ID: 1176215207

View in Genome Browser
Species Human (GRCh38)
Location 20:63944650-63944672
Sequence GGCCGCGCTCACTGATGTCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 69}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176215203_1176215207 -10 Left 1176215203 20:63944637-63944659 CCCTCGATGTCCCGGCCGCGCTC 0: 1
1: 0
2: 0
3: 1
4: 39
Right 1176215207 20:63944650-63944672 GGCCGCGCTCACTGATGTCCCGG 0: 1
1: 0
2: 0
3: 5
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176215207 Original CRISPR GGCCGCGCTCACTGATGTCC CGG Exonic