ID: 1176194158

View in Genome Browser
Species Human (GRCh38)
Location 20:63829629-63829651
Sequence AGGTGCCCAAAAGTGCCAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176194155_1176194158 2 Left 1176194155 20:63829604-63829626 CCTTTCTGCAGTGGTAACCAGGC No data
Right 1176194158 20:63829629-63829651 AGGTGCCCAAAAGTGCCAGTTGG No data
1176194153_1176194158 9 Left 1176194153 20:63829597-63829619 CCTCAGTCCTTTCTGCAGTGGTA No data
Right 1176194158 20:63829629-63829651 AGGTGCCCAAAAGTGCCAGTTGG No data
1176194151_1176194158 16 Left 1176194151 20:63829590-63829612 CCTCACTCCTCAGTCCTTTCTGC No data
Right 1176194158 20:63829629-63829651 AGGTGCCCAAAAGTGCCAGTTGG No data
1176194148_1176194158 27 Left 1176194148 20:63829579-63829601 CCAAGTACTCCCCTCACTCCTCA No data
Right 1176194158 20:63829629-63829651 AGGTGCCCAAAAGTGCCAGTTGG No data
1176194150_1176194158 17 Left 1176194150 20:63829589-63829611 CCCTCACTCCTCAGTCCTTTCTG No data
Right 1176194158 20:63829629-63829651 AGGTGCCCAAAAGTGCCAGTTGG No data
1176194147_1176194158 28 Left 1176194147 20:63829578-63829600 CCCAAGTACTCCCCTCACTCCTC No data
Right 1176194158 20:63829629-63829651 AGGTGCCCAAAAGTGCCAGTTGG No data
1176194149_1176194158 18 Left 1176194149 20:63829588-63829610 CCCCTCACTCCTCAGTCCTTTCT No data
Right 1176194158 20:63829629-63829651 AGGTGCCCAAAAGTGCCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176194158 Original CRISPR AGGTGCCCAAAAGTGCCAGT TGG Intronic