ID: 1176203710

View in Genome Browser
Species Human (GRCh38)
Location 20:63876820-63876842
Sequence CCAGGGACCCGGGTGGTTCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 126}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176203697_1176203710 11 Left 1176203697 20:63876786-63876808 CCCGGGCGGTTCTCGGCATGTTG 0: 1
1: 1
2: 0
3: 2
4: 49
Right 1176203710 20:63876820-63876842 CCAGGGACCCGGGTGGTTCGTGG 0: 1
1: 0
2: 2
3: 12
4: 126
1176203698_1176203710 10 Left 1176203698 20:63876787-63876809 CCGGGCGGTTCTCGGCATGTTGC 0: 1
1: 1
2: 0
3: 6
4: 44
Right 1176203710 20:63876820-63876842 CCAGGGACCCGGGTGGTTCGTGG 0: 1
1: 0
2: 2
3: 12
4: 126
1176203696_1176203710 12 Left 1176203696 20:63876785-63876807 CCCCGGGCGGTTCTCGGCATGTT 0: 1
1: 0
2: 0
3: 0
4: 18
Right 1176203710 20:63876820-63876842 CCAGGGACCCGGGTGGTTCGTGG 0: 1
1: 0
2: 2
3: 12
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176203710 Original CRISPR CCAGGGACCCGGGTGGTTCG TGG Intronic
900105338 1:978680-978702 CCAAGCACCCGGGTTGTTCAGGG - Intronic
900596923 1:3484123-3484145 CCTGGGACCCCGGCGGTTCATGG + Intergenic
901470682 1:9454385-9454407 CCAGGGACCCAGGCTGTTCCAGG + Intergenic
902140232 1:14347454-14347476 CTGGGGACCCGGGTGGATCTTGG - Intergenic
902354373 1:15886484-15886506 GCAGGGACCCGGCTGCTGCGTGG + Intronic
905643685 1:39609814-39609836 GCAGGGACCCGGGTGATGGGAGG + Intergenic
908272848 1:62437293-62437315 CCGGGGACCCGGCGGGCTCGGGG + Exonic
909828278 1:80153768-80153790 CCAGGCTCCGGGGTGGTTCTGGG + Intergenic
913937203 1:125065771-125065793 CCGGGGACCCGGGGGCTTGGGGG + Intergenic
915704452 1:157830581-157830603 CCAGAGACCAGTGTGGTTCTGGG + Intergenic
916991096 1:170246352-170246374 CCAGGGGCTGGGGTGGTTGGAGG + Intergenic
922411372 1:225378994-225379016 CCAGGGCCCCGGGAGGTGGGAGG - Intronic
922603585 1:226874974-226874996 CCAGGGAAAAGGGTGGTTTGTGG - Intronic
922674383 1:227541947-227541969 CCAGGGAGCCGGGTTGGGCGCGG + Intergenic
923563168 1:235057122-235057144 GCAGGGACCCAGGTGGTTGGAGG - Intergenic
1062927766 10:1329748-1329770 CCAAGCCCCCAGGTGGTTCGCGG - Intronic
1063663813 10:8050366-8050388 CCGCGGACCCGGCTGGTGCGGGG + Intergenic
1065138045 10:22691980-22692002 CCAGGGACTGGGGTGGTGTGGGG + Intronic
1066665698 10:37780782-37780804 CCAGGGTCCCGCGCGGCTCGGGG - Intronic
1068445386 10:57115586-57115608 CCAGGGACAGGGGTGGTGGGGGG + Intergenic
1070257675 10:74825680-74825702 CCGGGGACCCGGGTGGCCGGAGG + Intronic
1071475238 10:86019833-86019855 CCCAGGGCCAGGGTGGTTCGAGG + Intronic
1071919473 10:90333101-90333123 CCAGGGGCTTGGGTGGTTGGTGG - Intergenic
1075325063 10:121524827-121524849 CCAGGGACCGGGGAGGTTCCTGG - Intronic
1077432852 11:2524614-2524636 CCAGGGCCCCTGGTGGGTGGTGG + Intronic
1078168379 11:8910507-8910529 CCAGGTACTCGGGAGGGTCGAGG - Intronic
1083377068 11:62232652-62232674 CCAGGGACTCCAGTGGATCGGGG - Intergenic
1083757426 11:64799251-64799273 CCAGGGACCTGGAGGGTTAGGGG - Intronic
1084196128 11:67524285-67524307 CCAGGGGCCTGGCTGGTTCCTGG + Intergenic
1084978642 11:72816806-72816828 CCAGGGGCCCTGGTGGGTGGTGG - Exonic
1085353503 11:75815624-75815646 GCAGGGACCCGGAGGGCTCGCGG + Intronic
1090261910 11:125327402-125327424 CCAATGACCCGGATGGTTCAGGG - Intronic
1090272633 11:125398612-125398634 CCTGGGAACAGGGTGGTTTGAGG - Intronic
1092174685 12:6395211-6395233 GCAGGGACCTTGGTGGTTGGGGG - Intergenic
1092263316 12:6963593-6963615 CCAGGGACTCGGGTGGTGGGGGG + Intergenic
1092652024 12:10645246-10645268 CCAGAGAGCAGGGTGGTTCTGGG + Intronic
1092770442 12:11891783-11891805 TCAGTGACCCGGGTGCTTTGTGG + Exonic
1094819114 12:34211209-34211231 CCCCGGACCCAGGTGGGTCGTGG - Intergenic
1095038592 12:37419867-37419889 CCGGGGACCCGGGGGGTTGGGGG + Intergenic
1098823696 12:75266907-75266929 CCAGGGCCTAGGGTGGTTGGAGG + Intergenic
1100855979 12:98757541-98757563 CCAGGGGACCGGGTGGCTCCAGG - Intronic
1101843282 12:108342627-108342649 CCAGGGACCCAGCTGGCTGGGGG - Intergenic
1104973514 12:132541907-132541929 CCAGCAACCCGGATGGTTCGGGG - Intronic
1105293823 13:19071552-19071574 CCAGGCACCCAGGTGGTGAGGGG - Intergenic
1105596292 13:21842534-21842556 CCAGAGACTGGGGTGGTTAGGGG + Intergenic
1119554831 14:75545334-75545356 CCAGCTACCCGGGAGGCTCGGGG - Intronic
1120302865 14:82730588-82730610 CCAGGGAGCTGGGTGTTTTGAGG - Intergenic
1121127474 14:91417524-91417546 CCGGGGCCCCGGGTGGCTCCGGG - Intronic
1122859525 14:104576296-104576318 CCAGGCACCCTGGGGGTTGGTGG - Intronic
1122938580 14:104971073-104971095 CCAGATACCCTGGTGCTTCGAGG - Intronic
1127953540 15:63833606-63833628 CCGGGGACCCGGGGGATCCGCGG + Intronic
1132496225 16:264733-264755 CCAGGGACCCGGGTGTTCCGCGG + Intronic
1132932895 16:2467874-2467896 GCAGGGCCCCGGGGGGTTCCGGG - Intergenic
1133264405 16:4574832-4574854 CCCAGGACCCGGGAGGTTGGGGG - Intronic
1133315597 16:4881897-4881919 CCTGGGACCCGGGTGTTTATGGG - Exonic
1134193948 16:12144003-12144025 CCTGAGCCCCGGGTGTTTCGTGG - Intronic
1136573268 16:31109084-31109106 TCAGGGACCAGGGTGCGTCGAGG - Exonic
1139923293 16:70472715-70472737 CCAGGGGCCTGGGTGGTTTTGGG + Intronic
1142000432 16:87661220-87661242 ACAAGGACCCTTGTGGTTCGGGG + Intronic
1142263969 16:89055133-89055155 CCAGGCACCCGGGAGGTTAAAGG - Intergenic
1142623594 17:1179538-1179560 CCAGGCACCGGGCTGGTCCGGGG - Intronic
1144036966 17:11375941-11375963 CCAGGGACCAGGATGGTTTCAGG - Intronic
1144706198 17:17369971-17369993 CCAGGGACCAGGGTGGAAGGGGG - Intergenic
1144722738 17:17483502-17483524 CCAGGGACCCACCTGGTTCTGGG + Intronic
1144872368 17:18379149-18379171 CCAGAGAACCGGGTGGTCCAAGG - Intronic
1144873576 17:18384801-18384823 CCAGAGAACCGGGTGGTCCAAGG - Intronic
1145306968 17:21680731-21680753 CCTGGGACCCGTGGGGTTGGGGG + Intergenic
1145307879 17:21685391-21685413 CCTGGGACCCGTGGGGTTGGGGG + Intergenic
1147134740 17:38428416-38428438 GCAGGGACCCGGGAGGGGCGGGG - Exonic
1148238796 17:45986454-45986476 CAGGGGAGCCGGGTGGTTCCAGG + Intronic
1151748895 17:76025873-76025895 CCAGAGAGCCGGGTGGTCCAAGG + Intronic
1151984017 17:77530330-77530352 CCACGGACCCGGGTGGGGTGGGG + Intergenic
1152064770 17:78104795-78104817 CCAGGCAGCAGGGTGGTTAGCGG - Exonic
1159934244 18:74349670-74349692 CCATGGACCGGGGTGGTGGGGGG - Intronic
1161715937 19:5876465-5876487 TCAGGGGCACGGGTGGTTGGAGG - Intronic
1162084557 19:8240756-8240778 CCAGGGTCCTTGGGGGTTCGGGG + Intronic
1163367602 19:16884415-16884437 CCAGGGACCTGAGGGGTTGGAGG + Intergenic
1163522491 19:17799760-17799782 CCAGCGACCAGGCTGGTTAGGGG + Intronic
1165114550 19:33521386-33521408 CCAGGGACCCGGGCGCTTCCCGG - Intronic
1165464585 19:35966072-35966094 CCAGGGACCCTGGAGGCCCGGGG + Intergenic
1168064110 19:53909592-53909614 CAAGGGACCCGAGTGGCTCCAGG + Intronic
926152993 2:10434927-10434949 CCAGGGTCCCGGGGGCTTTGAGG - Intergenic
929555798 2:42924937-42924959 CCAGGGCCGTGGGTGGTTCTTGG - Intergenic
942812646 2:180017112-180017134 CCAGGGGCCCAGGTGGTGCCGGG - Intergenic
945225577 2:207529383-207529405 CCTGGGACCCGGGGGCGTCGTGG - Intergenic
948883637 2:240872602-240872624 CCAGGGACCAGGGTGGCACCAGG - Intronic
949063364 2:241974308-241974330 GCAGGGACCCGGGAGGTCAGAGG + Intergenic
1169557915 20:6768890-6768912 CCAGGGCCCGGGGTGGGTGGTGG + Intronic
1173868430 20:46327633-46327655 CCAGGGCCCAGGGTGTTTCCAGG - Intergenic
1174081761 20:47974906-47974928 CCAGGGACCCAGGTGGCTCTTGG - Intergenic
1174134692 20:48371691-48371713 CCAGGGACCCAGGTGGCTCTTGG + Intergenic
1176024896 20:62980971-62980993 CCGGGGACCCCGGTGGGTCTGGG - Intergenic
1176203710 20:63876820-63876842 CCAGGGACCCGGGTGGTTCGTGG + Intronic
1176203724 20:63876879-63876901 CTGGGGACCCGGGCGGTTCACGG + Intronic
1176203737 20:63876920-63876942 CCAGGGACCCGGGCGGTTTGTGG + Intronic
1176203751 20:63876979-63877001 CTGGGGACCCGGGTGGTTCATGG + Intronic
1176684905 21:9838758-9838780 CCTGGGACCCCGGTGGTGGGGGG + Intergenic
1178804992 21:35831773-35831795 CCGGGGACCCGGGTGGGTTGAGG - Intronic
1180955552 22:19739719-19739741 CCTGGGAACGGGCTGGTTCGGGG + Intergenic
1181029981 22:20144964-20144986 CCAGGGACTCGGGAGGGTGGTGG + Intronic
1182574923 22:31266598-31266620 CCAGGGAGCTGGGTGGATCGGGG - Intronic
1184864325 22:47193955-47193977 CCAAGGACCCGGGAGGGTTGGGG - Intergenic
1184968547 22:47998741-47998763 CCAGGCTCCCGTGTGGTTCCTGG + Intergenic
1185245337 22:49770147-49770169 CCAGGGACAGGAGTGGTCCGGGG + Intergenic
1185339328 22:50284513-50284535 CCAGGGCCCCGGGTGGGGTGGGG - Intronic
949986658 3:9546470-9546492 CCAGGTACCAGGGTGGTGCCTGG + Intronic
950249425 3:11452006-11452028 CCAGGGACTTGGGGGGTTGGGGG + Intronic
952316848 3:32238921-32238943 CCAGGGACCCCGGCGGGTCTGGG - Exonic
953123648 3:40070708-40070730 CCATGGACCAGGGTGGTAAGGGG - Intronic
954109071 3:48424277-48424299 CCAGGGGCCCTGGTGGTATGCGG - Exonic
954110277 3:48429559-48429581 GCGGGGTCCCGGGCGGTTCGGGG - Intronic
954909098 3:54088037-54088059 CCAGGGGCCCGGGTGCGTCAGGG - Intergenic
961385334 3:126520122-126520144 CAAGGGACCTGGGTGCTTAGGGG - Intergenic
962988767 3:140559806-140559828 CTAGGGACCAGGGTGGTTTAAGG - Intronic
984824337 4:183911004-183911026 CCAGGGACACAGCTGGTTTGTGG - Intronic
985590041 5:759832-759854 GCAGGGACCCGGGCGGCTCTGGG - Intronic
988724046 5:33907910-33907932 CCAGAGACTAGGGTGGTTGGGGG + Intergenic
996948266 5:129095165-129095187 CCCGGGTCCCGGGCGGCTCGGGG - Intronic
998374547 5:141682142-141682164 GCAGGGACCCGGGGGGCGCGGGG + Intronic
998457248 5:142282807-142282829 CCAGGGAGGCGGGTGGGTGGAGG + Intergenic
999166260 5:149551668-149551690 CCAGAGACCCGGCGGGTCCGAGG - Intergenic
1002789970 6:429949-429971 CCAGTTACCCTGGTGGTTTGTGG - Intergenic
1005838295 6:29723975-29723997 TGAGGGACCCGGGCGGTCCGTGG - Intronic
1006101072 6:31686748-31686770 TCAGGGACCGGGGAGGTTTGGGG + Intergenic
1006643931 6:35503531-35503553 CCAGGGGCCAGGGAGGTGCGGGG + Intronic
1007726846 6:43921786-43921808 CCATGGACCCGGGGGGTCCCGGG + Intergenic
1018239882 6:161763354-161763376 CCAGGGACAGGGGTGGGTCTCGG - Intronic
1018718332 6:166552857-166552879 CCAGGGACCAGCGTGGTTATCGG - Intronic
1018810585 6:167295239-167295261 CCAGGGACCCTGGTTGTGCCAGG + Intronic
1020970497 7:14931831-14931853 CCAGGGAGCGGGGTGGGTCGGGG + Intronic
1021177305 7:17463800-17463822 CCAAGGACCAGGGTGGATGGGGG - Intergenic
1021729969 7:23586461-23586483 CCAGGGTCCCGGGTTGGTGGGGG - Intergenic
1034527959 7:151678082-151678104 GGAGGGACACGGGTGGTTCTGGG - Intronic
1035294972 7:157861831-157861853 GCAGGGACACGGATGCTTCGAGG + Intronic
1037890506 8:22621604-22621626 CCAGGGAACCGTGTGCTTCAGGG + Intronic
1042690946 8:71498029-71498051 ACAGGGACTAGGGTGGTTGGGGG + Intronic
1047313462 8:123711460-123711482 CCAGGGACCAGGGTGGGATGAGG - Intronic
1054160781 9:61670948-61670970 CCTGGGACCCGGGGGGTGGGGGG + Intergenic
1061920265 9:133778733-133778755 CCTGGGGCCCGGGAGGGTCGAGG - Intronic
1185761435 X:2691891-2691913 CCTGAGACCCGGGTGGTGGGGGG + Intronic
1200162156 X:154015151-154015173 CCAGGGACCTGGGGCGTTGGGGG + Intronic