ID: 1176195003

View in Genome Browser
Species Human (GRCh38)
Location 20:63832662-63832684
Sequence CATCCCGGCGACCTTGGCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176195003_1176195010 7 Left 1176195003 20:63832662-63832684 CCCTCGCCAAGGTCGCCGGGATG No data
Right 1176195010 20:63832692-63832714 GGCCCAGGAAGCCCCGTCGCCGG No data
1176195003_1176195016 21 Left 1176195003 20:63832662-63832684 CCCTCGCCAAGGTCGCCGGGATG No data
Right 1176195016 20:63832706-63832728 CGTCGCCGGCCTACCTCGCGCGG No data
1176195003_1176195009 -8 Left 1176195003 20:63832662-63832684 CCCTCGCCAAGGTCGCCGGGATG No data
Right 1176195009 20:63832677-63832699 CCGGGATGGCACTGCGGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176195003 Original CRISPR CATCCCGGCGACCTTGGCGA GGG (reversed) Intergenic
No off target data available for this crispr