ID: 1176194158

View in Genome Browser
Species Human (GRCh38)
Location 20:63829629-63829651
Sequence AGGTGCCCAAAAGTGCCAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 125}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176194148_1176194158 27 Left 1176194148 20:63829579-63829601 CCAAGTACTCCCCTCACTCCTCA No data
Right 1176194158 20:63829629-63829651 AGGTGCCCAAAAGTGCCAGTTGG 0: 1
1: 0
2: 0
3: 13
4: 125
1176194147_1176194158 28 Left 1176194147 20:63829578-63829600 CCCAAGTACTCCCCTCACTCCTC 0: 1
1: 0
2: 0
3: 34
4: 255
Right 1176194158 20:63829629-63829651 AGGTGCCCAAAAGTGCCAGTTGG 0: 1
1: 0
2: 0
3: 13
4: 125
1176194151_1176194158 16 Left 1176194151 20:63829590-63829612 CCTCACTCCTCAGTCCTTTCTGC 0: 1
1: 0
2: 5
3: 69
4: 504
Right 1176194158 20:63829629-63829651 AGGTGCCCAAAAGTGCCAGTTGG 0: 1
1: 0
2: 0
3: 13
4: 125
1176194150_1176194158 17 Left 1176194150 20:63829589-63829611 CCCTCACTCCTCAGTCCTTTCTG 0: 1
1: 0
2: 1
3: 56
4: 512
Right 1176194158 20:63829629-63829651 AGGTGCCCAAAAGTGCCAGTTGG 0: 1
1: 0
2: 0
3: 13
4: 125
1176194155_1176194158 2 Left 1176194155 20:63829604-63829626 CCTTTCTGCAGTGGTAACCAGGC 0: 1
1: 0
2: 0
3: 7
4: 90
Right 1176194158 20:63829629-63829651 AGGTGCCCAAAAGTGCCAGTTGG 0: 1
1: 0
2: 0
3: 13
4: 125
1176194153_1176194158 9 Left 1176194153 20:63829597-63829619 CCTCAGTCCTTTCTGCAGTGGTA 0: 1
1: 0
2: 4
3: 22
4: 230
Right 1176194158 20:63829629-63829651 AGGTGCCCAAAAGTGCCAGTTGG 0: 1
1: 0
2: 0
3: 13
4: 125
1176194149_1176194158 18 Left 1176194149 20:63829588-63829610 CCCCTCACTCCTCAGTCCTTTCT 0: 1
1: 0
2: 4
3: 74
4: 685
Right 1176194158 20:63829629-63829651 AGGTGCCCAAAAGTGCCAGTTGG 0: 1
1: 0
2: 0
3: 13
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176194158 Original CRISPR AGGTGCCCAAAAGTGCCAGT TGG Intronic
901633001 1:10656952-10656974 AGGTGGCCAAAAGTCAAAGTAGG + Intronic
902605555 1:17567176-17567198 AGGTGCCCAAAAATGCTAGCTGG - Intronic
902966875 1:20011482-20011504 AGCTCCCCAAAAGTTGCAGTTGG + Intergenic
904352869 1:29920345-29920367 TGGGGCTGAAAAGTGCCAGTTGG - Intergenic
905869244 1:41393777-41393799 AGGCCCACAAAAGTGCCTGTTGG + Intergenic
909215158 1:72877580-72877602 AGGAGCCCAAAGTGGCCAGTTGG - Intergenic
910791584 1:91056477-91056499 AGGAGCCCAAAGTTGCCAGGTGG + Intergenic
912543422 1:110433869-110433891 AGGTCCCTAAAAGGGCCAGGAGG - Intergenic
914640828 1:149605932-149605954 AAGTGCCCAAGAGTGCCAAACGG - Intergenic
915986187 1:160467315-160467337 AGCAACCCAAAAATGCCAGTGGG - Intergenic
1063890934 10:10627711-10627733 ATGTGCTCAAAAGAGCCAGGAGG - Intergenic
1064222326 10:13451930-13451952 AGCTTCCCCAAAGTGACAGTGGG - Intronic
1065152794 10:22839454-22839476 AGGTGACCATAAGTGCCTGATGG - Intergenic
1066747883 10:38619985-38620007 AGGTATCCAAAAGTGTTAGTAGG + Intergenic
1071862651 10:89690087-89690109 AGGTCCCCATAAGTGACAGATGG + Intergenic
1072706781 10:97686875-97686897 AGGTGCTTACAAGGGCCAGTCGG + Exonic
1074492599 10:113952469-113952491 TGGAGCCCAAAAGTCCCTGTAGG + Intergenic
1075020987 10:118952297-118952319 TAGTGCTCAAAAGTACCAGTCGG - Intergenic
1076313163 10:129522341-129522363 AGGTGGCCAGAAGTGCCTGTAGG + Intronic
1079154020 11:17927211-17927233 TGGTGCCAAAAATTGCCAGATGG - Intronic
1080479669 11:32633432-32633454 GGGACCCCAAAAGAGCCAGTTGG - Intronic
1081934563 11:46895953-46895975 CTGTGCCCAGAAGTGCCAGATGG - Exonic
1083093358 11:60222762-60222784 AGGAGCCCAAAATGGCCAGGTGG - Intronic
1085016275 11:73176151-73176173 AGGTCCACAGAAGAGCCAGTTGG - Intergenic
1086060581 11:82695861-82695883 AGGTCCCCAGAGGTGCCTGTGGG + Intergenic
1086989475 11:93287475-93287497 AGGTGCTCAAAGGAGCCAGGTGG + Intergenic
1087641095 11:100754419-100754441 AGGTTCCTTAAAGTACCAGTTGG - Intronic
1088006515 11:104947380-104947402 AGGTGATCAAAAGTTGCAGTTGG + Intronic
1088140951 11:106615546-106615568 ATTTGCCCAACATTGCCAGTAGG + Intergenic
1088988438 11:114929667-114929689 AGGAGCCCAGAAGTGCCACATGG - Intergenic
1089378603 11:118012110-118012132 AGGAGCCCAATAGAGCAAGTGGG - Intergenic
1096504085 12:52081872-52081894 AGGGGCCCCCAAGTGCCAGAAGG - Intergenic
1097279693 12:57837167-57837189 ACATGCCCTAAAGTGCCAGGTGG + Intronic
1100503066 12:95193132-95193154 AAATGCCCAAAAGTGCAATTAGG - Intronic
1101360227 12:104019488-104019510 TGATGCCAAAAAGTGCCTGTGGG + Intronic
1104664284 12:130636285-130636307 TGGTGCTCAAGAGTGCCAGTAGG - Intronic
1105344470 13:19560620-19560642 AGGTGCCCATCAGGGCCAGCAGG + Intergenic
1108228599 13:48316319-48316341 AGATGCCCCAAAGTGTCCGTCGG - Intronic
1109462143 13:62674948-62674970 TGGTGCCCAGAAGTGGCAGCAGG + Intergenic
1111253251 13:85633121-85633143 GAGTGTCCAAAAGTGCCAGCTGG - Intergenic
1114521192 14:23337596-23337618 AGGTGCCCCTGAGTGCCAGGGGG + Intergenic
1119950206 14:78737300-78737322 TGGTACCCAAAGGTACCAGTAGG + Intronic
1121336073 14:93078224-93078246 GGGTGCCCAAAGGTTCCTGTGGG - Intronic
1125827030 15:42685269-42685291 AGGTGCCAAAAAGTCTCTGTGGG - Exonic
1126412276 15:48384661-48384683 AGGTGCCCACAATTCCCATTTGG + Intergenic
1126484217 15:49161340-49161362 AGGTGCTAATAAGTGCTAGTTGG + Intronic
1127360984 15:58245107-58245129 AGGTGCCCAAGAGTTCCAGCAGG + Intronic
1129538391 15:76332580-76332602 AGGGGCCCAGCAGTGCCTGTGGG + Intergenic
1130710645 15:86277702-86277724 AGGTGTCCCGAAGGGCCAGTAGG - Intronic
1130927171 15:88394377-88394399 AGGTCCCCAGAAGTGGCAGCAGG - Intergenic
1130953722 15:88612194-88612216 AGGTGCCCCAAAGTGATTGTTGG - Intergenic
1131128758 15:89880253-89880275 AGGTCCCAAAAAGTCCCTGTTGG - Intronic
1132458491 16:37431-37453 AGGTGGACGAAAGTGGCAGTGGG + Intergenic
1135626044 16:23995780-23995802 ATGAGCCCAAAGGTGCAAGTTGG - Intronic
1137440594 16:48495784-48495806 AGCTGCCAAAAACTGCCAGCAGG - Intergenic
1137866330 16:51900560-51900582 AGTTGGCCAAATGTGCCTGTAGG + Intergenic
1139275866 16:65727134-65727156 TGGAGCTCAAAACTGCCAGTTGG - Intergenic
1144936230 17:18901238-18901260 AGCGACCCAAAAATGCCAGTGGG - Intronic
1150455766 17:65305262-65305284 AGTTGCCCAAAAGAGCCATCTGG - Intergenic
1151451705 17:74202060-74202082 AAGTGCCCAAAAGTGCCCCTCGG + Intergenic
1153461750 18:5342060-5342082 AGGAGCCCAAAAGGGCCAGATGG - Intergenic
1159711562 18:71766073-71766095 AGGAGCCCAAAGTTGCCAGGTGG - Intronic
1165831456 19:38732635-38732657 AAGTGTCCAAAAGAGCCAGCCGG - Intronic
1166217244 19:41343692-41343714 AGGTGTCCAGAAGTGACTGTGGG + Intronic
926889756 2:17629095-17629117 GGGTGCCCAGAAGGGCCAGGTGG - Intronic
927972600 2:27315248-27315270 AGTTGCCCAAAGGTCCAAGTCGG + Intronic
929611838 2:43276559-43276581 AGGTTCCAGAAAGTGCCCGTGGG + Intronic
930514227 2:52385683-52385705 TGGGGCCCAAAAGTGCCTCTAGG + Intergenic
930582392 2:53228184-53228206 AGGGGCCCAAGAGCACCAGTGGG + Intergenic
936671607 2:114662763-114662785 AGGGGCCCTGAAGTGCCAGGGGG + Intronic
939482080 2:142761860-142761882 AGGAGTGCTAAAGTGCCAGTAGG - Intergenic
942345721 2:175000836-175000858 AGGCCCCCCAAAGTGCCAGGAGG + Intronic
943444892 2:187972507-187972529 AAGTGCACAAAAGAGCCAATGGG + Intergenic
943587949 2:189762637-189762659 AGGTGCGCAAAAGCGTCAGTGGG + Intronic
943783270 2:191847885-191847907 ACGTGCCCAGAAGTGTCTGTTGG + Intergenic
945066197 2:205949680-205949702 AGGAGCCCAGAAGTGCCACATGG + Intergenic
946782469 2:223205587-223205609 TGGTGCCCATATGTGCCATTCGG + Intergenic
948681379 2:239637293-239637315 TGGTGCCCACAAGTCCAAGTGGG + Intergenic
1169266972 20:4172710-4172732 CGGTTCCCAAAAGGGCCGGTAGG - Intronic
1170827643 20:19810094-19810116 AGGAGCCCAGAAGTGCCAAGAGG + Intergenic
1172933907 20:38605512-38605534 AGGTGCCTCAAAGACCCAGTTGG + Intronic
1173615685 20:44401502-44401524 ATGTGCCCAGGTGTGCCAGTGGG + Intronic
1176194158 20:63829629-63829651 AGGTGCCCAAAAGTGCCAGTTGG + Intronic
1177702893 21:24661491-24661513 AGGTGCACAAAAGTTCTACTAGG - Intergenic
1184869488 22:47226180-47226202 AGGAGGCCAAAGGTGGCAGTGGG + Intergenic
1185067439 22:48639241-48639263 AGGTGACCCACAGTGCCACTGGG - Intronic
952868419 3:37874342-37874364 GGGTACATAAAAGTGCCAGTGGG + Intronic
953378667 3:42449671-42449693 AAGTGCACAACAGTGCTAGTGGG - Intergenic
954860779 3:53688818-53688840 AGAGGCCCAAAACTGCCAGCAGG - Intronic
959742395 3:109736274-109736296 AGGTGCCAAAAAGATACAGTGGG + Intergenic
960821561 3:121738532-121738554 AGGACCTCAAAAGAGCCAGTGGG + Intronic
968435771 4:588219-588241 CGGTGCCCAGAGGTGCCAGGTGG + Intergenic
968490354 4:886853-886875 AGGTGCCCAGAGGTGCGAGTGGG + Intronic
971322122 4:25614138-25614160 GGGTGCCCAAAGGTGCAGGTTGG + Intergenic
972751249 4:41990973-41990995 AGGTGCCCACAAGTTCCCGCGGG - Intronic
979606632 4:122645391-122645413 GGGTGCCCAAAAGAGCAAGATGG + Intergenic
982426053 4:155262464-155262486 AGGTGCCCCATAGTTCCTGTAGG + Intergenic
984341951 4:178468590-178468612 AGATGACCAGAAATGCCAGTTGG + Intergenic
985575814 5:673107-673129 AGGCTCCCACAAGTGACAGTGGG + Intronic
988242510 5:28632349-28632371 ATATGCCCAAATGTGCTAGTAGG + Intergenic
990728530 5:58783688-58783710 ATGTGCCCAAAACTGCCTGTAGG - Intronic
1002883443 6:1273091-1273113 ATGTGCTCAAAACTGCCTGTGGG + Intergenic
1002889971 6:1323991-1324013 AGGTTGCCAAAAGGGCCAGTAGG - Intergenic
1004265010 6:14141755-14141777 ATGTACCCAAAAGAGCCAGCTGG + Intergenic
1004505616 6:16244509-16244531 AGGGGCTCAAAAGTGCAAATGGG - Intronic
1005225568 6:23638314-23638336 AGGAGCCCAAAATAGCCAGGTGG + Intergenic
1007910188 6:45505683-45505705 GGGTGCTCAAAAATGCTAGTTGG - Intronic
1010406797 6:75515263-75515285 AGGAGCCCAAAATGGCCAGGTGG + Intergenic
1010784103 6:79979683-79979705 AGGTGCCCAAAAGTCACACGTGG - Intergenic
1012288604 6:97423262-97423284 AGGAGCCCAAAGTTTCCAGTTGG + Intergenic
1014173519 6:118306159-118306181 AGGAGCCCAAAATGGCCAGGTGG + Intronic
1017363521 6:153604751-153604773 AAGAGCCCAAGAGTGGCAGTAGG - Intergenic
1017822775 6:158061036-158061058 AGGAGCCCAACAGTGCCTGGTGG - Intronic
1018456369 6:163956817-163956839 AGGTGCCCAGAACTTCCAGCAGG - Intergenic
1022020755 7:26398025-26398047 AGGGGCCCAAATGTGACAGGGGG + Intergenic
1027723144 7:81770040-81770062 CAGTGCCTAAAAGAGCCAGTCGG + Exonic
1033412589 7:141132614-141132636 TGGTGCCCACATGTGCCACTTGG + Intronic
1035395520 7:158532319-158532341 AGATGCCCAAAAGCGACATTGGG + Intronic
1037692660 8:21195306-21195328 AGTGGCACAAAAGTGCCACTGGG + Intergenic
1038671862 8:29589359-29589381 AGGTGGATCAAAGTGCCAGTGGG + Intergenic
1041506901 8:58609072-58609094 AGGAGCCCATAACTGCCAGACGG + Intronic
1049287150 8:141782032-141782054 GGCTGCCCAATAGAGCCAGTGGG + Intergenic
1049874502 8:145007615-145007637 GGGTCCCCAAAAGCCCCAGTGGG - Intergenic
1050063535 9:1735027-1735049 AGGTGGCCACATGTCCCAGTTGG - Intergenic
1050063858 9:1738119-1738141 AGGTGACCACATGTCCCAGTTGG - Intergenic
1052390143 9:27869983-27870005 AGGAGCCCAAAGGTGTCAGCTGG - Intergenic
1052740333 9:32386152-32386174 AGGCTCACAAAAGTGCCAGTGGG + Intronic
1056643635 9:88391117-88391139 ATGTGACCCAAAGAGCCAGTAGG - Intronic
1056899604 9:90585316-90585338 AGGGGTCCAGAAGTGCCAGGGGG + Intergenic
1057470255 9:95350308-95350330 AGATGCCCGAAAGTGTCCGTGGG + Intergenic
1058248291 9:102658759-102658781 AGGTGCCCAGAACTGTCAGTTGG - Intergenic
1060930440 9:127486412-127486434 AGGTGCCCAGCAGAGCCAGTGGG + Intronic
1061471078 9:130826466-130826488 AGGAGCCCAAAGGAGACAGTAGG + Intronic
1061628969 9:131859489-131859511 AGATGTCCAAAAGAACCAGTGGG - Intergenic
1186975891 X:14904543-14904565 AGGTGCTCAAAATTGCCCTTAGG + Intronic
1191889287 X:65924755-65924777 GGCTGCCCAAATGTGCCTGTAGG + Intergenic
1192195595 X:69025813-69025835 TGTTGCCCTAAATTGCCAGTAGG - Intergenic
1194425880 X:93737855-93737877 AGTTGCCTTATAGTGCCAGTGGG + Intergenic
1201271666 Y:12261600-12261622 AGGTCAGCAAAAGGGCCAGTGGG + Intergenic