ID: 1176198595

View in Genome Browser
Species Human (GRCh38)
Location 20:63849256-63849278
Sequence CATTCCTGTTGTTTGGATGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176198595_1176198602 19 Left 1176198595 20:63849256-63849278 CCCGCATCCAAACAACAGGAATG No data
Right 1176198602 20:63849298-63849320 CTCCAGATGACACCTCTGCCAGG No data
1176198595_1176198598 -6 Left 1176198595 20:63849256-63849278 CCCGCATCCAAACAACAGGAATG No data
Right 1176198598 20:63849273-63849295 GGAATGCTTGCCCCGAAGTGAGG No data
1176198595_1176198603 20 Left 1176198595 20:63849256-63849278 CCCGCATCCAAACAACAGGAATG No data
Right 1176198603 20:63849299-63849321 TCCAGATGACACCTCTGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176198595 Original CRISPR CATTCCTGTTGTTTGGATGC GGG (reversed) Intergenic
No off target data available for this crispr