ID: 1176194155 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 20:63829604-63829626 |
Sequence | GCCTGGTTACCACTGCAGAA AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1176194155_1176194158 | 2 | Left | 1176194155 | 20:63829604-63829626 | CCTTTCTGCAGTGGTAACCAGGC | No data | ||
Right | 1176194158 | 20:63829629-63829651 | AGGTGCCCAAAAGTGCCAGTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1176194155 | Original CRISPR | GCCTGGTTACCACTGCAGAA AGG (reversed) | Intronic | ||