ID: 1176197632

View in Genome Browser
Species Human (GRCh38)
Location 20:63844682-63844704
Sequence CAGGTTTTCCTGAGGAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176197626_1176197632 4 Left 1176197626 20:63844655-63844677 CCAGAGACTGGAGGCCTTATCAG No data
Right 1176197632 20:63844682-63844704 CAGGTTTTCCTGAGGAAGGAAGG No data
1176197623_1176197632 22 Left 1176197623 20:63844637-63844659 CCGGGGTGGTTTTGAAAACCAGA No data
Right 1176197632 20:63844682-63844704 CAGGTTTTCCTGAGGAAGGAAGG No data
1176197622_1176197632 29 Left 1176197622 20:63844630-63844652 CCTGGTGCCGGGGTGGTTTTGAA No data
Right 1176197632 20:63844682-63844704 CAGGTTTTCCTGAGGAAGGAAGG No data
1176197628_1176197632 -10 Left 1176197628 20:63844669-63844691 CCTTATCAGACCACAGGTTTTCC No data
Right 1176197632 20:63844682-63844704 CAGGTTTTCCTGAGGAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176197632 Original CRISPR CAGGTTTTCCTGAGGAAGGA AGG Intergenic
No off target data available for this crispr