ID: 1176205840

View in Genome Browser
Species Human (GRCh38)
Location 20:63887693-63887715
Sequence CCTCAATTAATCCAGGAATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 125}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176205840_1176205843 -8 Left 1176205840 20:63887693-63887715 CCATATTCCTGGATTAATTGAGG 0: 1
1: 0
2: 0
3: 10
4: 125
Right 1176205843 20:63887708-63887730 AATTGAGGACTCCATTCCCTTGG 0: 1
1: 0
2: 1
3: 13
4: 127
1176205840_1176205847 11 Left 1176205840 20:63887693-63887715 CCATATTCCTGGATTAATTGAGG 0: 1
1: 0
2: 0
3: 10
4: 125
Right 1176205847 20:63887727-63887749 TTGGCAACCTCTGATGACTAAGG 0: 1
1: 0
2: 0
3: 6
4: 93
1176205840_1176205849 16 Left 1176205840 20:63887693-63887715 CCATATTCCTGGATTAATTGAGG 0: 1
1: 0
2: 0
3: 10
4: 125
Right 1176205849 20:63887732-63887754 AACCTCTGATGACTAAGGGCCGG 0: 1
1: 0
2: 1
3: 20
4: 156
1176205840_1176205848 12 Left 1176205840 20:63887693-63887715 CCATATTCCTGGATTAATTGAGG 0: 1
1: 0
2: 0
3: 10
4: 125
Right 1176205848 20:63887728-63887750 TGGCAACCTCTGATGACTAAGGG 0: 1
1: 0
2: 1
3: 6
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176205840 Original CRISPR CCTCAATTAATCCAGGAATA TGG (reversed) Intronic
900820440 1:4882621-4882643 CCTCATTTACTCCAGGGCTATGG + Intergenic
903470822 1:23586151-23586173 CCCTAATTAATCCTTGAATATGG - Intronic
905081841 1:35329719-35329741 CCTCAGTTAAACCAGAAAAAGGG - Intronic
912058421 1:105633497-105633519 CCTCAATTAGTCATTGAATATGG - Intergenic
912065925 1:105742805-105742827 CTTGAATTAATCCAGAAAGAGGG + Intergenic
915328846 1:155096679-155096701 TCTAAATGAATACAGGAATAGGG + Intergenic
916825570 1:168438742-168438764 CCTCATTTAATCCTCAAATAAGG + Intergenic
921521662 1:216163435-216163457 CCTCAAGTAATTCAGATATATGG - Intronic
923007672 1:230065038-230065060 CAGAAAATAATCCAGGAATAAGG - Intronic
1062852274 10:754062-754084 ACTCATTGAATCAAGGAATATGG + Intergenic
1063512026 10:6655071-6655093 CCTCCATTATTTAAGGAATAGGG + Intergenic
1070997125 10:80794858-80794880 TCCCAATTAATTCAGTAATAGGG + Intergenic
1071056338 10:81513623-81513645 TCTAATTTAATTCAGGAATAAGG - Intergenic
1076297798 10:129400749-129400771 CCACAATTATTCCAGAAATTTGG + Intergenic
1079326316 11:19495429-19495451 CCTCAATTAAGCCTGGTAAAGGG + Intronic
1079498011 11:21068173-21068195 CCTCCATTCATCCAGGCACAGGG - Intronic
1080509595 11:32955100-32955122 CTTAAATTATTCCAGAAATAGGG - Intronic
1083170002 11:60918091-60918113 CCTCAATTACTTCAGTAAAATGG + Intronic
1083615438 11:64023805-64023827 CCTCGATTAGACCAGGAAGAGGG - Intronic
1084732207 11:71080878-71080900 CCTGAATGAATGCAGGAACACGG + Intronic
1088060046 11:105636632-105636654 CCTCATTTAATGCAGCCATATGG + Intronic
1093403681 12:18778631-18778653 CCAAGACTAATCCAGGAATAAGG + Intergenic
1099256963 12:80326098-80326120 CCTCAAGTACTGCAGGTATAAGG - Intronic
1101505399 12:105341731-105341753 GCTCACTGAATCCAGTAATATGG + Intronic
1102529574 12:113536484-113536506 CCTAAAGTAACCCAGGAAGAAGG - Intergenic
1103243350 12:119433597-119433619 CCTCATTTAATACTGGGATATGG - Intronic
1106031452 13:26009303-26009325 CTTCAAATAAGCCAGGAATCAGG - Intronic
1106347366 13:28892140-28892162 CCTCAAGGAGTCCAGGAATATGG - Intronic
1112134626 13:96563242-96563264 TCACAATTTAACCAGGAATAGGG - Intronic
1114962219 14:27907667-27907689 TCTAAATCAATACAGGAATAAGG + Intergenic
1117746406 14:58874091-58874113 CCTCAATTAATCCAGAGAATTGG - Intergenic
1119367401 14:74105668-74105690 TCTCAATTAATGCAGGAAAGAGG - Intronic
1120170011 14:81238649-81238671 CCTCAATTGATCCATTCATATGG - Intergenic
1120393540 14:83939065-83939087 TCTCAATTAATTCAGAAATTGGG - Intergenic
1120742183 14:88120331-88120353 CATCAATTACCCCAGGAATGAGG - Intergenic
1123808687 15:23901113-23901135 TCACAATTAAACTAGGAATATGG + Intergenic
1124101406 15:26697554-26697576 CCTCAGATAATGCAGGAAGAGGG + Intronic
1133677759 16:8091438-8091460 CCTTAATTATTCCAGGATCAGGG - Intergenic
1137491723 16:48938587-48938609 CCTCAAATAGTTCAAGAATATGG + Intergenic
1138382254 16:56610814-56610836 TCTCATTTAATCCATAAATAGGG - Intergenic
1140101732 16:71923587-71923609 CTGCAATTAAGCCAGGAATCAGG + Intronic
1144733557 17:17542344-17542366 GCTCAGTTAATCCAGAAACAGGG + Intronic
1147481291 17:40766106-40766128 CCTCAATTAATAACAGAATAAGG - Intergenic
1150717596 17:67585151-67585173 CCTCCATTAATCATGGAGTAGGG + Intronic
1151636078 17:75349056-75349078 CTTCAAATAGTCTAGGAATAGGG + Intronic
1155463557 18:26110637-26110659 GATCAATGAATCCAGGAATTGGG - Intergenic
1155932131 18:31719215-31719237 TCACCATTAAGCCAGGAATAGGG + Intergenic
1158073962 18:53507041-53507063 CCTCAGTTACTACAGAAATAAGG + Intronic
1158223624 18:55177405-55177427 GTTCAATCAATCCAGGGATATGG - Intergenic
1159126747 18:64232854-64232876 CCTCAGTTAATCCAGGTAAGAGG - Intergenic
1159369502 18:67513230-67513252 CACCCATCAATCCAGGAATATGG + Exonic
1159480159 18:68980145-68980167 CCTACATCAAACCAGGAATATGG - Intronic
1161266927 19:3368401-3368423 CCTCAGTTTCTCCAGGAACAGGG + Intronic
1166822351 19:45588163-45588185 CCTCACTCATTCCAGGAAAAGGG - Intronic
928214003 2:29346242-29346264 TCTCAATCAATCCAGGAAGCAGG + Intronic
929677175 2:43948121-43948143 CCTTAATCAATTCAGGAACATGG + Exonic
932812372 2:74835405-74835427 TCTCAAGTAATCCAGGAACGCGG - Intronic
942074821 2:172347842-172347864 CCTGAAATAATTAAGGAATAAGG - Intergenic
943709519 2:191075345-191075367 TCTGAATTCATCCAGGAAAATGG + Intronic
944772788 2:202931470-202931492 CCTCAAACAATGCAGGAATTGGG - Intronic
944892677 2:204134008-204134030 CCTCAAATCATTCAGGAAAAAGG - Intergenic
945734945 2:213587367-213587389 CCTCAATTGACCCAGGTATGGGG - Intronic
947275344 2:228385550-228385572 GTTCAATTAAACCAGGAACAAGG + Intergenic
947441248 2:230123630-230123652 CATCAATTAATTCAGGGATTGGG - Intergenic
1171359177 20:24574681-24574703 TTTCAATTAATGCAGGAATATGG + Intronic
1175599628 20:60262731-60262753 CTTCATTGAATCCAGGGATATGG + Intergenic
1175804129 20:61817929-61817951 CCTCCAGTAACCCAGGAATTTGG + Intronic
1175992118 20:62794717-62794739 CCACAATTACTGCAGGCATAGGG - Intergenic
1176205840 20:63887693-63887715 CCTCAATTAATCCAGGAATATGG - Intronic
1177564508 21:22801172-22801194 GCTCAATCAATCCAGGAACAAGG + Intergenic
1181788162 22:25242628-25242650 TCTCCATTAATCCAGGAATTAGG + Intergenic
1181819905 22:25467641-25467663 TCTCCATTAATCCAGGAATTAGG + Intergenic
951006843 3:17627052-17627074 TCTAAAGTATTCCAGGAATAAGG + Intronic
951104484 3:18727066-18727088 ACTCAATAACTCCAGGATTAGGG - Intergenic
951635719 3:24773368-24773390 GATCAATTAATCCAGGCACAGGG - Intergenic
951736597 3:25872956-25872978 CCTCAATTATTCAAGGCTTATGG - Intronic
952285900 3:31969627-31969649 CCTCAAGTAATCAAGTAATCTGG - Intronic
955230150 3:57091823-57091845 CCTGAATTATTCCAGACATATGG - Exonic
955500958 3:59582339-59582361 CCTCATTTATTTCAGGAATTTGG + Intergenic
956852131 3:73238826-73238848 CATCAATGAATCCACGAATAGGG + Intergenic
960882364 3:122357956-122357978 CCTCAACTAATGAAGGAAGATGG - Intergenic
962433530 3:135343430-135343452 CCTCAATTAAACAAAAAATATGG + Intergenic
962536153 3:136330470-136330492 CCTCAATTCATGGAGGAATTAGG - Intronic
973826961 4:54717709-54717731 TTTAAATTAATCCAAGAATAGGG + Intronic
974590271 4:63939569-63939591 CATGAACTATTCCAGGAATATGG + Intergenic
974919142 4:68215736-68215758 CCTCAATTAAACAATGATTAAGG - Intergenic
976541859 4:86286726-86286748 CCTCAAGTACTTCAGGAATGAGG + Intronic
980750515 4:137081040-137081062 CCTCAATGAATTCATGAAGATGG - Intergenic
981655027 4:147103387-147103409 CCTCAAGTAACCCTGGAAAAGGG + Intergenic
986876460 5:12116911-12116933 CCTAAAATAATCCAGTAACAGGG + Intergenic
987625392 5:20392955-20392977 CTTCAACAAATCCAGCAATAGGG + Intronic
989415273 5:41167974-41167996 CTTCAATTAGGGCAGGAATAAGG - Intronic
991971851 5:72148965-72148987 CCTAAATTAATCCAGGTGAAGGG - Intronic
994770026 5:103969667-103969689 CCTCAATCAAGCAAGTAATAGGG - Intergenic
995160935 5:108980802-108980824 CTTCAAATAATTCAGTAATAGGG - Intronic
996882312 5:128313594-128313616 CCTTATTCAATCCAGTAATAAGG + Intronic
998873060 5:146571965-146571987 ACTCAATAAATCCAGGAGTTGGG - Intergenic
1004142173 6:13028450-13028472 CTTCAATCAATCCAGGAATCAGG + Intronic
1004449105 6:15728227-15728249 CCTCAAATAATGCAGGAGTTAGG - Intergenic
1005137586 6:22588100-22588122 CTTCAATTTATCCAGAAATGTGG - Intergenic
1006137469 6:31904050-31904072 CCTCATTTGGTACAGGAATAGGG - Intronic
1008714410 6:54271581-54271603 TCTCAATTATTCAGGGAATAGGG - Intergenic
1014340661 6:120202818-120202840 CCTCAATAAAGCTAGGAAAAAGG + Intergenic
1015525754 6:134174753-134174775 CCTCACTTACTCCAGGATGAGGG - Intronic
1015854719 6:137611248-137611270 CCTCGATCAATCCAGGCATCTGG + Intergenic
1018294603 6:162332101-162332123 CCAGAATTAATCCAGGCATGTGG + Intronic
1018463976 6:164025637-164025659 CCATAATTATTCCAGAAATAAGG + Intergenic
1018989385 6:168662093-168662115 CAACAGTTAATCAAGGAATATGG + Intronic
1021708157 7:23388481-23388503 ACTCAATTAACCGAGGAAAAAGG + Intronic
1023119968 7:36899313-36899335 CCTCAACTAGAGCAGGAATAAGG - Intronic
1026968354 7:74454074-74454096 CCTTAATTAATCCGGGAGAATGG - Exonic
1027933213 7:84567194-84567216 TTTCAGTTAATCCAGGAATTTGG - Intergenic
1030927169 7:115472618-115472640 TAGCAATTAATTCAGGAATATGG + Intergenic
1031203498 7:118722523-118722545 ACTAAATTACTCCAGAAATAGGG - Intergenic
1031651558 7:124297265-124297287 CATCAAATAATGCAGAAATAAGG - Intergenic
1032997453 7:137463934-137463956 CCTGAACTAAACCAGGAACAGGG - Intronic
1040370745 8:46770460-46770482 CCTCAGCTGATCCAGGCATAAGG + Intergenic
1040586776 8:48750807-48750829 CATCAATTAATCCATGAAAATGG - Intergenic
1040795299 8:51283910-51283932 CTTCAATGAATTCAAGAATAGGG + Intergenic
1043721013 8:83546830-83546852 CCTACATTAATCCACAAATATGG + Intergenic
1045623957 8:104019712-104019734 CCTAAATTATTGCAGGAAAATGG - Intronic
1046265142 8:111821421-111821443 GCTAAATAAATCCAGAAATAAGG - Intergenic
1046960079 8:120102345-120102367 CCTAAAATCATCCAGAAATAAGG - Intronic
1047050484 8:121106121-121106143 CCACAATTATACCAGGAAAATGG + Intergenic
1048335911 8:133502056-133502078 CCTCATTTATGCCAGGAATTGGG + Intronic
1048641802 8:136371492-136371514 GCTGAATAAATCCAGGAATAAGG - Intergenic
1049150426 8:141031703-141031725 CCTCATTTATTCCAGGGTTAAGG + Intergenic
1050908679 9:11038790-11038812 CATCAATTAAGGCAGGAACAGGG - Intergenic
1051105705 9:13577635-13577657 CATCAATCAATAAAGGAATAGGG + Intergenic
1051756666 9:20408304-20408326 TTTCAAATAAACCAGGAATATGG + Intronic
1056508184 9:87277327-87277349 CCTCATTTAATTCAGAAATAAGG - Intergenic
1060140936 9:121209348-121209370 CCTCACTGAAACCAGGACTAAGG + Intronic
1060806978 9:126583947-126583969 CCTCAATTCATCCAGGACACTGG + Intergenic
1188771807 X:34162625-34162647 CCCCAATGAATCCAGGATTCAGG - Intergenic
1194839311 X:98719544-98719566 TCTCCATTAATCCATTAATATGG - Intergenic
1198391502 X:136179737-136179759 CCTCCAACAATTCAGGAATATGG - Intronic