATGGGAGGAGGG + Intergenic
1188477952 X:30606869-30606891 GAGGGAGAGAGAAGGGAGGAGGG - Intergenic
1188910688 X:35843447-35843469 GAGGGAGACAGGTGGGAGGAGGG - Intergenic
1189847978 X:45153844-45153866 CAGGGTGACAGGAGCTAGGGAGG - Intronic
1190377971 X:49808588-49808610 GAGGGTGGAAGATGGGAGGAGGG - Intergenic
1190525718 X:51327628-51327650 GAGGGTGACAGCAGTGAGGCAGG + Intergenic
1190812202 X:53895629-53895651 GAGGGTGGAAGGAGGGAGGAGGG + Intergenic
1191673946 X:63775673-63775695 GAGGGTGAAGGATGTGAGGAGGG + Intronic
1192336554 X:70225501-70225523 GTGGGTGGAAGAAGGGAGGAGGG + Intergenic
1192627290 X:72743642-72743664 GGGGGTGGCAGATGGGAGGAAGG + Intergenic
1192654418 X:72977171-72977193 GGGGGTGGCAGATGGGAGGAAGG - Intergenic
1194061015 X:89198016-89198038 GAGGGTGGAAGATGGGAGGAAGG + Intergenic
1194362066 X:92964463-92964485 GAGGCAGACAAAAGGGAGGAGGG + Intergenic
1195130013 X:101842278-101842300 GAGAGAGACAGAAGGAAGGAAGG - Intronic
1195726960 X:107927849-107927871 GTGCGTGACAGGAGGGAGGAAGG - Intergenic
1195745453 X:108112935-108112957 TAGGTTGACAGAAGCAAGAAGGG - Intronic
1197190923 X:123647408-123647430 GAGGGAGACAGAAACAGGGAGGG + Intronic
1198159693 X:133995294-133995316 GAGGGTGGAAAATGCGAGGAGGG + Intergenic
1199233327 X:145464146-145464168 TGGGGTGGGAGAAGCGAGGAGGG + Intergenic
1199855534 X:151756158-151756180 GAGGGAGAAAGAAGCAAGGAAGG - Intergenic
1200076195 X:153552407-153552429 GAGGGTCACAGAGGCGGGCATGG - Intronic
1200389181 X:155926470-155926492 AAGGCTGAGAGAGGCGAGGAAGG - Intronic
1200670315 Y:6080678-6080700 GAGGCAGACAAAAGGGAGGAGGG + Intergenic
1200812257 Y:7498461-7498483 GAGGGTGCAGGAAGGGAGGAGGG + Intergenic
1201486197 Y:14496836-14496858 GAGAGAGACAGAAGAGAGGAAGG + Intergenic
1201517691 Y:14835600-14835622 GAGGAAGAAAGAAGAGAGGAAGG + Intronic