ID: 1176195688

View in Genome Browser
Species Human (GRCh38)
Location 20:63835579-63835601
Sequence CTGGAGCGGCAGTTGGGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176195688_1176195694 1 Left 1176195688 20:63835579-63835601 CCAAGCCCCAACTGCCGCTCCAG No data
Right 1176195694 20:63835603-63835625 TGCCACAGCCAACTGTCGACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176195688 Original CRISPR CTGGAGCGGCAGTTGGGGCT TGG (reversed) Intergenic
No off target data available for this crispr