ID: 1176193735

View in Genome Browser
Species Human (GRCh38)
Location 20:63826918-63826940
Sequence AAACCCTGCTTCCCGGAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 154}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176193735_1176193743 22 Left 1176193735 20:63826918-63826940 CCACTCTCCGGGAAGCAGGGTTT 0: 1
1: 0
2: 1
3: 17
4: 154
Right 1176193743 20:63826963-63826985 GACCGGATGACTGCCAGGTCTGG 0: 1
1: 0
2: 0
3: 5
4: 50
1176193735_1176193741 17 Left 1176193735 20:63826918-63826940 CCACTCTCCGGGAAGCAGGGTTT 0: 1
1: 0
2: 1
3: 17
4: 154
Right 1176193741 20:63826958-63826980 ACCAGGACCGGATGACTGCCAGG 0: 1
1: 0
2: 2
3: 7
4: 97
1176193735_1176193739 5 Left 1176193735 20:63826918-63826940 CCACTCTCCGGGAAGCAGGGTTT 0: 1
1: 0
2: 1
3: 17
4: 154
Right 1176193739 20:63826946-63826968 ATGACTCGCTCCACCAGGACCGG 0: 1
1: 0
2: 0
3: 8
4: 74
1176193735_1176193738 0 Left 1176193735 20:63826918-63826940 CCACTCTCCGGGAAGCAGGGTTT 0: 1
1: 0
2: 1
3: 17
4: 154
Right 1176193738 20:63826941-63826963 GGAATATGACTCGCTCCACCAGG 0: 1
1: 0
2: 0
3: 2
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176193735 Original CRISPR AAACCCTGCTTCCCGGAGAG TGG (reversed) Intronic
900691249 1:3981971-3981993 AAACGCTGCATCTGGGAGAGCGG + Intergenic
901134621 1:6984936-6984958 GGACCCTGCTTCCCAGAGAAAGG + Intronic
901383281 1:8889442-8889464 ACATCCTGCTTCCCTAAGAGGGG - Intergenic
902281388 1:15377289-15377311 AAACCCTACTTCCCTGAGGGTGG + Intronic
902492079 1:16790170-16790192 AGACCCTGCTTCCCAGAGGCAGG - Intronic
902832911 1:19029283-19029305 AAACCCGGCACCCCGGAGATGGG + Intergenic
905390110 1:37630742-37630764 AAACCCTGCTTCCCCGTCACGGG + Intronic
907824772 1:58004856-58004878 AAAGCCAGCTTCCTGAAGAGTGG + Intronic
908022667 1:59914680-59914702 ATACCCGGCTTCCAGGGGAGAGG - Intronic
909122292 1:71618456-71618478 AAACCCTGCTTCACAAAGACAGG - Intronic
911792356 1:102033614-102033636 AAACCCTGCTTCACAAAGATAGG - Intergenic
912507263 1:110164952-110164974 AAACCCTGCTGCAGGCAGAGTGG + Intronic
912787623 1:112619651-112619673 AAACCCTACTTCCTGGGGCGCGG + Exonic
915037768 1:152942996-152943018 AAAACCTGAGCCCCGGAGAGTGG + Intergenic
916337734 1:163692405-163692427 AGAGCCTGCTCCCCCGAGAGAGG - Intergenic
917482385 1:175423502-175423524 CAACCCTGCTTTCCAGAGTGGGG + Intronic
919091322 1:192981557-192981579 AAACCCTGCTTCACAAAGATAGG - Intergenic
919478009 1:198053622-198053644 AAACCCTGGTTCCCAGGGTGTGG - Intergenic
919838369 1:201592090-201592112 AAGCCCTGCTTCAGGAAGAGAGG - Intergenic
920789189 1:209072327-209072349 CAAACCTGCTTCCCTGAAAGAGG - Intergenic
922671797 1:227514180-227514202 AAACCCTGCTTCACAAAGACAGG + Intergenic
923528367 1:234792367-234792389 AGACCCTGCTTCCCAGAGGCAGG + Intergenic
1063594393 10:7420640-7420662 AAACCCTGCTTCCCAAAGATAGG - Intergenic
1067263189 10:44712608-44712630 AAACCATGCTTTCCAGACAGTGG - Intergenic
1067728261 10:48790009-48790031 AAACCCTGCTTCCCAAATAGCGG - Intronic
1069590813 10:69640796-69640818 AAACCCTGCTCCCCGGGGACAGG - Intergenic
1069755323 10:70771234-70771256 AAAACCGTCTTCCCTGAGAGAGG - Exonic
1071347625 10:84707597-84707619 AGACCCAGGTTCCAGGAGAGAGG + Intergenic
1074194065 10:111164865-111164887 AAGCTCTGCTCCCGGGAGAGAGG + Intergenic
1077804371 11:5575468-5575490 AATCCCTGCTCCCAGAAGAGAGG + Intronic
1079570121 11:21932646-21932668 AAACCCTGCTTCACAAAGATAGG - Intergenic
1080487594 11:32727397-32727419 AAGCTCTGCTTCCCAGAGGGAGG + Intronic
1081861143 11:46333937-46333959 AGACCCTGCTGCCCAGAGATGGG + Intronic
1084091184 11:66880251-66880273 AGACCCTGCTTCCTGGAGAGAGG - Intronic
1086993517 11:93330876-93330898 AAGCCCAGCCTCCCGCAGAGCGG - Intronic
1087642660 11:100771988-100772010 AATCCCTGCTTCTCAGAGCGTGG - Intronic
1091541360 12:1465692-1465714 AAGCCCCGCTTCCCCTAGAGAGG + Intronic
1091803496 12:3339953-3339975 ATTCCCTGTTTGCCGGAGAGCGG + Intergenic
1099230351 12:80016289-80016311 AAACTCTGATTCCCAGAGGGAGG + Intergenic
1108883167 13:55146371-55146393 AAACCCTGCTTCAGGGAGGAAGG + Intergenic
1111058869 13:82985647-82985669 AAAGCATGCTTGCAGGAGAGAGG + Intergenic
1112457436 13:99575448-99575470 TCGCCCTGCTTCCCGGTGAGTGG - Intergenic
1115221794 14:31065323-31065345 AAGAACTGCTTCCCGGAGAAGGG - Intronic
1116018672 14:39435457-39435479 AATCCCTGCTTTATGGAGAGAGG - Intergenic
1118526620 14:66651729-66651751 AAACCCTGCTTCACAAAGACAGG - Intronic
1119527899 14:75336969-75336991 AAACTCTACTTCCTGGAGAAGGG + Intergenic
1120149826 14:81020889-81020911 AAACCCTGCTTCACAAAGATAGG - Intronic
1120888320 14:89469374-89469396 CAACCCTGCTTCCTGGACTGAGG - Intronic
1121095502 14:91215575-91215597 AAAAGCTGCTTCCAGGCGAGCGG - Intronic
1122737116 14:103849136-103849158 AAACTCTGCTCCCAGAAGAGGGG - Intergenic
1125163080 15:36670016-36670038 AAACTCTGCCTTCTGGAGAGAGG + Intronic
1126412745 15:48388750-48388772 ACACCCTTCTTCCTGGAGAGTGG + Intergenic
1126945289 15:53812423-53812445 AATCCCTGCTTACCTGAGAGAGG + Intergenic
1131354622 15:91733974-91733996 ACACCCTGCTTCCAGTTGAGTGG - Intergenic
1131631752 15:94184559-94184581 AAACCCTGCTTCACAAAGACAGG + Intergenic
1133765021 16:8831930-8831952 AAACCCTGTTCCCTGGAGAAGGG - Intronic
1135815276 16:25626971-25626993 AAACCCTTCTGCCCCGAGATGGG + Intergenic
1136088474 16:27902283-27902305 AAAAACTGCTTCCAGGAGAAGGG + Intronic
1138425540 16:56929768-56929790 AAACCCTGCTTCACAGAGATGGG + Intergenic
1141902789 16:87003472-87003494 AAAACTTGCCTCCCTGAGAGAGG + Intergenic
1143241853 17:5450301-5450323 CAACCCTCCTTCCCGGCGAGAGG - Exonic
1143560151 17:7688875-7688897 AAACTCTGTTTCCAGGGGAGTGG - Exonic
1144315762 17:14059523-14059545 AAAAACTGTTTCCAGGAGAGAGG - Intergenic
1146280573 17:31541706-31541728 AACCCCTCGTTCCTGGAGAGGGG - Intergenic
1147467651 17:40623204-40623226 AAACCATTTTTCCTGGAGAGAGG - Intergenic
1148796958 17:50201684-50201706 GAACCCTGCCCCTCGGAGAGGGG + Intergenic
1149977436 17:61280133-61280155 AGACCCTGGTGCCCAGAGAGAGG + Intronic
1151153774 17:72110232-72110254 AAACCCTGATTAGGGGAGAGGGG + Intergenic
1151541092 17:74764811-74764833 AAACCCTGGCAGCCGGAGAGGGG - Intronic
1151954827 17:77374976-77374998 CATCCCTGCTTCCCAGAGGGAGG + Intronic
1152959835 18:73089-73111 AGACCCTGGTACCGGGAGAGGGG - Intronic
1153835873 18:8963209-8963231 AGACCCTGCTTCCTGGACGGAGG - Intergenic
1159792535 18:72800381-72800403 AAACCCTGCTTCACAAAGATAGG - Intronic
1164525971 19:29014085-29014107 GAGCCCGGCTTCCTGGAGAGCGG - Intergenic
1165171367 19:33894312-33894334 AAAGACTCCTTCCCTGAGAGGGG + Intergenic
1168717802 19:58539375-58539397 ACACCCTGCTTCCCTCAGACAGG + Intergenic
1168717934 19:58539955-58539977 AGACTCTGCTTCCCTGAGACAGG + Intergenic
1168718131 19:58540767-58540789 AGACCCTGCTTCCCTCAGACAGG + Intergenic
1168718424 19:58541966-58541988 AGACCCTGCTTCCCTCAGACAGG + Intergenic
1168718566 19:58542549-58542571 AGACCCTGCTTCCCTCAGACAGG + Intergenic
929174662 2:38964156-38964178 AAACCCTGCTTCACAAAGATGGG + Intronic
933480484 2:82851186-82851208 AAACCCTGCTTCACAAAGACAGG + Intergenic
936689924 2:114874410-114874432 AAACCCTGCTTCACCAAGATAGG - Intronic
938103573 2:128514376-128514398 AAACCCTGCTTTGTGGAGAGGGG - Intergenic
939859464 2:147400414-147400436 ACTCTCTGTTTCCCGGAGAGAGG + Intergenic
940564170 2:155339475-155339497 AAACCCTGCTTCTCAGAGGGAGG + Intergenic
940656169 2:156489951-156489973 AAACCCTGCGTCAGGGAGAGGGG - Intronic
943818692 2:192290459-192290481 AAACCCTGCTTCACAAAGATAGG + Intergenic
946690798 2:222306915-222306937 AAACCCTGCTTTGCTGAGAGAGG - Intergenic
947089845 2:226497537-226497559 AAACCCTTCTTCATGGAAAGTGG + Intergenic
947685278 2:232078389-232078411 AAACCCTTCCTCCCGGGGAGCGG - Intronic
1169061761 20:2665433-2665455 AAACCATACTTCCAGAAGAGCGG - Intergenic
1169245691 20:4022730-4022752 GAAACCTGCTGCTCGGAGAGTGG - Intergenic
1170031101 20:11944993-11945015 AGACCCTGCTTCATGGTGAGAGG + Intergenic
1174262865 20:49309735-49309757 AAACCCTGGCTCCTGGGGAGGGG + Intergenic
1176058793 20:63162792-63162814 AAACCCTGCTCCCTGGGGATGGG - Intergenic
1176193735 20:63826918-63826940 AAACCCTGCTTCCCGGAGAGTGG - Intronic
1176552877 21:8236589-8236611 AAACTCTGCTGGCCGGAGGGCGG - Intergenic
1176571775 21:8418992-8419014 AAACTCTGCTGGCCGGAGGGCGG - Intergenic
1176579686 21:8463554-8463576 AAACTCTGCTGGCCGGAGGGCGG - Intergenic
1178794560 21:35731995-35732017 ATCTCCTGCTTCCCAGAGAGGGG - Intronic
1179188098 21:39100355-39100377 AAACCCTGCTTCACAAAGATAGG - Intergenic
1180846128 22:18983428-18983450 AAAAACTGCTTCCCAGTGAGTGG + Intergenic
1181576231 22:23796954-23796976 AATCCCAGCATCCCTGAGAGAGG - Intronic
1185133558 22:49055580-49055602 AACCCCAGCTTCCAGGAGACAGG - Intergenic
1203257854 22_KI270733v1_random:152989-153011 AAACTCTGCTGGCCGGAGGGCGG - Intergenic
951215030 3:20015638-20015660 AACCCCAGCTTCCCAGAGTGGGG + Intergenic
953502843 3:43454653-43454675 AAACAGTGTTTCCAGGAGAGAGG + Intronic
957178396 3:76843302-76843324 AAACTCTGCTTCCAGAAGAAGGG + Intronic
957472492 3:80677498-80677520 AGACACTGCTTTCCAGAGAGAGG - Intergenic
961580837 3:127880760-127880782 AAACCCTGCTTCACAAACAGAGG + Intergenic
961621403 3:128227651-128227673 AGACCCTGCTTCCATGATAGGGG + Intronic
963356308 3:144212581-144212603 AAACCCTGCTTCACAAAGATAGG + Intergenic
965356888 3:167686363-167686385 AAAGCCTCTTTCCAGGAGAGTGG + Intronic
972533729 4:39982345-39982367 AACCCCTGCTTCCCAGAGTCAGG - Intergenic
976122718 4:81800583-81800605 AAACCCTGCTTCACAAAGATAGG + Intronic
976180400 4:82393539-82393561 AAACCCTGCTTCACAAAGATAGG - Intergenic
978222463 4:106293262-106293284 AAACCCTGCTTCACAAAGATAGG - Intronic
979689851 4:123548372-123548394 TATCCCTGCTTCTCAGAGAGAGG - Intergenic
980991343 4:139741006-139741028 AAACCCAGCTTCCCACAGACAGG - Intronic
981597616 4:146445408-146445430 AAACCCTGCTCCCGCCAGAGAGG - Intronic
981752246 4:148103447-148103469 TGGCCCTGCTTCCCGGAGGGAGG - Intronic
982039799 4:151385513-151385535 AAACCCTGCTTCACAAAGATAGG + Intergenic
983936762 4:173507933-173507955 AATCCCTGCTGCCCCGAGTGCGG + Intergenic
985664179 5:1173398-1173420 AATCTCTGCCTCCCGGTGAGAGG - Intergenic
985810266 5:2078076-2078098 AAACCCAGATTCCGAGAGAGAGG - Intergenic
986165036 5:5265744-5265766 ACCCCCTGCTCCCCGGACAGTGG + Intronic
987756461 5:22102944-22102966 AAACACTGCATCCCAGAGTGAGG + Intronic
987993180 5:25241930-25241952 AAACCCTGCTTCACAAAGATAGG + Intergenic
988136110 5:27173872-27173894 AAACCCTGCTTCACAAAGATTGG - Intergenic
989178979 5:38557085-38557107 AAAACCAGCTTCTGGGAGAGGGG + Intronic
990190180 5:53250794-53250816 ATACCTTGATTCCAGGAGAGAGG + Intergenic
995463903 5:112431097-112431119 AAACCCTGCTTCACAAAGATAGG + Intergenic
995861355 5:116644222-116644244 AAACCCTGCTTCACAAAGATAGG + Intergenic
999193773 5:149768103-149768125 AAACCCTGCTTCACAGGGATAGG + Intronic
1001042009 5:168342879-168342901 AAACCCTACTGCCCAGAGTGTGG - Intronic
1001580261 5:172793430-172793452 AAAACCCGCTGCCCAGAGAGGGG + Intergenic
1001894462 5:175366505-175366527 AAACCCTGCTTCGCAAAGATAGG - Intergenic
1005705097 6:28443514-28443536 AACCGCTGTTTCGCGGAGAGCGG - Intergenic
1006008223 6:31020524-31020546 AACCTCTGCCTCCCGGTGAGAGG + Intronic
1010952207 6:82050115-82050137 ATACCCTGCTTCAGGGAGAAGGG + Intergenic
1013036079 6:106384590-106384612 AAACCCTGCTTCACAAAGATAGG + Intergenic
1013470409 6:110459162-110459184 AAACTCTACTTCCTGGAGAGAGG - Intronic
1014009689 6:116461807-116461829 AAAGGCTGCTTCTCGCAGAGTGG + Intronic
1017097329 6:150816199-150816221 AAACCCTGCTTCACAAAGATAGG + Intronic
1018596551 6:165487254-165487276 AAACCCTGCTTCACAAAGACAGG - Intronic
1018664527 6:166122927-166122949 AAACCCTGCTTCACAAAGACAGG + Intergenic
1019284520 7:216907-216929 AAGCTCTGCTGCCCGGAGACAGG - Intronic
1019916160 7:4134119-4134141 AGCCCTTGCTTCCCTGAGAGGGG + Intronic
1028511023 7:91626468-91626490 ACACCCTGCTGCCTGGAGTGTGG - Intergenic
1030560707 7:111081887-111081909 AAACCCTACTTTCCAGAGTGAGG + Intronic
1032071892 7:128812934-128812956 AAACCCTGCCTCCCTGACAGTGG - Intronic
1032128154 7:129209463-129209485 AATCCCTGCTGCCCGGTGGGTGG - Intronic
1032411013 7:131693246-131693268 AATCCCTGCTTTCTGGGGAGAGG - Intergenic
1038465169 8:27755503-27755525 AAGCACTACTTCCTGGAGAGGGG - Intronic
1038730790 8:30125756-30125778 AACTCCTGCCTCCAGGAGAGGGG + Intronic
1041441709 8:57904275-57904297 AAACTCTGGCTCCTGGAGAGAGG + Intergenic
1044299475 8:90567053-90567075 AGACCCTGGTACCTGGAGAGTGG + Intergenic
1046932590 8:119856032-119856054 AAACGCGGCTTCCCGGGGGGCGG + Intergenic
1048637907 8:136318861-136318883 AAACCCTGCTTGGCTGGGAGTGG - Intergenic
1049372779 8:142275644-142275666 CAAGCCTTCTTCCCGGAGGGAGG + Intronic
1049605101 8:143525702-143525724 AAACTGTGCTTCCTGTAGAGAGG - Intronic
1049744776 8:144258630-144258652 AGAGCCTGCTTCCTGGAGAGTGG + Intronic
1050057080 9:1667005-1667027 AAACCCTGCTTCACAAAGATAGG - Intergenic
1052956780 9:34258627-34258649 CCACACTGCTTCCTGGAGAGAGG + Intronic
1056546741 9:87620092-87620114 AGCCCCTGCTTCCAGCAGAGCGG + Intronic
1061610864 9:131744802-131744824 AAACCCAAGTTCCAGGAGAGAGG + Intergenic
1061917589 9:133763335-133763357 CAACCCTGCTGCCCGGTCAGCGG - Exonic
1061932451 9:133840232-133840254 AAACTCTGCTTCCCGAAGCCGGG - Intronic
1203474047 Un_GL000220v1:135012-135034 AAACTCTGCTGGCCGGAGGGCGG - Intergenic
1186514540 X:10156801-10156823 AAACCCGGCGTCCCGGAGACAGG - Intergenic
1198261533 X:134969273-134969295 GCACCCTGCTTCCCTGAGGGTGG + Intergenic
1198265138 X:135001873-135001895 GCACCCTGCTTCCCTGAGGGTGG - Intergenic