ID: 1176187744

View in Genome Browser
Species Human (GRCh38)
Location 20:63790550-63790572
Sequence GGTGCAGAAGACGTCGGAGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 112}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176187744_1176187748 4 Left 1176187744 20:63790550-63790572 CCTGCTCCGACGTCTTCTGCACC 0: 1
1: 0
2: 0
3: 5
4: 112
Right 1176187748 20:63790577-63790599 AGTAGAGCGTCTTGAAGTAGCGG 0: 1
1: 0
2: 0
3: 8
4: 78
1176187744_1176187749 19 Left 1176187744 20:63790550-63790572 CCTGCTCCGACGTCTTCTGCACC 0: 1
1: 0
2: 0
3: 5
4: 112
Right 1176187749 20:63790592-63790614 AGTAGCGGCTGCTGCCCAGCAGG 0: 1
1: 0
2: 0
3: 23
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176187744 Original CRISPR GGTGCAGAAGACGTCGGAGC AGG (reversed) Exonic
900642754 1:3695220-3695242 AGCGCTGGAGACGTCGGAGCTGG + Intronic
900827334 1:4937237-4937259 GGGGCAGAAGAGGCGGGAGCTGG + Intergenic
903072154 1:20731891-20731913 AGGGCAGATGACGACGGAGCGGG + Intronic
903672322 1:25043811-25043833 GATGCAGGAGGAGTCGGAGCTGG - Intergenic
905168570 1:36097637-36097659 GGTGCAGATGCCGTCGGACCAGG - Exonic
905410345 1:37764298-37764320 GGTGCAGAATCCGGAGGAGCTGG - Intronic
912771101 1:112464962-112464984 GGTGCGGAAGGCGTCGGAGGAGG - Intergenic
1064376563 10:14801853-14801875 GGTGCAGAAGGCCAGGGAGCAGG - Intergenic
1069065666 10:63939265-63939287 GGTGCTGGAGATGTCAGAGCTGG + Intergenic
1069607573 10:69749434-69749456 GGTGCAGGAGACGAGGGAGTGGG + Intergenic
1078534224 11:12160392-12160414 GGAGCAGAAGACAGAGGAGCAGG - Intronic
1079101245 11:17543681-17543703 GGTACTGAGGGCGTCGGAGCTGG - Intronic
1082810475 11:57476493-57476515 GGCGCAGGTCACGTCGGAGCTGG - Exonic
1083960432 11:66012185-66012207 GGTGCAGAAGGCGGCGCAGGCGG + Exonic
1084013589 11:66366092-66366114 GGTGGAGAAGACGGCAGGGCAGG - Intronic
1084872515 11:72107882-72107904 GTTGCAGAAGACATGGGAGATGG - Intronic
1089811728 11:121137760-121137782 GATGCAGGAGGCGTCGGTGCGGG - Exonic
1089814196 11:121158004-121158026 GGTGCGGAAGACGCCGCCGCCGG - Exonic
1091330752 11:134729331-134729353 GGTGCAGAGGACTGAGGAGCAGG + Intergenic
1098012657 12:66071244-66071266 GGTGCAAAAGATGTGGGAGTGGG + Intergenic
1099004466 12:77219455-77219477 GGAGCAGAAGAGTTCGGAGAGGG + Intergenic
1101782752 12:107850060-107850082 GGTGGAGAAGAAGGAGGAGCAGG - Intergenic
1112461232 13:99605640-99605662 GGTGGAGCAGGCGTGGGAGCTGG + Intergenic
1113795418 13:113054482-113054504 GATGAAGAAGACGTTAGAGCCGG - Intronic
1116276397 14:42839081-42839103 GGTGCACAAGACGCTGGAGGTGG + Intergenic
1122447799 14:101781914-101781936 GGCGCAGACGAGGTGGGAGCGGG - Intronic
1123468670 15:20534303-20534325 GGAGGAGAAGATGTGGGAGCAGG - Exonic
1123649444 15:22466759-22466781 GGAGGAGAAGATGTGGGAGCAGG + Exonic
1123681966 15:22770021-22770043 GGTGCAGAAGCAGGAGGAGCAGG - Intergenic
1123728989 15:23129514-23129536 GGAGGAGAAGATGTGGGAGCAGG - Exonic
1123747153 15:23326979-23327001 GGAGGAGAAGATGTGGGAGCAGG - Intergenic
1123761929 15:23440076-23440098 GGAGGAGAAGATGTGGGAGCAGG - Exonic
1123761947 15:23440214-23440236 GGAGCAGAAGATGTGGCAGCAGG - Exonic
1123761975 15:23440400-23440422 GGAGGAGAAGATGTGGGAGCAGG - Exonic
1123761979 15:23440421-23440443 GGAGGAGAAGATGTGGGAGCAGG - Exonic
1123761985 15:23440463-23440485 GGAGGAGAAGATGTGGGAGCAGG - Exonic
1123762015 15:23440628-23440650 GGAGAAGAAGACGCAGGAGCAGG - Exonic
1123762036 15:23440748-23440770 GGAGCAGAAGATGTGGGACCAGG - Exonic
1123762149 15:23441394-23441416 GGAGGAGAAGATGTGGGAGCAGG - Exonic
1124279479 15:28350694-28350716 GGAGGAGAAGATGTGGGAGCAGG - Intergenic
1124303219 15:28560914-28560936 GGAGGAGAAGATGTGGGAGCAGG + Intergenic
1126599828 15:50417612-50417634 GGTGGAGAAGATGTTGCAGCTGG - Intergenic
1131263668 15:90903133-90903155 GGGGCCGACGAAGTCGGAGCGGG + Exonic
1131282899 15:91034974-91034996 GATGCAGGAGATGTTGGAGCAGG - Intergenic
1132723453 16:1328007-1328029 GGTGCAGAAGCCTTTGGACCAGG - Intergenic
1133071094 16:3247198-3247220 GGTGCAGAGGAAGCTGGAGCAGG - Exonic
1136143915 16:28304341-28304363 GGTGCTGAAGACACTGGAGCTGG + Intronic
1136546581 16:30958171-30958193 GGTGCAGAACGCGCCGGGGCGGG + Intronic
1137868098 16:51922226-51922248 GGTGCAGAAGTAGTAGGAGATGG - Intergenic
1138416451 16:56874314-56874336 GGTGCAGGAGGCGCCAGAGCTGG + Intronic
1138478274 16:57284658-57284680 GCTGCAGGAGGCGTCGGGGCTGG + Exonic
1138527283 16:57616411-57616433 GGAGCACAAGATGTCAGAGCTGG + Intronic
1139930625 16:70523474-70523496 GGTGCAGCAGCCGTCTGAGGGGG - Exonic
1141832726 16:86518688-86518710 GCTGCAGAAGACGCCGGAAAAGG - Intergenic
1143291227 17:5830810-5830832 GGGGCAGAAGAAGGGGGAGCAGG - Intronic
1145250705 17:21295537-21295559 GCTGCTGCAGACGTCAGAGCTGG - Intronic
1145747802 17:27332987-27333009 TGTCCAGGAGACGCCGGAGCTGG - Intergenic
1147264362 17:39225840-39225862 GGCGCAGCGGACGGCGGAGCCGG - Exonic
1148452681 17:47790180-47790202 GGACCAGAAGACGCCGGAACTGG - Intergenic
1158882731 18:61796536-61796558 GGTGCATATGACGTCTGTGCTGG + Intergenic
1161484133 19:4525632-4525654 GCTGCAGGAGACGCTGGAGCTGG - Exonic
1163654829 19:18539583-18539605 GGTGCAGGAGGAGCCGGAGCTGG - Exonic
1168239431 19:55081820-55081842 GCTGCAGAAGTCGGCGGAGGCGG + Exonic
930937123 2:56967266-56967288 GGTGGAGCAGGCGTCAGAGCAGG + Intergenic
935545524 2:104396028-104396050 GGTGGAGAAGATGTTGCAGCTGG + Intergenic
937622304 2:124002679-124002701 GGTGGACAAGACGTCAGAGCTGG - Intergenic
947606358 2:231488556-231488578 GATGCTGGAGACGTCAGAGCAGG + Intergenic
948888118 2:240893909-240893931 GGTTCAGAAGATGCTGGAGCAGG + Intronic
1169130831 20:3165733-3165755 GCGGCAGAAGGCGTGGGAGCGGG - Intronic
1172037374 20:32019360-32019382 GTTGCAGTAGGCGTCGGGGCTGG - Exonic
1172210101 20:33191301-33191323 GGTGAAAAAGAAGTCAGAGCTGG - Intergenic
1172358183 20:34294124-34294146 GGTGGAGAAGATGTTGCAGCTGG + Exonic
1174342558 20:49906995-49907017 GAGGCAGAAGACGCAGGAGCTGG + Intronic
1176032805 20:63021827-63021849 GGTCCAGACGACGTGGGTGCAGG + Intergenic
1176094517 20:63333815-63333837 GGTGCAGATGGCATCGGGGCAGG - Intronic
1176187744 20:63790550-63790572 GGTGCAGAAGACGTCGGAGCAGG - Exonic
1179597412 21:42452131-42452153 TGTGCAGAGGACGCCTGAGCTGG - Intergenic
1180738233 22:18034689-18034711 AGGGTAGAAGACGACGGAGCAGG + Intergenic
1182360747 22:29745082-29745104 AGTGGAGAACAAGTCGGAGCTGG + Intronic
1183924584 22:41197084-41197106 GGTGCGGGAGAAGTCGGAGGAGG - Intergenic
1184515520 22:44959642-44959664 GCTGCAGAGGATGTCTGAGCTGG + Intronic
1184794517 22:46724051-46724073 GGTGGAGAAGACGGAGGAGGTGG - Intronic
1185129010 22:49027016-49027038 TGTGCAGGAGACGTCTGGGCTGG - Intergenic
1185173134 22:49305013-49305035 GGGGCAGAAGACATGAGAGCTGG - Intergenic
1185326587 22:50228629-50228651 GGTGGAGAAGGGGTCAGAGCAGG - Intronic
1185399199 22:50607249-50607271 GGTGCAGAGGACGCCTGAGTGGG + Intronic
952423102 3:33148846-33148868 GGTGCTGATGGCGTCTGAGCTGG + Intergenic
961013017 3:123448485-123448507 GGCGCAGAAGACTGCGGCGCCGG - Exonic
961611109 3:128140387-128140409 GCTGCTGAAAACGTGGGAGCAGG - Intronic
963052093 3:141151031-141151053 GTTACAGAAGAAGTGGGAGCAGG + Intergenic
988850239 5:35173431-35173453 GGTGCAGAGGAAGTCAAAGCAGG + Intronic
995509400 5:112893009-112893031 GGTGCCGAAGTCGTGGGAGGAGG + Exonic
1000117275 5:158165634-158165656 GGTGGATAAGAAGTCAGAGCAGG - Intergenic
1001639178 5:173233177-173233199 GCTGCAGAAGGCGGTGGAGCTGG - Exonic
1005434031 6:25788556-25788578 GGTGCAGAGGGTGTCTGAGCTGG + Intronic
1009667538 6:66703654-66703676 GGTGTAGATGAAGTGGGAGCAGG - Intergenic
1010451957 6:76013478-76013500 AGTACAGAAGATGTCTGAGCTGG - Intronic
1012399935 6:98834720-98834742 GCAACAGAAGGCGTCGGAGCGGG + Exonic
1015354313 6:132259159-132259181 GGTGCAGTGGAGGTGGGAGCTGG - Intergenic
1018393497 6:163359147-163359169 GGTGCAGATGAAGTCCAAGCTGG - Intergenic
1021038199 7:15827604-15827626 TGTTCAGAAGACTTGGGAGCTGG - Intergenic
1029610505 7:101624205-101624227 CATGGAGAAGACGTTGGAGCTGG + Exonic
1034469085 7:151246195-151246217 GGAGGAGCAGAAGTCGGAGCAGG - Intronic
1034997791 7:155589287-155589309 GATGCAGAGGGCGTGGGAGCGGG + Intergenic
1039447102 8:37641860-37641882 GGTGGAGGAGGCGTCGGATCAGG - Intergenic
1046893926 8:119452462-119452484 GGTGCAGAAAAAGTCAGAGGTGG + Intergenic
1049056006 8:140238154-140238176 GGTCCAGGAGACGTCGGTTCCGG + Intronic
1049192826 8:141298303-141298325 GGTGCGGAAAACGTCTGAGCAGG - Intronic
1055213404 9:73828402-73828424 GGAGAAGAAGACGACGGAGAAGG - Intergenic
1058110811 9:101029229-101029251 GGTGCAGATGAAGGCGGCGCTGG + Intronic
1059563998 9:115364675-115364697 GATGCAGAAGGCCTCGAAGCTGG + Intronic
1061063271 9:128261453-128261475 GATGCAGCAGATGTCAGAGCAGG - Exonic
1061779828 9:132989050-132989072 GGTGGAGAAGACCTGGGAGCAGG - Exonic
1062086270 9:134650576-134650598 GGTGCAGTAGAAGTGGGAGTAGG + Intronic
1062206956 9:135342702-135342724 GGGGCAGGAGAGGTGGGAGCTGG - Intergenic
1062418085 9:136463713-136463735 GCTGCAGCACACGTCTGAGCAGG - Exonic
1195967268 X:110439891-110439913 GGTGCAGAAGAATTTGGAACAGG + Intronic
1196424993 X:115561193-115561215 GGTGCAGAAGTTGTCTGAGTGGG + Exonic