ID: 1176201341

View in Genome Browser
Species Human (GRCh38)
Location 20:63862105-63862127
Sequence CTGTCTGCACCGCTCGAGGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 82}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176201335_1176201341 26 Left 1176201335 20:63862056-63862078 CCTCGTCATCTGCTGCGAAGGCA 0: 1
1: 0
2: 0
3: 8
4: 68
Right 1176201341 20:63862105-63862127 CTGTCTGCACCGCTCGAGGCCGG 0: 1
1: 0
2: 1
3: 4
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176201341 Original CRISPR CTGTCTGCACCGCTCGAGGC CGG Exonic
901449080 1:9325240-9325262 CCATCTGCACCGGTGGAGGCGGG - Intronic
902645818 1:17797195-17797217 GTTTCTGCACCTCTCCAGGCAGG + Intronic
904782898 1:32964256-32964278 CTGTCCGCACCGCTCGTGCCGGG - Exonic
906960906 1:50419068-50419090 CTGCCTGCGCCGCTGCAGGCGGG - Exonic
919723855 1:200869561-200869583 CTCTCTGCACTGCTGGAGCCAGG - Intergenic
920127353 1:203703882-203703904 CTTTCTGCACCGACCGAGACTGG + Intronic
920450799 1:206059789-206059811 GTGTCTCCATCCCTCGAGGCAGG + Intronic
1067432058 10:46251405-46251427 CTGTCTGCAGCTCTCCGGGCTGG + Intergenic
1067577826 10:47419211-47419233 CTGTCTGCAGCTCTCTGGGCTGG - Intergenic
1068739468 10:60452144-60452166 CTGTGTGCACCGCTAGAGGCTGG - Intronic
1069545679 10:69326387-69326409 CTGTCTGCAACACACAAGGCAGG - Intronic
1073025408 10:100483728-100483750 TGGTCTGCACCTCTAGAGGCAGG + Exonic
1073347663 10:102796442-102796464 CTGTCTACAGGGCTAGAGGCTGG - Intronic
1074473085 10:113744814-113744836 CTGTCTGCAGAGGTGGAGGCAGG - Intergenic
1076873236 10:133203716-133203738 CTGTCTGCACCGGTGAAGCCTGG + Intronic
1077475932 11:2790487-2790509 CTGTGTGCACAGCTGGATGCTGG - Intronic
1078489426 11:11755509-11755531 CTGTCTGGACCACTGGAGACAGG + Intergenic
1082771427 11:57210796-57210818 CTGTCTGCACCGTTGGAGGATGG - Intergenic
1083418946 11:62542885-62542907 CTGTCTGCCCCACCCAAGGCCGG + Intronic
1083710185 11:64543105-64543127 CTCTCTGGACCCCTCGAGGAGGG + Intergenic
1084871693 11:72102967-72102989 CTGCCTGCACACCCCGAGGCGGG + Intronic
1089001988 11:115059856-115059878 CTGTTTGTACTGCTGGAGGCTGG - Intergenic
1096087146 12:48873248-48873270 CTGTCTGGATCTCTCGAGGTCGG + Intergenic
1104020398 12:124988557-124988579 TTGTCTGCTCAGCTCCAGGCTGG - Intronic
1104068659 12:125326658-125326680 CTGTCTGCACCGGGGGAGGTCGG + Exonic
1108518353 13:51222842-51222864 TTGTCTGCATCGCTAGAGACAGG + Intronic
1110175461 13:72550544-72550566 CAGTCTGCTCCGCTGGATGCAGG + Intergenic
1120216387 14:81684956-81684978 CTGCCTCCACCTCTCTAGGCTGG + Intergenic
1120744745 14:88143173-88143195 CTGTATGCTCCCCTAGAGGCTGG + Intergenic
1121644569 14:95509060-95509082 CTGTCTCCAGCCCTCAAGGCGGG + Intergenic
1122696227 14:103553991-103554013 CTCTCAGCACCCCTTGAGGCAGG - Intergenic
1122791018 14:104184202-104184224 CTGTCTGCCCCGCTCCTTGCTGG + Intergenic
1123113523 14:105883667-105883689 CTGCCTGCACCTCTCAGGGCGGG + Intergenic
1123117781 14:105902413-105902435 CTGCCTGCACCTCTCAGGGCGGG + Intergenic
1123992527 15:25694177-25694199 CTGTCTGCTCCTCTCCAGGGAGG - Intronic
1126793789 15:52243785-52243807 CTCTCAGGACCCCTCGAGGCAGG + Intronic
1128034034 15:64507457-64507479 CTGTCAGCAGCTCTGGAGGCGGG - Intronic
1132868583 16:2105501-2105523 CTGTCAGCAGCGCAGGAGGCCGG + Intronic
1140702150 16:77591094-77591116 CTGGCTGCACCGCCCAAGACTGG + Intergenic
1147742845 17:42678452-42678474 CTGTCCCCACCGCTCCAGCCTGG - Intergenic
1149112183 17:53046911-53046933 CTGGCTGCAACCCACGAGGCTGG - Intergenic
1151350542 17:73529290-73529312 CTGCCTCCACCACTGGAGGCTGG + Intronic
1151445126 17:74158630-74158652 CTGTCTGCACTGATTTAGGCTGG + Intergenic
1151816490 17:76473867-76473889 ATGTGGGCACCGCTGGAGGCTGG + Exonic
1152230010 17:79109726-79109748 CTGTGTGCCCCTCTCCAGGCTGG - Intronic
1152465052 17:80461634-80461656 CTGCCTGCACTGCTCTCGGCTGG + Intergenic
1162128956 19:8513787-8513809 TTGTCCACACTGCTCGAGGCCGG - Intronic
1162368119 19:10261798-10261820 CTGGCTGCAACTCTCCAGGCTGG - Intergenic
925093196 2:1171914-1171936 CTGTCTGCACCAAGCGAGGCTGG + Intronic
926154769 2:10447883-10447905 CCGTCTTCACAGCTCGGGGCTGG - Intronic
926369286 2:12163872-12163894 CTGTCTGAACCGCTCAATACCGG + Intergenic
933847621 2:86337951-86337973 CTGTCTGCACCTGTCTAGGTGGG + Intronic
943564208 2:189498381-189498403 ATGTCTGCACAGCCAGAGGCTGG - Intergenic
944831092 2:203534909-203534931 CTGGCTGGACCGCTCCCGGCTGG - Intronic
1172771583 20:37385398-37385420 CTGTCTGCACCGCTGGGGCCCGG - Intronic
1172869620 20:38127965-38127987 CTATCTGAAGCCCTCGAGGCAGG - Exonic
1175626341 20:60491064-60491086 CTGTCTGCACCACCAGAGCCGGG + Intergenic
1175914450 20:62419217-62419239 CTTTCTGCCACGCTGGAGGCCGG + Intronic
1176201341 20:63862105-63862127 CTGTCTGCACCGCTCGAGGCCGG + Exonic
1179022710 21:37654804-37654826 CTGTCTGCACAGCCCCTGGCTGG + Intronic
1184823862 22:46933696-46933718 CTCTCTGCACTGCCCGGGGCGGG + Intronic
1185086082 22:48741762-48741784 CTGTCTGCAGCCCAGGAGGCTGG - Intronic
950105850 3:10387975-10387997 CTGTTTCCACCACTTGAGGCTGG + Intronic
951340795 3:21484422-21484444 CTATCTGCACCGCAGGAGTCTGG + Intronic
960795909 3:121487460-121487482 CTTTCTGAACTGCTTGAGGCTGG + Exonic
962247266 3:133806056-133806078 TTGGCTGCACCGCTGCAGGCCGG + Intronic
967576872 3:191104837-191104859 CTGTCTCCACCACTCGCCGCGGG - Intergenic
969675609 4:8612760-8612782 CTGCCTGCACCTCTCCATGCCGG + Intronic
972837569 4:42892251-42892273 CTGTCTGCACCTCCTGAGGGAGG - Intergenic
985894143 5:2739188-2739210 GTGTCTGCACCGCTCCCCGCGGG - Intergenic
985947160 5:3194809-3194831 CTGTCTGCACCCCCAGAGGACGG + Intergenic
987870865 5:23614995-23615017 CTGTCTGCCCCTGTTGAGGCAGG - Intergenic
989256490 5:39371274-39371296 CTGTGTGGACTGCTCTAGGCTGG - Intronic
1000367766 5:160506788-160506810 CTGGCTGTACCGCCCCAGGCAGG - Intergenic
1005372833 6:25153249-25153271 CTCGCTGCACCGCTGGGGGCAGG - Intergenic
1013009085 6:106103938-106103960 CTGTCTGCACATCGCGAGGAAGG + Intronic
1013912016 6:115287294-115287316 CTGTCTACACCTCACCAGGCAGG + Intergenic
1015543799 6:134342302-134342324 CTCTCTGCACAGCTTGAGGTTGG - Intergenic
1016283916 6:142451364-142451386 CTGGCTGCACCCCTGGATGCTGG - Intergenic
1020281548 7:6652655-6652677 CTTCCCGCACCGCTCGCGGCTGG + Exonic
1029496140 7:100896263-100896285 CTGTCGGTCTCGCTCGAGGCTGG + Intronic
1047001581 8:120578539-120578561 CTGACTGCAGCACTCAAGGCAGG - Intronic
1057623260 9:96655205-96655227 CTGTCGGGGCCGCTCGGGGCCGG + Exonic
1059322659 9:113481547-113481569 CTGTTTGCACAGCTGGAGTCAGG - Intronic
1060724003 9:125995513-125995535 CTGTCTCCATGGCTCCAGGCAGG - Intergenic
1061138635 9:128751140-128751162 CTGGTTGCAACGCTCGATGCGGG + Exonic
1062033878 9:134374207-134374229 CTGGCTGCATCGCTCTCGGCTGG - Intronic
1190979543 X:55443751-55443773 CTGACTCCACCTCTGGAGGCAGG + Intergenic