ID: 1176193746

View in Genome Browser
Species Human (GRCh38)
Location 20:63826974-63826996
Sequence TGCCAGGTCTGGAACCGTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 97}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176193740_1176193746 -5 Left 1176193740 20:63826956-63826978 CCACCAGGACCGGATGACTGCCA 0: 1
1: 0
2: 0
3: 6
4: 136
Right 1176193746 20:63826974-63826996 TGCCAGGTCTGGAACCGTGCGGG 0: 1
1: 0
2: 0
3: 11
4: 97
1176193737_1176193746 26 Left 1176193737 20:63826925-63826947 CCGGGAAGCAGGGTTTGGAATAT 0: 1
1: 0
2: 0
3: 13
4: 191
Right 1176193746 20:63826974-63826996 TGCCAGGTCTGGAACCGTGCGGG 0: 1
1: 0
2: 0
3: 11
4: 97
1176193742_1176193746 -8 Left 1176193742 20:63826959-63826981 CCAGGACCGGATGACTGCCAGGT 0: 1
1: 0
2: 1
3: 15
4: 181
Right 1176193746 20:63826974-63826996 TGCCAGGTCTGGAACCGTGCGGG 0: 1
1: 0
2: 0
3: 11
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176193746 Original CRISPR TGCCAGGTCTGGAACCGTGC GGG Intronic
900231697 1:1562165-1562187 TCCCAGGTCTGGAACCCAGGAGG + Intronic
900401060 1:2473152-2473174 TCCCAAGGCTGGAACCGGGCGGG - Intronic
905214999 1:36400717-36400739 TGCCAGGTGTGGAGCAGTGAGGG + Intergenic
910349278 1:86277440-86277462 TGGCATCTCTGGAACTGTGCTGG - Intergenic
911041916 1:93598055-93598077 AGCCAGGTCTGCAGACGTGCTGG + Intronic
912126682 1:106547871-106547893 TGCCAGGTATTGTACGGTGCTGG - Intergenic
916963722 1:169913946-169913968 TACCAGGTCTGGAGCCCTGTTGG + Intergenic
919983671 1:202658268-202658290 TGCCAGGAGTGGGACTGTGCAGG + Intronic
923533557 1:234830700-234830722 GGCTAGGACTGGAACCATGCAGG + Intergenic
924560640 1:245154700-245154722 TGCGAGGCCTGGAGCCGGGCTGG - Intergenic
1069689135 10:70338059-70338081 TTCCAGGTCTGGAACTTTCCAGG - Intronic
1070547953 10:77467461-77467483 TGCCATGTCTGGAACCCTGTTGG - Intronic
1073793218 10:106960796-106960818 TGCCAGGTCAGGTTCTGTGCAGG + Intronic
1075652177 10:124134726-124134748 TGCCAGGCCTGGTGCCATGCTGG + Intergenic
1076803694 10:132844723-132844745 TGCCTGGTCTGCAGCCGTGCGGG + Intronic
1077135013 11:994151-994173 CTCCAGGTCTGTCACCGTGCTGG - Exonic
1078615373 11:12860423-12860445 TGCCAGTGCTGGGACTGTGCAGG - Intronic
1083895353 11:65617054-65617076 TGCCTGGGCCGGAACCTTGCAGG + Intronic
1084195848 11:67523340-67523362 TGCCAGGCCTGGAACCCCGGGGG + Exonic
1087705288 11:101483552-101483574 TGCCAGGTATAGAACCTTGGTGG + Intronic
1087950830 11:104218817-104218839 AGCCACATCTGGAACTGTGCTGG + Intergenic
1089037337 11:115408386-115408408 TCCCAGATCTTGAACTGTGCAGG - Intronic
1095414574 12:41962391-41962413 TGCCAAGTCTGGAACTCTGCGGG - Intergenic
1095839005 12:46671148-46671170 TACCAGTTCTGAAACTGTGCCGG + Intergenic
1101532888 12:105590500-105590522 TGCCAGGTCTGGAGGTGGGCTGG + Intergenic
1101652394 12:106689439-106689461 TGCCAGGCCTGGCACCTAGCAGG - Intronic
1102216356 12:111164228-111164250 TACCAGGCCTGGAAGGGTGCTGG - Intronic
1102254765 12:111409163-111409185 TGTCAGGACTGGAACTGTGTTGG + Intronic
1102866197 12:116377002-116377024 TGCTAGGTCTGGGACAGTCCTGG + Intergenic
1113784551 13:112995624-112995646 TGCCCCGTGTGGGACCGTGCGGG + Intronic
1114556018 14:23562806-23562828 TGCCAGGTCTGGAAGTGAGGAGG - Intronic
1119482056 14:74964037-74964059 TGCCAGCTCTGGCTCAGTGCTGG + Intergenic
1121639255 14:95474422-95474444 TGCCAGGGCTGGGGCTGTGCAGG - Intronic
1122213564 14:100188701-100188723 TTGCAGGTCTGCAACCGGGCAGG - Intergenic
1125224162 15:37375921-37375943 TGTCAGGTCTGGCACCGTCCCGG - Intergenic
1129329598 15:74820323-74820345 TGCCAGGTCTCAAAAGGTGCAGG + Intronic
1132150601 15:99455459-99455481 TGCCAGGTATGAAACCGTTGGGG + Intergenic
1133382375 16:5341914-5341936 TGCCAGGGCTGGAGCCATGGGGG + Intergenic
1137613977 16:49836190-49836212 TGCCAGGCCTTGAACCTTGCTGG + Intronic
1138473321 16:57255910-57255932 TGCTGGGTCTGGAACAGTCCTGG - Intronic
1139951892 16:70676472-70676494 TGCCAGGCCTAGCACCGTGTGGG - Intronic
1142742224 17:1937829-1937851 AGCCAGGTCAGGGGCCGTGCAGG + Intronic
1148741591 17:49896407-49896429 AGCCAGGTCTACAACCTTGCTGG + Intergenic
1152497470 17:80683845-80683867 TGCCAGGACTTGAGCCATGCGGG - Intronic
1156481384 18:37438603-37438625 TTCCAGGTCTGGAGTGGTGCAGG + Intronic
1165419697 19:35716806-35716828 TGCCAGGTCAGAAGCCGAGCCGG - Exonic
927928293 2:27027756-27027778 TGCCAGGACTGGGGCTGTGCAGG - Intergenic
931571149 2:63670505-63670527 TGCCAGGTCTGGGACCATGAGGG + Intronic
932598313 2:73107804-73107826 TGCCAGCTCTGGGGCCGAGCAGG + Intronic
1169251787 20:4066786-4066808 TGCTAGGACTGGAACCATGGTGG + Intergenic
1170369087 20:15628720-15628742 TCCCAGGTCTGGCACCTTGGTGG + Intronic
1172515264 20:35528732-35528754 TGCCAAGGCTGGAGCCCTGCGGG + Exonic
1173161894 20:40658928-40658950 TCCCAGGCCTGGAAAGGTGCAGG - Intergenic
1175087124 20:56468852-56468874 AGCCAGGTCTGGAACTCCGCTGG - Intronic
1176193746 20:63826974-63826996 TGCCAGGTCTGGAACCGTGCGGG + Intronic
1176200268 20:63857007-63857029 TGCCAGGGCAGGAACCCTGGGGG + Intergenic
1180107877 21:45631707-45631729 GGCCAGGTCAGAAACGGTGCTGG + Intergenic
1183015919 22:34986597-34986619 TGCCAGGTCTGGATATGTGTGGG + Intergenic
1183378713 22:37480049-37480071 TGTCAGGACTGGAACCCAGCTGG + Intronic
1183384290 22:37506108-37506130 GGCCAGGGCTGGGAACGTGCCGG - Intronic
1184164275 22:42718696-42718718 TGCCAGGCCTGGCACCTAGCAGG - Intronic
1184779648 22:46640754-46640776 TGCCTGGTCCGGAATCTTGCTGG - Intronic
1185109683 22:48894047-48894069 GGCCAGGGCTGGGACCCTGCAGG + Intergenic
950207737 3:11093402-11093424 AGCCAGGTGTGGAACGGTGAGGG - Intergenic
954391469 3:50270120-50270142 TGCCAGGCCTGGAGCTCTGCAGG - Exonic
961046047 3:123708733-123708755 TGCGAGGCCTGGAACAGCGCTGG - Exonic
961192326 3:124972226-124972248 TGCTAGTTATTGAACCGTGCTGG + Intronic
963102975 3:141623349-141623371 ACCCAGTTCTGGAACCGTCCTGG + Intergenic
967973032 3:195013135-195013157 TGCCACGTATGAAACCGTGTGGG - Intergenic
968180388 3:196591020-196591042 CGCTATGTCTGGAACCATGCTGG + Intergenic
968601706 4:1512865-1512887 GGCCGGGGCTGGACCCGTGCTGG - Intergenic
968651684 4:1762658-1762680 TGCCAGGTTTAGACCCCTGCAGG - Intergenic
968867093 4:3220052-3220074 TGCCAGCTCTGGGACAGTGTTGG + Intronic
974533368 4:63141709-63141731 TCCCATTTCTGGAACAGTGCTGG - Intergenic
976712307 4:88085477-88085499 TACCAGGTCTGTAACCCTGATGG - Intergenic
985493969 5:194097-194119 TCCCAGCTCTGAAACCATGCGGG + Intronic
985872649 5:2569630-2569652 TGACAAGTCAGGAACCCTGCTGG - Intergenic
997710067 5:135996652-135996674 CTCCAGGTCTGGAGCCCTGCTGG + Intergenic
1003051664 6:2786222-2786244 TGCCATGTCTGGAAGGCTGCCGG + Intronic
1009882420 6:69584881-69584903 TGCCAAGGCTGAAACCTTGCAGG - Intergenic
1009895647 6:69746009-69746031 TGCCATGGGTGGAATCGTGCTGG - Intronic
1012962826 6:105640705-105640727 AGCCAGGTCTGGATCTGTGAGGG - Intergenic
1013828155 6:114240199-114240221 CCCCAGGTCAGGAAGCGTGCAGG - Intronic
1015948171 6:138524102-138524124 AGCCAGGTCTGGGACCCTGAAGG + Intronic
1017153638 6:151303701-151303723 TTCCAGGTCTGGAACCGGTCTGG - Intronic
1018416055 6:163603037-163603059 AGGCAGGCATGGAACCGTGCAGG + Intergenic
1019146685 6:169980029-169980051 TGCCACCTCCGGGACCGTGCTGG - Intergenic
1019305504 7:332637-332659 CGCCAGGGCTGGAACTGTGCAGG + Intergenic
1023191265 7:37585530-37585552 TGCCTGGTTTGGAACAGAGCTGG + Intergenic
1034254254 7:149715654-149715676 AGCCAGTTCTGCAACCGTGGTGG + Intronic
1034326400 7:150237738-150237760 TGGCAGGTGTGGGACCTTGCTGG + Intergenic
1034766814 7:153731518-153731540 TGGCAGGTGTGGGACCTTGCTGG - Intergenic
1035012732 7:155733962-155733984 TGCCAAGTCTGGAACCTGGGAGG - Intronic
1039010313 8:33086389-33086411 TGCCAGGTTTGGAAAGGTGGTGG + Intergenic
1048968796 8:139632570-139632592 GGCCAGGCCTGGAACCCTGCTGG - Intronic
1049287096 8:141781769-141781791 TGCCAGGGCAGGAGCCATGCCGG - Intergenic
1049679682 8:143912503-143912525 TGCCGGGCCTGGTATCGTGCTGG - Intergenic
1049679686 8:143912520-143912542 TGCCGTGTCTGGTATCGTGCCGG - Intergenic
1049679693 8:143912557-143912579 TGCCGGGTCTGGTATCGTGCTGG - Intergenic
1056808714 9:89747779-89747801 GGCCAGGGCTGGAGACGTGCCGG + Intergenic
1060369099 9:123052226-123052248 AGCTAGGTCTGGAACCCAGCTGG - Intronic
1062108352 9:134767942-134767964 TGCCAGGCCTGGGACCTTCCAGG + Intronic
1062302356 9:135881954-135881976 TGCCAGGCTTGGAACAGTGATGG - Intronic
1062320119 9:135986636-135986658 TGACAGGCCTGGAGCAGTGCAGG + Intergenic
1187253501 X:17621140-17621162 AGCCAGGTCTGGAACCGCTTGGG + Intronic
1197030570 X:121808940-121808962 TGCAAGCTCTGGATCTGTGCTGG - Intergenic
1198520307 X:137445741-137445763 TGCCAGGTCTGGGACATGGCTGG + Intergenic
1201176044 Y:11308604-11308626 TGTCAGGCCTGGAGCTGTGCGGG - Intergenic
1201244045 Y:11986151-11986173 TGCCTGGTCAGGAACAGTGCCGG + Intergenic