ID: 1176215207

View in Genome Browser
Species Human (GRCh38)
Location 20:63944650-63944672
Sequence GGCCGCGCTCACTGATGTCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 69}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176215203_1176215207 -10 Left 1176215203 20:63944637-63944659 CCCTCGATGTCCCGGCCGCGCTC 0: 1
1: 0
2: 0
3: 1
4: 39
Right 1176215207 20:63944650-63944672 GGCCGCGCTCACTGATGTCCCGG 0: 1
1: 0
2: 0
3: 5
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176215207 Original CRISPR GGCCGCGCTCACTGATGTCC CGG Exonic
900095540 1:938650-938672 GCCCGCCCTCACTCCTGTCCAGG + Intronic
900418238 1:2544778-2544800 GCCCCGGCTCACTGTTGTCCTGG - Intergenic
902159149 1:14515572-14515594 GGCCTCACTCACTGAGCTCCAGG + Intergenic
906722864 1:48022016-48022038 GGCAGGGATGACTGATGTCCTGG + Intergenic
907389911 1:54151521-54151543 AGCCAGGCACACTGATGTCCAGG + Intronic
920058738 1:203213249-203213271 GGAGGCAGTCACTGATGTCCAGG + Intronic
920263800 1:204707259-204707281 GGCAGCCCTCACTGTTGTCATGG - Intergenic
920723477 1:208411814-208411836 GGCAGCATTCACTGATGTCCTGG - Intergenic
922817856 1:228463809-228463831 GGACGTGCTCACTGAGGTCCGGG - Intergenic
1062785474 10:261128-261150 GGCCCCACTCACTGCTTTCCGGG - Intergenic
1076630080 10:131847041-131847063 GGCCACCCTCCCTGCTGTCCTGG - Intergenic
1081607903 11:44538599-44538621 GGCCCTGCTCACTGCTGTCCAGG - Intergenic
1089072183 11:115709357-115709379 GGCCACCCTCACTGTTGTTCAGG - Intergenic
1093158952 12:15722256-15722278 GGCCGCACTCAAAGCTGTCCTGG + Intronic
1097037635 12:56134189-56134211 GGCCACCCACAATGATGTCCTGG - Intronic
1112325423 13:98440225-98440247 GGCCACACTCACTGTTGTCAGGG - Exonic
1113302483 13:109037281-109037303 GGCGGCCCTCAGTGAAGTCCAGG + Intronic
1126734048 15:51713918-51713940 GGCCCTGCTCAGTGATGTCATGG + Intronic
1128361478 15:66964771-66964793 GGCCTCAGTCACAGATGTCCTGG - Intergenic
1128380089 15:67106017-67106039 GACAGGGCTCAGTGATGTCCTGG - Intronic
1131255746 15:90860843-90860865 GGCCCCTCTCCCTGAAGTCCTGG - Intergenic
1132633268 16:930000-930022 GGACGCGACCACTGCTGTCCTGG - Intronic
1132932946 16:2468051-2468073 GGCCGCGCTCAGTGCGGGCCTGG + Intergenic
1135404900 16:22190792-22190814 TTCCCCGCTCACTGATTTCCTGG + Exonic
1137883308 16:52075443-52075465 GCCTGTACTCACTGATGTCCTGG - Intronic
1138443923 16:57051476-57051498 GGCCGTGCTCCCTGCTTTCCTGG + Intronic
1141823318 16:86462663-86462685 GGCCCTGCACACTGATGGCCTGG - Intergenic
1142340425 16:89518612-89518634 GGCCCCGCTCACTGATAACGCGG + Intronic
1142990078 17:3724376-3724398 GGCCGCACACGCTGAGGTCCGGG - Exonic
1143578216 17:7807550-7807572 AGCCGCGCTCGCTGAGGCCCAGG + Exonic
1144863050 17:18317769-18317791 GGCTGGTCTTACTGATGTCCCGG - Exonic
1148591104 17:48817237-48817259 GGGCGCGCCCACGGTTGTCCCGG + Intergenic
1152362579 17:79839478-79839500 GGCCCCGCCCGCTGACGTCCGGG - Intergenic
1152575287 17:81137338-81137360 GGCTGGGCGCACTGGTGTCCTGG - Intronic
1152763405 17:82121705-82121727 GGACGCGCTGACTGAGGCCCAGG - Intronic
1162022076 19:7872608-7872630 GGCGCTGCTCACTGATTTCCGGG + Exonic
1165070258 19:33251449-33251471 GCCCCACCTCACTGATGTCCTGG + Intergenic
1165561751 19:36686486-36686508 GGCCAGGGTCACTGATATCCAGG + Intergenic
929571313 2:43024740-43024762 CGCCCTGCTCACAGATGTCCAGG + Intergenic
936096388 2:109533280-109533302 GGCTGCGCTCACTGCTGACCTGG + Intergenic
942098585 2:172556336-172556358 GGCCGCACTCACCGAAGTCCAGG - Exonic
943716346 2:191156330-191156352 GGCCGCACTCAAAGCTGTCCTGG + Intergenic
1172274908 20:33674208-33674230 GCCCGCGCCCACTCACGTCCTGG + Exonic
1176215207 20:63944650-63944672 GGCCGCGCTCACTGATGTCCCGG + Exonic
1179940463 21:44636431-44636453 GGCCACGCTCACTGAAGGGCTGG - Intronic
1180876723 22:19178308-19178330 GGCCGCGCCGACCGAAGTCCGGG - Intronic
952238930 3:31509794-31509816 GGAAACCCTCACTGATGTCCAGG + Intergenic
961714721 3:128850383-128850405 GGAGGCGCCCTCTGATGTCCAGG + Intergenic
967309424 3:188091996-188092018 GGCCCCACTCACAGGTGTCCAGG + Intergenic
969297436 4:6278216-6278238 GGCCGAGCTGACTGAGGCCCTGG + Intronic
973533888 4:51861386-51861408 GGCCCAGCTCACCGAAGTCCTGG + Intronic
973916189 4:55636616-55636638 GGCGACGCTCTCTGGTGTCCTGG + Intronic
981069933 4:140524155-140524177 GGCCTCGCTCCCTGACTTCCGGG + Exonic
982356476 4:154474566-154474588 TGCTGCCCTCACTGCTGTCCAGG + Intronic
1001751867 5:174137453-174137475 GGCCGCCCTCTCAGATGTGCGGG + Intronic
1002567299 5:180119203-180119225 GGCCGGGCTCTCTGAAGGCCTGG - Intronic
1004428534 6:15523088-15523110 CCCCACCCTCACTGATGTCCCGG + Exonic
1005957270 6:30672883-30672905 AGCCGCGCTCACTGCTGGGCCGG + Exonic
1017178370 6:151526246-151526268 GGCGTCTCTCTCTGATGTCCAGG + Intronic
1019302581 7:315061-315083 TTCTGCGCTCACTGATGCCCTGG + Intergenic
1019327830 7:446846-446868 TGGGGCCCTCACTGATGTCCAGG - Intergenic
1022787407 7:33652248-33652270 GGCAGAGCACACTGATCTCCTGG - Intergenic
1023852628 7:44158776-44158798 GGCCCCGGACACTGGTGTCCTGG + Intronic
1033299326 7:140173113-140173135 GGCCCCGCTCCCTTATCTCCAGG - Intronic
1042828407 8:73001301-73001323 GGCCGCACTCAAAGCTGTCCTGG + Intergenic
1049249916 8:141582791-141582813 GGCAGCACGCACTGATGCCCGGG - Intergenic
1049317571 8:141977432-141977454 GGCCAGGCTCACTGAGGACCTGG + Intergenic
1060221534 9:121766560-121766582 TGAGCCGCTCACTGATGTCCGGG - Exonic
1060354945 9:122897160-122897182 GGCCGCATTCAAAGATGTCCTGG + Intronic
1061575150 9:131501718-131501740 TGCAGCCCCCACTGATGTCCAGG + Intergenic
1061716409 9:132521128-132521150 GGCCGGGCTCTCTGTTCTCCAGG + Intronic
1061859879 9:133462578-133462600 GGCCCCCCTCAGTGATGGCCTGG + Intronic
1185505689 X:631065-631087 CGCCGCCCTCCGTGATGTCCTGG - Exonic
1198531119 X:137550130-137550152 GGCCGCGGACACTGCTGGCCTGG - Intergenic
1200128977 X:153830829-153830851 GGCCGCGCTCTCGGAGCTCCCGG + Intergenic