ID: 1176206534

View in Genome Browser
Species Human (GRCh38)
Location 20:63891674-63891696
Sequence GGTCCTCAATGCTGGGACAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 132}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176206525_1176206534 22 Left 1176206525 20:63891629-63891651 CCCTTGGGAGAGGCAGGCAGGGG 0: 1
1: 0
2: 9
3: 56
4: 643
Right 1176206534 20:63891674-63891696 GGTCCTCAATGCTGGGACAAGGG 0: 1
1: 0
2: 0
3: 5
4: 132
1176206522_1176206534 27 Left 1176206522 20:63891624-63891646 CCGCACCCTTGGGAGAGGCAGGC 0: 1
1: 0
2: 0
3: 27
4: 274
Right 1176206534 20:63891674-63891696 GGTCCTCAATGCTGGGACAAGGG 0: 1
1: 0
2: 0
3: 5
4: 132
1176206527_1176206534 21 Left 1176206527 20:63891630-63891652 CCTTGGGAGAGGCAGGCAGGGGA 0: 1
1: 1
2: 8
3: 101
4: 819
Right 1176206534 20:63891674-63891696 GGTCCTCAATGCTGGGACAAGGG 0: 1
1: 0
2: 0
3: 5
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176206534 Original CRISPR GGTCCTCAATGCTGGGACAA GGG Intergenic