ID: 1176206522

View in Genome Browser
Species Human (GRCh38)
Location 20:63891624-63891646
Sequence GCCTGCCTCTCCCAAGGGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 274}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176206522_1176206531 19 Left 1176206522 20:63891624-63891646 CCGCACCCTTGGGAGAGGCAGGC 0: 1
1: 0
2: 0
3: 27
4: 274
Right 1176206531 20:63891666-63891688 AAAGGGCAGGTCCTCAATGCTGG 0: 1
1: 0
2: 3
3: 19
4: 169
1176206522_1176206528 1 Left 1176206522 20:63891624-63891646 CCGCACCCTTGGGAGAGGCAGGC 0: 1
1: 0
2: 0
3: 27
4: 274
Right 1176206528 20:63891648-63891670 GGGGACAGTGCTAAAGACAAAGG 0: 1
1: 0
2: 0
3: 16
4: 180
1176206522_1176206530 6 Left 1176206522 20:63891624-63891646 CCGCACCCTTGGGAGAGGCAGGC 0: 1
1: 0
2: 0
3: 27
4: 274
Right 1176206530 20:63891653-63891675 CAGTGCTAAAGACAAAGGGCAGG 0: 1
1: 0
2: 2
3: 12
4: 200
1176206522_1176206534 27 Left 1176206522 20:63891624-63891646 CCGCACCCTTGGGAGAGGCAGGC 0: 1
1: 0
2: 0
3: 27
4: 274
Right 1176206534 20:63891674-63891696 GGTCCTCAATGCTGGGACAAGGG 0: 1
1: 0
2: 0
3: 5
4: 132
1176206522_1176206532 20 Left 1176206522 20:63891624-63891646 CCGCACCCTTGGGAGAGGCAGGC 0: 1
1: 0
2: 0
3: 27
4: 274
Right 1176206532 20:63891667-63891689 AAGGGCAGGTCCTCAATGCTGGG 0: 1
1: 0
2: 1
3: 17
4: 145
1176206522_1176206529 2 Left 1176206522 20:63891624-63891646 CCGCACCCTTGGGAGAGGCAGGC 0: 1
1: 0
2: 0
3: 27
4: 274
Right 1176206529 20:63891649-63891671 GGGACAGTGCTAAAGACAAAGGG 0: 1
1: 1
2: 0
3: 12
4: 218
1176206522_1176206533 26 Left 1176206522 20:63891624-63891646 CCGCACCCTTGGGAGAGGCAGGC 0: 1
1: 0
2: 0
3: 27
4: 274
Right 1176206533 20:63891673-63891695 AGGTCCTCAATGCTGGGACAAGG 0: 1
1: 0
2: 1
3: 17
4: 176
1176206522_1176206535 28 Left 1176206522 20:63891624-63891646 CCGCACCCTTGGGAGAGGCAGGC 0: 1
1: 0
2: 0
3: 27
4: 274
Right 1176206535 20:63891675-63891697 GTCCTCAATGCTGGGACAAGGGG 0: 1
1: 0
2: 1
3: 6
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176206522 Original CRISPR GCCTGCCTCTCCCAAGGGTG CGG (reversed) Intergenic