ID: 1176187194

View in Genome Browser
Species Human (GRCh38)
Location 20:63787238-63787260
Sequence CTGTCACGCCACCAGGTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 83}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176187194 Original CRISPR CTGTCACGCCACCAGGTGAC AGG (reversed) Intronic
900596892 1:3484034-3484056 CTCTCACGCCACCTGGTGTCTGG + Intergenic
900968552 1:5976391-5976413 CTGTCACAACACCAGGTTTCGGG + Intronic
906784138 1:48599441-48599463 CTGTGATGTCACCAGGTGACAGG + Intronic
907571674 1:55489749-55489771 CTGTGGATCCACCAGGTGACTGG - Intergenic
915462487 1:156078440-156078462 CTGTCTTGCCCCCAGGGGACAGG - Intronic
918043170 1:180925649-180925671 CTGTCCCTCCACCAGGAAACTGG + Intronic
920306060 1:205018855-205018877 CTGCCACACCACCTGGTGACTGG + Exonic
924330110 1:242932927-242932949 CTGTGACGCCACCATCAGACTGG + Intergenic
1067112312 10:43409082-43409104 CTGTCACGCCGGCAGGTAGCAGG - Intronic
1069637922 10:69936987-69937009 CTGTCACCCCACAAAGGGACAGG + Intronic
1071546686 10:86535149-86535171 CTCTCACCCCACCAGGTGAGTGG + Intergenic
1071971454 10:90911851-90911873 CTGACAAGCTCCCAGGTGACAGG - Intergenic
1072620428 10:97075684-97075706 CTGCCAATCCACCAGGTGCCAGG - Intronic
1080648357 11:34203573-34203595 CTGTAATGTCACCAGGAGACAGG + Intronic
1083297019 11:61720355-61720377 CTGTCATGCCCCCAGCTGCCCGG + Intronic
1083305340 11:61759159-61759181 CAGGCAGGCCACCAGGTGCCAGG - Intronic
1083816584 11:65135738-65135760 CTGTCAAGTCAACAGGTGGCAGG - Intergenic
1083897665 11:65628250-65628272 AGGTCACGCCACTAGGTCACTGG - Intronic
1086890473 11:92252678-92252700 CTTTCACACCAGCAAGTGACTGG - Intergenic
1092446532 12:8562615-8562637 CAGTCACGCCCCCAGGGGAAGGG + Intergenic
1103904989 12:124322558-124322580 CTGACACCCCACCTGGTGCCCGG - Intergenic
1113768845 13:112895973-112895995 CTGTCAGGCCCCCAGGGGAGGGG - Intronic
1122108918 14:99481360-99481382 CTGAGACGCCACCAAGCGACCGG - Intronic
1124484244 15:30101424-30101446 CTATCATGCCACCAGGACACCGG + Intergenic
1124519338 15:30395800-30395822 CTATCATGCCACCAGGACACCGG - Intergenic
1124539317 15:30570421-30570443 CTATCATGCCACCAGGACACCGG + Intergenic
1124759333 15:32437151-32437173 CTATCATGCCACCAGGACACCGG - Intergenic
1128772250 15:70291219-70291241 CTGTCACATCAGTAGGTGACTGG + Intergenic
1129231450 15:74199305-74199327 CTGCCTCTCCACCAAGTGACTGG - Intronic
1130574305 15:85077617-85077639 GAGTCAATCCACCAGGTGACAGG + Intronic
1134164145 16:11916264-11916286 CTGCCCCCCCACCAGGTGACAGG - Intergenic
1134228651 16:12412047-12412069 CTGTCTCCCCACCAGGTGCCAGG - Intronic
1136022517 16:27449067-27449089 CTGAGACCCCTCCAGGTGACCGG - Exonic
1137274144 16:46922488-46922510 CTGTCTGGCCACCTGGAGACAGG - Intronic
1138445092 16:57058599-57058621 CTGTCACTCCAGCAGGTCACGGG - Intronic
1141642650 16:85350243-85350265 TAGTCACGCCAGCAGGTGAGTGG + Intergenic
1148196106 17:45714466-45714488 CTGTCACAGCACCAGCTGGCAGG + Intergenic
1151603291 17:75119851-75119873 CTGCCCAGCCACCAGGTGCCAGG + Intronic
1156346004 18:36257711-36257733 CTCTCATGCCACAGGGTGACTGG + Intronic
1157495485 18:48154158-48154180 CTGTCAGGACCCCAGGTGACAGG - Intronic
1157745335 18:50130117-50130139 CAGGCAGGCCACCAGGAGACTGG + Intronic
1162524256 19:11197971-11197993 CGGTCACGCCACCGTGTGCCAGG - Intergenic
1163850082 19:19657716-19657738 GTGTCACTCGACCAGATGACGGG - Intronic
1166849729 19:45753732-45753754 CTGGCACGCCCCCTGGAGACAGG - Exonic
932593098 2:73078873-73078895 CTGTGACCTCACCAGGTGGCTGG - Intronic
933708803 2:85310206-85310228 CTGGCACGGACCCAGGTGACAGG - Exonic
947616846 2:231563379-231563401 CTGTCATGCCACAAGGTGTCCGG - Intergenic
1170201254 20:13746590-13746612 ATGTCAAGCCACCAGTTTACAGG - Intronic
1171325765 20:24291118-24291140 CAGTCACACCACCACATGACCGG - Intergenic
1173244217 20:41323920-41323942 CTATAAGGCCACTAGGTGACAGG + Intergenic
1174149794 20:48478016-48478038 CTGTCAGCCCACAAGGTGCCAGG - Intergenic
1174425290 20:50427845-50427867 CAGGCACCCCACCATGTGACAGG + Intergenic
1175301315 20:57945187-57945209 CTGTGATGTCACCAGGTTACAGG + Intergenic
1175489436 20:59369623-59369645 CTGTTATGCCCCCAGATGACTGG + Intergenic
1175916375 20:62427881-62427903 CTGTCTCGCCACCTCGGGACAGG + Intergenic
1176187194 20:63787238-63787260 CTGTCACGCCACCAGGTGACAGG - Intronic
1176201430 20:63862539-63862561 CCTCCACGTCACCAGGTGACAGG - Exonic
1184803835 22:46779246-46779268 CTGTGACATCACTAGGTGACAGG + Intronic
956737319 3:72247727-72247749 CTGTCTCCCCACCAGCTGTCAGG + Intergenic
959572662 3:107901140-107901162 CTTTCATGCTACCAGTTGACTGG - Intergenic
966161582 3:176974361-176974383 CTGTGATGTCACTAGGTGACAGG + Intergenic
969504636 4:7577267-7577289 CTGTCTCCCCACCAGGGAACTGG - Intronic
970821543 4:20221261-20221283 CTGTGAGGCCACCAGGTCCCAGG + Intergenic
974078958 4:57193605-57193627 CTGGCATCCCACCAGGTCACGGG - Intergenic
985923836 5:3000408-3000430 ATCTCCTGCCACCAGGTGACCGG + Intergenic
988822212 5:34898455-34898477 CTGTCGCACCACAAGGTGGCAGG - Intronic
996488470 5:124064771-124064793 GTGTCACTCCACCAGGTAAAGGG - Intergenic
999265059 5:150261435-150261457 CAGTCACTCCACCAGGAGACAGG - Intronic
999702435 5:154240176-154240198 CTGTCACCCCACCAGATGGCAGG - Intronic
1004441601 6:15660452-15660474 TTGTTTCTCCACCAGGTGACAGG + Intronic
1009232642 6:61082504-61082526 TTCTCAAGCCACTAGGTGACAGG - Intergenic
1012860305 6:104551543-104551565 CTTCCACCCCACCAGGTGACAGG + Intergenic
1015240923 6:131022328-131022350 GTGTCACGTTACCATGTGACAGG - Intronic
1019589449 7:1823526-1823548 CAGTCACCCCTCCAGGTGCCAGG - Intronic
1019711973 7:2521941-2521963 GGGTCACCCCACCAGGGGACAGG + Intronic
1022520808 7:31005795-31005817 CTCTCACGCTGCCTGGTGACTGG + Intergenic
1026590146 7:71687348-71687370 CCGTCACGCCAGCAGGGCACGGG - Intronic
1035304170 7:157919860-157919882 CTGTGACGTCGCAAGGTGACAGG - Intronic
1036630308 8:10509008-10509030 CTACCACGTCACCAGGGGACAGG + Intergenic
1038628165 8:29214823-29214845 CTGTGATGCCACTAAGTGACAGG + Intronic
1041994199 8:64033508-64033530 CTATGATGTCACCAGGTGACAGG - Intergenic
1044739895 8:95315412-95315434 CTGTCAGGCAGGCAGGTGACTGG + Intergenic
1049783004 8:144437325-144437347 CTGTCTCCCCACAAGGGGACCGG - Intronic
1052742625 9:32408168-32408190 TTGTCAAGCCACCATGTGAATGG + Intronic
1055288736 9:74760065-74760087 CTGTAATGTCACTAGGTGACAGG - Intronic
1058428899 9:104900667-104900689 CTGTAGGGCCACCAGGAGACTGG + Intronic
1060372306 9:123086018-123086040 CTGTCTTCCCACCAGGAGACAGG - Intronic
1061466924 9:130787791-130787813 CTGCCATGTCAACAGGTGACGGG - Intronic
1061596759 9:131635583-131635605 CTCTCACGCCACCAGGGCATGGG + Intronic
1062156838 9:135053972-135053994 CTGTCATGCCAGTAGTTGACAGG - Intergenic
1062198982 9:135290779-135290801 CTGTCACCCCACCCGGTCCCCGG - Intergenic
1062553117 9:137099433-137099455 CTGTCACCCGACCACCTGACTGG - Intronic
1188617232 X:32173167-32173189 TTGTCACGTCAACAGGTCACAGG - Intronic
1190651752 X:52574849-52574871 CTTTCACGCCACCTAGTGACCGG - Intergenic
1202263149 Y:22990773-22990795 TTGTCACGCCCCTAGGTGATGGG - Intronic
1202416139 Y:24624514-24624536 TTGTCACGCCCCTAGGTGATGGG - Intronic
1202454648 Y:25045572-25045594 TTGTCACGCCCCTAGGTGATGGG + Intronic