ID: 1176194404

View in Genome Browser
Species Human (GRCh38)
Location 20:63830838-63830860
Sequence GCCCCGCGCCGCCGGCCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176194386_1176194404 22 Left 1176194386 20:63830793-63830815 CCGCGCTCAGCCCCGCGGGGAAC No data
Right 1176194404 20:63830838-63830860 GCCCCGCGCCGCCGGCCTGGGGG No data
1176194394_1176194404 -10 Left 1176194394 20:63830825-63830847 CCCCGCGCGCCCCGCCCCGCGCC No data
Right 1176194404 20:63830838-63830860 GCCCCGCGCCGCCGGCCTGGGGG No data
1176194392_1176194404 -6 Left 1176194392 20:63830821-63830843 CCGCCCCCGCGCGCCCCGCCCCG No data
Right 1176194404 20:63830838-63830860 GCCCCGCGCCGCCGGCCTGGGGG No data
1176194390_1176194404 0 Left 1176194390 20:63830815-63830837 CCCGCGCCGCCCCCGCGCGCCCC No data
Right 1176194404 20:63830838-63830860 GCCCCGCGCCGCCGGCCTGGGGG No data
1176194381_1176194404 28 Left 1176194381 20:63830787-63830809 CCGCCTCCGCGCTCAGCCCCGCG No data
Right 1176194404 20:63830838-63830860 GCCCCGCGCCGCCGGCCTGGGGG No data
1176194388_1176194404 11 Left 1176194388 20:63830804-63830826 CCCGCGGGGAACCCGCGCCGCCC No data
Right 1176194404 20:63830838-63830860 GCCCCGCGCCGCCGGCCTGGGGG No data
1176194384_1176194404 25 Left 1176194384 20:63830790-63830812 CCTCCGCGCTCAGCCCCGCGGGG No data
Right 1176194404 20:63830838-63830860 GCCCCGCGCCGCCGGCCTGGGGG No data
1176194393_1176194404 -9 Left 1176194393 20:63830824-63830846 CCCCCGCGCGCCCCGCCCCGCGC No data
Right 1176194404 20:63830838-63830860 GCCCCGCGCCGCCGGCCTGGGGG No data
1176194387_1176194404 12 Left 1176194387 20:63830803-63830825 CCCCGCGGGGAACCCGCGCCGCC No data
Right 1176194404 20:63830838-63830860 GCCCCGCGCCGCCGGCCTGGGGG No data
1176194391_1176194404 -1 Left 1176194391 20:63830816-63830838 CCGCGCCGCCCCCGCGCGCCCCG No data
Right 1176194404 20:63830838-63830860 GCCCCGCGCCGCCGGCCTGGGGG No data
1176194389_1176194404 10 Left 1176194389 20:63830805-63830827 CCGCGGGGAACCCGCGCCGCCCC No data
Right 1176194404 20:63830838-63830860 GCCCCGCGCCGCCGGCCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176194404 Original CRISPR GCCCCGCGCCGCCGGCCTGG GGG Intronic