ID: 1176198600

View in Genome Browser
Species Human (GRCh38)
Location 20:63849284-63849306
Sequence CATCTGGAGCACCTCACTTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176198600_1176198602 -9 Left 1176198600 20:63849284-63849306 CCCGAAGTGAGGTGCTCCAGATG No data
Right 1176198602 20:63849298-63849320 CTCCAGATGACACCTCTGCCAGG No data
1176198600_1176198603 -8 Left 1176198600 20:63849284-63849306 CCCGAAGTGAGGTGCTCCAGATG No data
Right 1176198603 20:63849299-63849321 TCCAGATGACACCTCTGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176198600 Original CRISPR CATCTGGAGCACCTCACTTC GGG (reversed) Intergenic
No off target data available for this crispr