ID: 1176198602

View in Genome Browser
Species Human (GRCh38)
Location 20:63849298-63849320
Sequence CTCCAGATGACACCTCTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176198601_1176198602 -10 Left 1176198601 20:63849285-63849307 CCGAAGTGAGGTGCTCCAGATGA No data
Right 1176198602 20:63849298-63849320 CTCCAGATGACACCTCTGCCAGG No data
1176198594_1176198602 20 Left 1176198594 20:63849255-63849277 CCCCGCATCCAAACAACAGGAAT No data
Right 1176198602 20:63849298-63849320 CTCCAGATGACACCTCTGCCAGG No data
1176198600_1176198602 -9 Left 1176198600 20:63849284-63849306 CCCGAAGTGAGGTGCTCCAGATG No data
Right 1176198602 20:63849298-63849320 CTCCAGATGACACCTCTGCCAGG No data
1176198599_1176198602 -8 Left 1176198599 20:63849283-63849305 CCCCGAAGTGAGGTGCTCCAGAT No data
Right 1176198602 20:63849298-63849320 CTCCAGATGACACCTCTGCCAGG No data
1176198595_1176198602 19 Left 1176198595 20:63849256-63849278 CCCGCATCCAAACAACAGGAATG No data
Right 1176198602 20:63849298-63849320 CTCCAGATGACACCTCTGCCAGG No data
1176198596_1176198602 18 Left 1176198596 20:63849257-63849279 CCGCATCCAAACAACAGGAATGC No data
Right 1176198602 20:63849298-63849320 CTCCAGATGACACCTCTGCCAGG No data
1176198597_1176198602 12 Left 1176198597 20:63849263-63849285 CCAAACAACAGGAATGCTTGCCC No data
Right 1176198602 20:63849298-63849320 CTCCAGATGACACCTCTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176198602 Original CRISPR CTCCAGATGACACCTCTGCC AGG Intergenic
No off target data available for this crispr