ID: 1176186838

View in Genome Browser
Species Human (GRCh38)
Location 20:63784868-63784890
Sequence GATGATGCACAGAGGGGTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 278}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176186821_1176186838 29 Left 1176186821 20:63784816-63784838 CCTAGAAAATCACTCTTAAAAGC 0: 1
1: 0
2: 2
3: 21
4: 338
Right 1176186838 20:63784868-63784890 GATGATGCACAGAGGGGTTGGGG 0: 1
1: 0
2: 2
3: 22
4: 278
1176186829_1176186838 -1 Left 1176186829 20:63784846-63784868 CCTCAGGGTCACCAGGGGCCGGG 0: 1
1: 0
2: 3
3: 37
4: 308
Right 1176186838 20:63784868-63784890 GATGATGCACAGAGGGGTTGGGG 0: 1
1: 0
2: 2
3: 22
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176186838 Original CRISPR GATGATGCACAGAGGGGTTG GGG Intronic
902028734 1:13405082-13405104 GCTGAGGCACAGAGAGGTTAAGG - Intergenic
902311573 1:15585146-15585168 GCTGAAGTCCAGAGGGGTTGAGG - Intronic
903936329 1:26897591-26897613 GCTGATGCCCAGAGGGAATGTGG - Exonic
904810915 1:33162932-33162954 ACTGAGGCACAGAGAGGTTGAGG - Intronic
906704718 1:47886620-47886642 AATGATTAAAAGAGGGGTTGGGG - Intronic
906713972 1:47953215-47953237 GATGATGCACAGAGGGGTGTGGG + Intronic
907353758 1:53855187-53855209 AATGATGCAGAGAGGGCTTCTGG - Intronic
907659728 1:56380905-56380927 GAGCATTCACAGCGGGGTTGGGG + Intergenic
911416256 1:97578383-97578405 GATGATGCCCAGTGCGGTTTTGG - Intronic
912540243 1:110409399-110409421 AATGATCCACAGAGGGGGTGAGG - Intergenic
912799362 1:112711567-112711589 ATTGATGCACAGAGAGGTTAAGG + Intronic
913719298 1:121575268-121575290 GGTGATGTACAGAAGGGTTTTGG - Intergenic
917031759 1:170700538-170700560 GATGATGGACAGAGATATTGTGG + Intronic
917223976 1:172762220-172762242 GATGAGGCAGAGAGAGGTTGTGG + Intergenic
921078139 1:211716326-211716348 GATGAGGCACTGAGGGGCTTGGG - Intergenic
923395156 1:233554684-233554706 GCTGATGCACACAGGTGCTGAGG + Intergenic
924434381 1:244025985-244026007 GATGATGCCCAGGAGGGTTGAGG + Intergenic
1063899706 10:10719704-10719726 GATGAGGCACAGAGAGGTTAGGG - Intergenic
1065177622 10:23095229-23095251 GGAGATGCAGAGATGGGTTGGGG + Intergenic
1068306269 10:55212363-55212385 GATGCTGCAGAGAGGGGTCCTGG - Intronic
1068610575 10:59056014-59056036 GTTTATGCACAGAGAGGTGGAGG + Intergenic
1069917933 10:71798648-71798670 GAGGAGCCACAGAGGGGCTGTGG - Intronic
1070920701 10:80183808-80183830 GCTGATGCACTGAGGGTTTCTGG - Intronic
1072521949 10:96236898-96236920 GATCATTAACAGAGGGGTGGGGG + Intronic
1073102188 10:101012137-101012159 GAGGTTGCAGAGAGGGCTTGGGG - Intronic
1074454069 10:113582186-113582208 GATGCTGCTCAGAGGGGAAGGGG - Intronic
1075186265 10:120261160-120261182 GATGCTGCATAGAAGGGCTGTGG - Intergenic
1075827212 10:125369452-125369474 GAAGATGCACCATGGGGTTGTGG + Intergenic
1076542263 10:131221543-131221565 GAAGATGCGCTGAGGGGATGTGG + Intronic
1076772186 10:132671796-132671818 GTTGAGGCACAGAGAGGTTCAGG + Intronic
1076836081 10:133021643-133021665 GATAAGGCACAGGGAGGTTGCGG + Intergenic
1076875702 10:133214585-133214607 GCTCAGGCACAGAGGGGATGGGG - Intronic
1077917516 11:6621242-6621264 CAGGAGGCACAGAGGGGTGGTGG - Intergenic
1080517960 11:33040671-33040693 GATGATGGAAAGATGCGTTGGGG - Intronic
1081312459 11:41590547-41590569 CATGATGCACAGAGTGGCAGTGG - Intergenic
1081630850 11:44688573-44688595 GAAGAAGGAGAGAGGGGTTGGGG + Intergenic
1081638731 11:44738423-44738445 AATGAGGCACAGAGAGGTTGAGG - Intronic
1081651867 11:44829310-44829332 GATGGAGCACAGAGGATTTGGGG - Intronic
1082079131 11:47998470-47998492 GATGAGGCACAGAGAGGTGGAGG + Intronic
1083283135 11:61639792-61639814 GCTGATGCCCAGAGAGGTTTAGG + Intergenic
1083731299 11:64653957-64653979 GATGATGGGAAGAGGGCTTGTGG + Intronic
1084006618 11:66326669-66326691 GCTGATGCTCAGAGGAGGTGGGG - Intergenic
1084479390 11:69409919-69409941 GTTGAAGCACACAGTGGTTGCGG - Intergenic
1084705074 11:70811366-70811388 GAGGATGCACAGTGGGGCCGTGG - Intronic
1085049320 11:73372018-73372040 GATGAGGCACAGAGAGGGTCAGG + Intergenic
1085625044 11:78065327-78065349 GTCTATGCACAGAGGGGCTGGGG + Intronic
1085702445 11:78756924-78756946 GATGATGTCCAGAGGGTTAGGGG + Exonic
1086117918 11:83272968-83272990 AATGAAGCACAGAGGGGTTAAGG - Intronic
1086418538 11:86614453-86614475 GATGGAGCAAAGAGGGGTTCTGG - Intronic
1088418779 11:109619431-109619453 GAAGATGCACACATGGGTTTAGG + Intergenic
1089990676 11:122856897-122856919 GATGACTCACAGAGGGGTGGGGG - Intronic
1091319117 11:134637324-134637346 GCTGAGGCACAGAGAGGCTGTGG + Intergenic
1093776067 12:23075791-23075813 GGTGATGTACAGATGGGTTTTGG + Intergenic
1096470939 12:51875304-51875326 GCAGATGCACAGGAGGGTTGTGG - Intergenic
1097341867 12:58447924-58447946 GATAATGCACTGAGAGGATGGGG + Intergenic
1098597002 12:72285312-72285334 GATGATGGAGAGAGGAGTGGTGG + Intronic
1099339411 12:81409497-81409519 GATGATACAGAGAGAGGATGAGG - Intronic
1100109578 12:91223141-91223163 GATGACATACAGAGGGTTTGTGG - Intergenic
1100222240 12:92517735-92517757 GGTGATGCAAAAAGGGATTGTGG - Intergenic
1101911390 12:108862599-108862621 ATTGATGCACAGAGTGGTTAAGG + Intronic
1102013600 12:109633790-109633812 GATGATGCAGGCAGGGATTGGGG + Intergenic
1102425068 12:112837823-112837845 GATGAAGGACAGAGGGGAAGAGG - Intronic
1103040192 12:117688514-117688536 TATGATGCAGAGAGTGGTTCTGG - Intronic
1104285571 12:127421439-127421461 CCTGAAGCAAAGAGGGGTTGAGG + Intergenic
1104484580 12:129139405-129139427 GCTGCTGAACAGAGGGTTTGTGG - Intronic
1104655967 12:130574293-130574315 GGTGATGAACATGGGGGTTGTGG - Intronic
1106785834 13:33107416-33107438 GATTATGCACAGAGGGCTCTGGG + Intronic
1107599030 13:41993645-41993667 GCTGATGCACAGAGTTTTTGAGG + Intergenic
1108538529 13:51412521-51412543 GATGCAGCACAGAGGTGCTGAGG + Intronic
1110315332 13:74100093-74100115 GACCACGGACAGAGGGGTTGTGG + Intronic
1110605984 13:77433098-77433120 GATTTGGCTCAGAGGGGTTGAGG - Intergenic
1111888190 13:94049530-94049552 GATGATGCCTGGAGGGTTTGAGG - Intronic
1113402297 13:110005236-110005258 GATGAAGCTCAGAGAGGCTGTGG - Intergenic
1114669363 14:24400544-24400566 GCAGCTCCACAGAGGGGTTGAGG - Intronic
1114828307 14:26107259-26107281 GGTGATGTACAGATGGGTTTTGG - Intergenic
1117611103 14:57484334-57484356 GAAGATGAAGAGAGAGGTTGGGG + Intronic
1117823422 14:59675137-59675159 TATGGTGCACAGAGGAGTGGTGG + Intronic
1118675480 14:68180227-68180249 GATGGAGCACAGATGGTTTGGGG + Intronic
1119208649 14:72812997-72813019 GCTGATGCCCAGAGGCGATGCGG - Intronic
1121000998 14:90451981-90452003 GATGAGGCACAGGGAGGTTAAGG - Intergenic
1121487725 14:94331395-94331417 GATGAGGCCAAGAGGGGTTTGGG - Intergenic
1122019701 14:98827504-98827526 GATGATGGAGAGAGGGGTCAGGG + Intergenic
1123184583 14:106504743-106504765 GATGGTGCCCAGGGAGGTTGAGG - Intergenic
1124513319 15:30346361-30346383 GGTGATGTACAGATGGGTTTTGG + Intergenic
1124729604 15:32184404-32184426 GGTGATGTACAGATGGGTTTTGG - Intergenic
1126202538 15:46003386-46003408 GACCATGCAGAGAGGAGTTGAGG + Intergenic
1126341413 15:47645155-47645177 GATGATCCACAGAGGGATAAAGG + Intronic
1127152630 15:56093922-56093944 GATGATGCAGTGAGAGGTTTGGG - Exonic
1128596063 15:68950791-68950813 GATGAAACACAGAGGGTTTTAGG - Intronic
1129090399 15:73143588-73143610 GATGATGGACAGCAGGGATGAGG - Intronic
1130293681 15:82626968-82626990 TATGATACACAGAAAGGTTGGGG - Intronic
1131073631 15:89481118-89481140 GCTGAGGCTCAGAGGGGTTAAGG - Intronic
1131553124 15:93374877-93374899 TATGATACACAGGGGGTTTGCGG - Intergenic
1132870465 16:2113501-2113523 ACTGAGGCACAGAGAGGTTGAGG - Intronic
1134511103 16:14847387-14847409 ACTGAGGCACAGAGGGGTTAAGG - Intronic
1134522077 16:14923424-14923446 ACTGAGGCACAGAGAGGTTGAGG + Intronic
1134698745 16:16245883-16245905 ACTGAGGCACAGAGGGGTTAAGG - Intronic
1134709746 16:16322075-16322097 ACTGAGGCACAGAGAGGTTGAGG + Intergenic
1134716959 16:16362105-16362127 ACTGAGGCACAGAGAGGTTGAGG + Intergenic
1134949857 16:18346570-18346592 ACTGAGGCACAGAGAGGTTGAGG - Intergenic
1134957792 16:18390054-18390076 ACTGAGGCACAGAGAGGTTGAGG - Intergenic
1134973089 16:18548790-18548812 ACTGAGGCACAGAGGGGTTAAGG + Intronic
1136999344 16:35215921-35215943 GAAGATGGACAGAGGGGTTAAGG + Intergenic
1137003606 16:35252085-35252107 GCAGATGGACAGAGGGGTTAAGG - Intergenic
1137374306 16:47939659-47939681 GCTGTTGCCCAAAGGGGTTGGGG + Intergenic
1137523230 16:49211435-49211457 GATGATGTACAGACTGGCTGTGG + Intergenic
1141565411 16:84898371-84898393 GAAGATGCACAGAGAGGGTGGGG - Intronic
1142124039 16:88401419-88401441 GATGATGGACAGATGGATAGAGG + Intergenic
1142575033 17:901247-901269 GTTGAGGCTCAGAGGGGTTTTGG - Intronic
1143447377 17:7017454-7017476 GATGAAGGTCAAAGGGGTTGGGG - Intronic
1143540813 17:7567682-7567704 GCTGAGGAACAGAGGGCTTGTGG + Intronic
1143956074 17:10670264-10670286 GATGATGCCTGCAGGGGTTGTGG - Intergenic
1146531308 17:33609849-33609871 GAGGAAGGAGAGAGGGGTTGAGG + Intronic
1147311497 17:39598529-39598551 GAGGGGGCACAGAGGGGTTTGGG + Intergenic
1147603963 17:41763509-41763531 AATGAGGCTCAGAGAGGTTGGGG + Intronic
1151153893 17:72111067-72111089 GGTGATGCACTGAGGGGTCATGG - Intergenic
1151178571 17:72309363-72309385 AATGTTGAATAGAGGGGTTGGGG + Intergenic
1151930648 17:77229671-77229693 ACTGAGGCTCAGAGGGGTTGGGG + Intergenic
1152539683 17:80968679-80968701 GGAGATGCTCAGTGGGGTTGGGG + Intergenic
1152996676 18:413865-413887 AATTATGCTCAGTGGGGTTGGGG + Intronic
1156376726 18:36521416-36521438 GATGATGAACAGAGCTGTGGAGG - Intronic
1156847788 18:41688932-41688954 GATGATGCAAATGGGGATTGAGG + Intergenic
1157301080 18:46479853-46479875 GATGATGCCCAGGGTTGTTGTGG - Intronic
1159701625 18:71636715-71636737 CAAGATGCACAAAGTGGTTGGGG - Intergenic
1159802638 18:72920037-72920059 CATGCTGCACTGACGGGTTGGGG + Intergenic
1160897975 19:1411716-1411738 ACTGAGGCACAGAGGAGTTGAGG + Intronic
1161713797 19:5864376-5864398 GCTGATGCCCAGAGAAGTTGAGG - Intergenic
1162628585 19:11906657-11906679 GGTGATGTACAGATGGGTTTTGG - Intronic
1163630880 19:18417494-18417516 AATGAGGCACAGAGAGGGTGTGG - Intergenic
1163675323 19:18652919-18652941 GTTGAGGCACAGAGAGGTTCAGG + Intronic
1164340738 19:24394886-24394908 GGTGATGTACAGATGGGTTTTGG - Intergenic
1164671827 19:30076728-30076750 GATGTTGCACAGTGGGTCTGTGG + Intergenic
1165388718 19:35526600-35526622 GATGGGGGACAGGGGGGTTGGGG - Intronic
1167390193 19:49189883-49189905 CATGAGGCACAGAGAGGTTAAGG - Intronic
1167676326 19:50888196-50888218 GATGAAGGACAGAGTGCTTGTGG + Intergenic
1168295161 19:55374585-55374607 GGTGAGGGTCAGAGGGGTTGTGG - Intergenic
925606163 2:5662508-5662530 GATGGAGCACAGAAGGTTTGTGG - Intergenic
926583668 2:14661437-14661459 ATTGATGAACACAGGGGTTGGGG - Intergenic
926644608 2:15275661-15275683 GATGGTGTACAGAGAGCTTGGGG + Exonic
930023035 2:47012848-47012870 GATCAGCCACAGAGGGGATGGGG - Intronic
930731188 2:54729553-54729575 GCTGAGGCACAGAGAGGTTGAGG + Intronic
931272365 2:60714271-60714293 AATGAAGCACAGAGAGGTTAAGG - Intergenic
931799385 2:65743688-65743710 AATGAAGCTCAGAGAGGTTGAGG + Intergenic
931977491 2:67658664-67658686 GATGCTGCAGAGAAGGGTAGAGG - Intergenic
933983419 2:87572070-87572092 GAAGATGCAGAGACAGGTTGGGG - Intergenic
935938507 2:108213710-108213732 GGTGATGTACAGATGGGTTTTGG + Intergenic
936310429 2:111378724-111378746 GAAGATGCAGAGACAGGTTGGGG + Intergenic
936444499 2:112585345-112585367 GATCATGCACAGAAGACTTGGGG - Intronic
937214999 2:120306891-120306913 AATGATGCTCAGAGAGATTGAGG - Intergenic
937880106 2:126858437-126858459 GCTGAAGCACAGAGGTGCTGGGG + Intergenic
939924261 2:148154096-148154118 GGTGATGTACAGATGGGTTTTGG + Intronic
940262211 2:151792833-151792855 GAAGATGCCCAGAGTGGTGGTGG + Intronic
940388500 2:153103220-153103242 GATGCAGCACAGAAAGGTTGAGG - Intergenic
942734259 2:179092559-179092581 GGTGATGTACAGATGGGTTTTGG + Intergenic
944480966 2:200157610-200157632 GTTGATGCAGAGTGGTGTTGGGG + Intergenic
944934290 2:204551584-204551606 GATTATACACAGAGGGTGTGTGG - Intronic
944986491 2:205183350-205183372 GAAGATGGACTGAGAGGTTGAGG + Intronic
945669533 2:212786097-212786119 GGTGATGTACAGATGGGTTTTGG - Intergenic
948132139 2:235608590-235608612 GATGATGCCCAGAGTGTCTGGGG + Intronic
948778248 2:240301150-240301172 GATGATGCAGAGATGGGAAGAGG - Intergenic
1168972603 20:1941193-1941215 GATGATCCCCAGTGGGCTTGTGG - Intergenic
1170864646 20:20142593-20142615 GATGCTGCCCAGGGGAGTTGTGG - Intronic
1171389250 20:24790608-24790630 GATGGTTCTCAGAGGGGTTCTGG - Intergenic
1171724261 20:28602162-28602184 GATGAATCACACAGTGGTTGAGG - Intergenic
1171753794 20:29080875-29080897 GATGAATCACACAGTGGTTGAGG + Intergenic
1171788452 20:29496655-29496677 GATGAATCACACAGTGGTTGAGG - Intergenic
1171859102 20:30377858-30377880 GATGAATCACACAGTGGTTGAGG + Intronic
1171965069 20:31523714-31523736 GGAGATGCTCAGAGGGGATGAGG + Intronic
1172441885 20:34971690-34971712 GAGGATGCACTGAAGGGGTGAGG - Intergenic
1173939950 20:46902115-46902137 GGGGAAGCACAGAGAGGTTGGGG + Intronic
1174138538 20:48397330-48397352 GCTGAGGCACCCAGGGGTTGTGG + Intergenic
1174536431 20:51254903-51254925 GATGAGGCACTGAAGGGTTTGGG - Intergenic
1175904899 20:62374948-62374970 GCTCATGCACAGAGAGGTGGGGG + Intergenic
1176186838 20:63784868-63784890 GATGATGCACAGAGGGGTTGGGG + Intronic
1177245852 21:18522142-18522164 GATGATGTACAGTGGGAGTGAGG + Intergenic
1177925419 21:27208355-27208377 GATGATGCGCAGGGGGGTTATGG - Intergenic
1178775901 21:35550417-35550439 GATGCTGCCCAGAGGTGATGTGG - Intronic
1180297811 22:10960836-10960858 GATGAATCACACAGTGGTTGAGG - Intergenic
1180410609 22:12602952-12602974 GATGAATCACACAGTGGTTGAGG + Intergenic
1181151737 22:20888716-20888738 GGTGATTCCCAGAGGGGTGGAGG - Exonic
1181170814 22:21008865-21008887 CATGTTGTACAGAGGGGATGTGG - Intergenic
1181380379 22:22497569-22497591 AATGATGTAAAGAGGGGTTGTGG + Intronic
1181759581 22:25048983-25049005 GTTGAGGCTCAGAGAGGTTGAGG + Intronic
1182099203 22:27646008-27646030 CATGAAACACAGAGGTGTTGGGG + Intergenic
1182150257 22:28022531-28022553 GCTGCAGCCCAGAGGGGTTGAGG - Intronic
1182813015 22:33133821-33133843 GATGCTGGAGAGAGAGGTTGTGG - Intergenic
1183649648 22:39146445-39146467 AGTGAGGCACAGAGAGGTTGAGG + Intronic
1184514109 22:44950694-44950716 TATTATGCAAAGAGGGCTTGGGG + Intronic
1185275965 22:49950353-49950375 GGGGAAGCACAGAGGGGTGGGGG + Intergenic
950185920 3:10945438-10945460 GATGATGGAGAGAGGGGCAGAGG + Intergenic
954678080 3:52326590-52326612 GATGAGTCTCAGAGGGGTGGAGG + Intronic
955341662 3:58129948-58129970 GATGAAGCACAGAGGAGTCGAGG - Intronic
955853574 3:63248062-63248084 GGTGATGCACAGAGGGGCCTTGG + Intronic
956437878 3:69252080-69252102 GATGATGCAAAGGTGGGTCGTGG - Intronic
956788581 3:72662747-72662769 GATCATGTACAGCCGGGTTGGGG - Intergenic
956924541 3:73969797-73969819 GATGATTCACAGAGTGGTTAAGG - Intergenic
959843823 3:111009600-111009622 GCTTATGAACACAGGGGTTGGGG + Intergenic
960172750 3:114481879-114481901 GATGATGCAAAGAACGGTGGGGG + Intronic
960753090 3:120978701-120978723 GGTGATGTACAGATGGGTTTTGG + Intronic
961560094 3:127722748-127722770 ACTGAGGCACAGAGTGGTTGAGG + Intronic
966239852 3:177744166-177744188 GAGGAAGCACAGAGCGTTTGGGG + Intergenic
967817107 3:193808891-193808913 CAAGATACACAGAGGGGTTTAGG - Intergenic
968286895 3:197514090-197514112 GATGGTGGGCAGAGGGGCTGTGG - Intronic
968762978 4:2451845-2451867 GATGATGGACACAGGGTTGGTGG + Intronic
969563542 4:7964524-7964546 GCTGATACACAGAGGGCATGAGG + Intergenic
970697223 4:18692193-18692215 GATGATGGACAGAGCAGATGAGG + Intergenic
971119852 4:23691105-23691127 GATGATGAAGAGAGGGGATTGGG + Intergenic
971485391 4:27154991-27155013 AATGTTCGACAGAGGGGTTGTGG - Intergenic
979466858 4:121049418-121049440 GATGATGCAAAGAGGGCCAGCGG - Intronic
980789980 4:137608025-137608047 AATGATGCACTCTGGGGTTGGGG + Intergenic
980879780 4:138698197-138698219 GAAGGGGGACAGAGGGGTTGCGG - Intergenic
981028459 4:140099995-140100017 GAGGCTGAACAGATGGGTTGGGG - Intronic
982691165 4:158549607-158549629 GGTGATGTACAGAGGGTTTTTGG + Intronic
983101675 4:163633081-163633103 GGTGATGTACAGATGGGTTTTGG - Intronic
983694336 4:170510251-170510273 GGTGACGTACAGAGGGGTTTTGG + Intergenic
985126345 4:186698627-186698649 GGCGAGGCACAGAGGGGTAGAGG + Intronic
985437227 4:189941494-189941516 GATGAATCACACAGTGGTTGAGG + Intronic
986374258 5:7114230-7114252 GATGAAGCACAGGAGGGTCGAGG - Intergenic
986691118 5:10314760-10314782 GATGAGGCACAGCGGGGTTGGGG - Intergenic
986711691 5:10492621-10492643 GAAGATGAACAGAGGGGCGGTGG + Intergenic
988495445 5:31741754-31741776 GAGTATGCACGGGGGGGTTGGGG - Intronic
989086236 5:37679388-37679410 GGTGATGTACAGATGGGTTTTGG + Intronic
989205708 5:38807177-38807199 GATGATGACCAGAGGGTTGGGGG - Intergenic
989949552 5:50281066-50281088 GGTGATGTACAGATGGGTTTTGG - Intergenic
990333197 5:54747513-54747535 GATGCTGCTGGGAGGGGTTGGGG - Intergenic
990843020 5:60104848-60104870 GGTGATGTACAGATGGGTTTTGG - Intronic
991451085 5:66751131-66751153 GGTGATGTACAGATGGGTTTTGG - Intronic
992664601 5:78994872-78994894 CATGAAGCACAGAGGTGGTGGGG - Intergenic
993806839 5:92420915-92420937 TATGATGAAGAGAGGTGTTGTGG + Intergenic
994424154 5:99562901-99562923 GGTGATGTACAGATGGGTTTTGG + Intergenic
995768496 5:115644886-115644908 GATGAGGCAGCTAGGGGTTGCGG - Intergenic
997420527 5:133763493-133763515 GAGGAGGCTCAGAGGGGCTGTGG - Intergenic
998074123 5:139222362-139222384 GATGCTGCTCTGAGGGTTTGAGG + Intronic
999691260 5:154147833-154147855 TATGATGCACAGAGGGTTCCAGG - Intronic
999712353 5:154329759-154329781 GATGAAGCACAGAGGGTGGGAGG - Intronic
1001533517 5:172481812-172481834 AAAGAGGCACAGAGAGGTTGAGG + Intergenic
1001563070 5:172682849-172682871 ACTGAGGCACAGAGGGGTTGGGG - Intronic
1001908345 5:175492579-175492601 AAAAATGCACGGAGGGGTTGTGG - Intronic
1002110120 5:176903083-176903105 GATGTTGCACTGAGGGGTGGAGG - Intergenic
1002902664 6:1423084-1423106 GCAGAGGCACAGAGGGGCTGTGG + Intergenic
1003078975 6:3005836-3005858 GTTGAGGCACAGAGGGGTGGAGG + Intronic
1003273947 6:4632408-4632430 GTTGAAGCTCAGAGAGGTTGGGG - Intergenic
1003491686 6:6627809-6627831 ACTGAAGCACAGAGGGGTTTAGG + Intronic
1004555954 6:16698089-16698111 GATCATGCACAGAGGTGACGGGG + Intronic
1005364657 6:25064843-25064865 GATGATGGATGGAGGGGCTGTGG - Intergenic
1006315531 6:33289240-33289262 GATGAAGGACAGAGGGCTTCCGG - Exonic
1006432804 6:34008133-34008155 GAAGCAGCACAGAGGGATTGGGG - Intergenic
1007748076 6:44055379-44055401 ACTGAGGCACAGAGGGATTGAGG - Intergenic
1007786528 6:44283266-44283288 GAGGATGCAGTGAGGGGCTGAGG - Intronic
1007906318 6:45464872-45464894 CTTGATGCACAGTGGGATTGTGG + Intronic
1008258703 6:49337556-49337578 GATGATGACTAGAAGGGTTGAGG - Intergenic
1011290501 6:85772173-85772195 AATAAGGCTCAGAGGGGTTGGGG + Intergenic
1011754263 6:90483092-90483114 GATAGTGCACAGTGGGGGTGGGG + Intergenic
1012089452 6:94873439-94873461 GGTGATGTACAGATGGGTTTTGG + Intergenic
1012654044 6:101793364-101793386 GGTGATGTACAGATGGGTTTTGG + Intronic
1013394428 6:109720644-109720666 GATCATGCACACAGATGTTGTGG + Intronic
1013608266 6:111770969-111770991 CCTGAAGCACAGAGAGGTTGAGG - Intronic
1018839649 6:167508405-167508427 GATGAGGAAGAGAGGGGATGGGG - Intergenic
1020359901 7:7316624-7316646 GATGGGGAACAGAGGGGGTGAGG + Intergenic
1022088869 7:27095107-27095129 GAGGGTGCCCAGAGGTGTTGGGG - Intronic
1022411964 7:30145938-30145960 GATGATGAACAGAGCAGGTGAGG + Intronic
1023229645 7:38013198-38013220 GATGAAGCACAGATGATTTGGGG - Intronic
1023940754 7:44767207-44767229 GCTGATGCACAGAGGGAGTGTGG + Intronic
1023965374 7:44961180-44961202 GCTGAGGCGCTGAGGGGTTGAGG + Intergenic
1026491019 7:70863559-70863581 TATGATGCACAGAGAGCTGGTGG + Intergenic
1027165861 7:75833893-75833915 GCTGATTCCAAGAGGGGTTGGGG + Intergenic
1029310469 7:99659233-99659255 GGTGATGTACAGATGGGTTTTGG + Intronic
1029794135 7:102875906-102875928 GATGATGCAAAGAAAGGTAGAGG + Intronic
1030199595 7:106889179-106889201 GAGTAAGCAGAGAGGGGTTGGGG - Intronic
1032683459 7:134208946-134208968 GCTGATGAACTGAGGTGTTGAGG - Intronic
1033240586 7:139676172-139676194 GATGCAGCAGAGAGGAGTTGCGG - Intronic
1035496364 7:159330649-159330671 GATGAGGCACAGAAGAGTGGTGG - Intergenic
1035791183 8:2307122-2307144 GGTGATGTACAGATGGGTTTTGG + Intergenic
1035801622 8:2414583-2414605 GGTGATGTACAGATGGGTTTTGG - Intergenic
1036660721 8:10706760-10706782 GGTGACTCACAGAGGGGTTGGGG - Intronic
1038438357 8:27554558-27554580 GGTGATGAACAGATGGGTTTTGG + Intergenic
1043420270 8:80090430-80090452 GAGGAAGCACAGTGGGGATGGGG + Intronic
1048445467 8:134489657-134489679 GATGATGGAAGGAGGGGATGTGG - Intronic
1048614485 8:136058926-136058948 GGTGAGGCACAGTGGGGGTGGGG - Intergenic
1049289109 8:141792136-141792158 GTAGATGCAGAGAGGGTTTGAGG - Intergenic
1049395266 8:142397307-142397329 CAAGGTGCACAGAGGGGCTGTGG - Intronic
1051929262 9:22365621-22365643 GATAAGGCCAAGAGGGGTTGTGG + Intergenic
1052484274 9:29076001-29076023 GGTGGTGCACAGAGAGGCTGTGG - Intergenic
1052503889 9:29328156-29328178 GATGATGCACACCGAGATTGAGG - Intergenic
1053388174 9:37711868-37711890 GATGATGCACAGGGAGGAAGCGG + Intronic
1053725338 9:40992908-40992930 GATGAATCACACAGTGGTTGAGG + Intergenic
1054340601 9:63858970-63858992 GATGAATCACACAGTGGTTGAGG - Intergenic
1055307490 9:74944662-74944684 AATGATGCACAGAGGTGTATTGG - Intergenic
1057283085 9:93726753-93726775 TATGATTCACAGAGGGCCTGAGG - Intergenic
1057306665 9:93916436-93916458 GGTGAGGCACAGTGAGGTTGGGG - Intergenic
1061630393 9:131868629-131868651 GAAGATGCACATAGTGGGTGAGG + Intronic
1061656640 9:132096942-132096964 GCTGGTGAGCAGAGGGGTTGAGG - Intergenic
1203773655 EBV:61440-61462 GAAGATGCGCAGAGGGGTTACGG + Intergenic
1185623442 X:1466972-1466994 GATGATCCACAGTGGGGCTGTGG + Intronic
1185654171 X:1670804-1670826 GAGGATACACAGAGGAGTTTAGG - Intergenic
1186581198 X:10820786-10820808 AATGATGCTCAGAGTGGTCGGGG - Intronic
1187147807 X:16653826-16653848 GCTGGTTAACAGAGGGGTTGGGG - Intronic
1197568936 X:128125184-128125206 GATGATGCACAGAAAGCTTTTGG + Intergenic
1198523122 X:137472804-137472826 GCTGAGGCTCAGAGAGGTTGTGG - Intergenic
1198553432 X:137768472-137768494 GGTGATGTACAGATGGGTTTTGG + Intergenic
1198615760 X:138456812-138456834 GGTGATGTACAGATGGGTTTTGG - Intergenic
1198767404 X:140093187-140093209 GATGCTGCAAAGAGGTGCTGTGG + Intergenic
1198834488 X:140788158-140788180 GATGATGGTCACTGGGGTTGAGG + Intergenic