ID: 1176215349

View in Genome Browser
Species Human (GRCh38)
Location 20:63945180-63945202
Sequence AGAGGCCTTGTGGAGGCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 677
Summary {0: 1, 1: 0, 2: 4, 3: 58, 4: 614}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176215338_1176215349 9 Left 1176215338 20:63945148-63945170 CCCATGCTCAGCACACAGTAGTT 0: 1
1: 0
2: 3
3: 52
4: 283
Right 1176215349 20:63945180-63945202 AGAGGCCTTGTGGAGGCTGGGGG 0: 1
1: 0
2: 4
3: 58
4: 614
1176215339_1176215349 8 Left 1176215339 20:63945149-63945171 CCATGCTCAGCACACAGTAGTTG 0: 1
1: 1
2: 2
3: 44
4: 278
Right 1176215349 20:63945180-63945202 AGAGGCCTTGTGGAGGCTGGGGG 0: 1
1: 0
2: 4
3: 58
4: 614
1176215337_1176215349 10 Left 1176215337 20:63945147-63945169 CCCCATGCTCAGCACACAGTAGT 0: 1
1: 0
2: 5
3: 33
4: 242
Right 1176215349 20:63945180-63945202 AGAGGCCTTGTGGAGGCTGGGGG 0: 1
1: 0
2: 4
3: 58
4: 614

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176215349 Original CRISPR AGAGGCCTTGTGGAGGCTGG GGG Intronic
900310532 1:2031276-2031298 AGAGGCCTGGAGGGGGCTAGAGG + Intergenic
900540940 1:3202361-3202383 GGAAGCCTAGGGGAGGCTGGGGG + Intronic
900643753 1:3699455-3699477 AGAGCCCCTGTCCAGGCTGGAGG + Intronic
900796152 1:4709463-4709485 TGAGGCCTGGTGGAGCCTGAAGG + Intronic
901039320 1:6354677-6354699 AGAGGCCATGGGGGGGCTAGAGG - Intronic
901039330 1:6354707-6354729 AGAGGCCATGGGGGGGCTAGAGG - Intronic
901039340 1:6354737-6354759 AGAGGCCATGGGGGGGCTAGAGG - Intronic
901039350 1:6354767-6354789 AGAGGCCATGGGGGGGCTAGAGG - Intronic
901170081 1:7250502-7250524 AGAGGCATTCTGGAGTCTGTTGG + Intronic
901209403 1:7515916-7515938 AAAGGGATTGTGGAGCCTGGTGG + Intronic
901872445 1:12145965-12145987 AGGGGCCTGGTGGAGGGTGCAGG - Intergenic
902221255 1:14967337-14967359 AGTGACCATCTGGAGGCTGGGGG - Intronic
902532021 1:17096673-17096695 ACAGGCTTTGTGGAGACTGTAGG + Intronic
902651689 1:17841598-17841620 AGAGGCCAAGAGGGGGCTGGAGG - Intergenic
903154852 1:21436488-21436510 AGACGCCTAGGCGAGGCTGGGGG - Intergenic
904424492 1:30414744-30414766 AGAGTCTCTGTGGAGGCTGCAGG - Intergenic
904939117 1:34152472-34152494 AAGGGCATTGAGGAGGCTGGAGG - Intronic
904953810 1:34266394-34266416 GCAAGCCTTGTGGAGGCAGGAGG + Intergenic
904957061 1:34293481-34293503 AGGGGCCTTTTGGAGGGTGGAGG - Intergenic
905251661 1:36652851-36652873 AGAGAGGTTTTGGAGGCTGGAGG + Intergenic
905307068 1:37027177-37027199 AGAGGCAGTGTGGACCCTGGAGG + Intronic
905891643 1:41521921-41521943 GGTGGCCCTGTGGTGGCTGGGGG - Intronic
906209891 1:44006893-44006915 AGAGGCCCTGTGGTGACTTGCGG + Intronic
906213342 1:44024445-44024467 AGAGGGCCTGGGCAGGCTGGTGG - Intronic
906686526 1:47766690-47766712 AGAGGCTGTGTGGTGGCTGGCGG + Intronic
906739141 1:48164156-48164178 TGGGGCCTTTTGGAGGGTGGAGG + Intergenic
907613604 1:55900055-55900077 TGGGGCCTGTTGGAGGCTGGAGG + Intergenic
907768649 1:57437682-57437704 AGTGCACTTGTGGGGGCTGGGGG - Intronic
907792278 1:57678599-57678621 AGAGGCCTGAGGAAGGCTGGAGG + Intronic
909045911 1:70709501-70709523 CGGGGCCTTTTGGAGGGTGGAGG - Intergenic
909659536 1:78066870-78066892 TGGGGCCTAGTGGAGGGTGGAGG + Intronic
912255739 1:108056178-108056200 GGAGGCCTTTTGGAGGGTAGAGG + Intergenic
913119517 1:115726962-115726984 AGATGGCATGTGGGGGCTGGGGG - Intronic
914324873 1:146602790-146602812 TGAGGCCTAGTGGAGGGTGGAGG - Intergenic
914355746 1:146882707-146882729 ACAGGCCTCGTGGAGGGAGGGGG - Intergenic
915534252 1:156525295-156525317 AGAGGGCTGGGGGAGGCTGCAGG + Intergenic
915537535 1:156546173-156546195 AGAGGCCTTAAGGAGCCTGGTGG - Intronic
916016716 1:160756240-160756262 AGAGGGCTGCTGGAGGCTGAGGG + Intergenic
916500651 1:165384129-165384151 AGAGGCTGTGGGGAAGCTGGAGG - Intergenic
916864324 1:168838849-168838871 TGAGGCCTATTGGAGGATGGGGG + Intergenic
917392364 1:174552328-174552350 TGGGGCCTTTTGGAGGGTGGAGG - Intronic
918482858 1:184998351-184998373 TGGGGCCTTCTGGAGGGTGGAGG + Intergenic
919173301 1:193986422-193986444 TGGGGCCTTTTGGAGGGTGGAGG - Intergenic
919819334 1:201463093-201463115 AGAGGGCAGGTGGAGGGTGGAGG - Intergenic
920030490 1:203034701-203034723 AGAGGCCTTCCCCAGGCTGGAGG + Intronic
920666401 1:207965744-207965766 AGTGGCCTTGGGGAGGCGGTGGG + Intergenic
921677370 1:217991056-217991078 AGAGTCCTAGTGGGGGCCGGGGG + Intergenic
922008118 1:221552579-221552601 TGTGGCCTTTTGGAGGGTGGAGG + Intergenic
922221204 1:223609939-223609961 CGAGGCCCTGGGGAGGCTGGGGG - Intronic
923210468 1:231799662-231799684 AGAGGCCTGGAGAAGGCAGGAGG + Intronic
923262839 1:232283834-232283856 ACAGGCATTGTGGAGGCTACTGG + Intergenic
924083025 1:240419561-240419583 AGTGGCCATGTGGAAGCTGTGGG + Intronic
924118472 1:240771604-240771626 AGAAGCCTGGAGGAGGCTGACGG + Intergenic
924384589 1:243489467-243489489 ACAGGCTTTTTGGAGGATGGTGG + Intronic
1063581978 10:7316376-7316398 AGGGGCTGGGTGGAGGCTGGTGG + Intronic
1064120559 10:12614742-12614764 ATAAGCCTTGTGGAGGGTGAGGG - Intronic
1064497784 10:15932147-15932169 TGGGGCCTTTTGGAGACTGGAGG - Intergenic
1066113637 10:32220185-32220207 TGAGGCCTTATAGAGGGTGGAGG + Intergenic
1067199713 10:44156715-44156737 AGAGGCCCTGAGGCTGCTGGAGG + Intergenic
1067853491 10:49769967-49769989 AAAGTCATTCTGGAGGCTGGTGG + Intergenic
1068728151 10:60326115-60326137 TGGGGCCTTTTGGAGGGTGGAGG + Intronic
1069527435 10:69185401-69185423 AGTGGCCTGGTGAAGGCTTGAGG + Intronic
1069558892 10:69415904-69415926 AGGGTCCTTGGGGAAGCTGGGGG - Intronic
1069825107 10:71250131-71250153 AGAGGCCTTCAGCAGGCAGGTGG - Intronic
1070154551 10:73825376-73825398 AGTGGCCTTGGGGACTCTGGAGG - Intronic
1070283756 10:75069218-75069240 GGAAGCCCTGAGGAGGCTGGAGG + Intergenic
1070369682 10:75770652-75770674 ATTGGCCTTGTGGAGGCCGAGGG + Intronic
1070380754 10:75878488-75878510 AAAGGCCTTGTGGTGTCTGCTGG + Intronic
1070396677 10:76017276-76017298 AGACGCCATGTGAAGGCTGGAGG + Intronic
1070707974 10:78655628-78655650 TGAGGACTTGGGCAGGCTGGAGG - Intergenic
1070830575 10:79415656-79415678 AAAGGCCTTGTTGATTCTGGTGG + Intronic
1070890149 10:79937031-79937053 AAATTCCTTCTGGAGGCTGGTGG - Intergenic
1071184295 10:83023078-83023100 AGGGGCCTGTTGGAGGGTGGGGG + Intergenic
1071526034 10:86359014-86359036 TGGGTCCTTCTGGAGGCTGGAGG - Intronic
1072313346 10:94178364-94178386 GGAGGCCTTGTAGAAGCTGCTGG - Intronic
1072410908 10:95201318-95201340 ATAGACATTGGGGAGGCTGGAGG - Intronic
1073433683 10:103503121-103503143 AAAGGCCCTGTGGAGCCTGTGGG + Intronic
1073669262 10:105569182-105569204 TGAGGCCTTTTGGAGGGTGGAGG + Intergenic
1074409583 10:113214725-113214747 AGAAGCATTGTGGGGGTTGGGGG - Intergenic
1075836353 10:125456700-125456722 TGGGGCCTTGTGGAGGGTGGAGG + Intergenic
1075874505 10:125795254-125795276 AGAGGCATTGTCTAGGCTGCTGG - Intronic
1076293707 10:129367771-129367793 GCAGGCCCTGTGGAGGTTGGTGG - Intergenic
1076629776 10:131845615-131845637 AGAGGCCACGGGGAGGGTGGCGG - Intergenic
1076629796 10:131845702-131845724 AGAGGCCACGGGGAGGGTGGCGG - Intergenic
1076698364 10:132257732-132257754 AGGGGCCTGGTGGAGGGTGGGGG - Intronic
1076706457 10:132304743-132304765 AGATGACTTGAGGAGTCTGGTGG + Intronic
1077064594 11:635249-635271 AGAAGTTTAGTGGAGGCTGGGGG + Intergenic
1077196245 11:1281912-1281934 GGAGACCTTGGAGAGGCTGGCGG - Intronic
1077284186 11:1758591-1758613 CGAGGGCTTGGGGAGGCTTGGGG - Intronic
1078011550 11:7576521-7576543 AGGGGCCTTGGAAAGGCTGGCGG - Intronic
1078121316 11:8512544-8512566 AGAGTGTTTGTGGAGGCAGGAGG + Intronic
1078372060 11:10756408-10756430 TGGGGCCTTTTGGAGGGTGGAGG - Intronic
1078432551 11:11298952-11298974 TGGGGCCTGGTGGAGGTTGGAGG - Intronic
1078462144 11:11522177-11522199 AGAGGTCATGTGGAGGTAGGAGG - Intronic
1079593086 11:22205184-22205206 TGGGGCCTTTTGGAGGATGGAGG + Intronic
1079906412 11:26253390-26253412 TGGGGCCTTTTGGAGGGTGGAGG + Intergenic
1080193661 11:29581894-29581916 TGGGGCCTTTTGGAGGGTGGAGG + Intergenic
1080261628 11:30355441-30355463 AGAGGCCTTGTGGTAACTGAGGG - Intergenic
1080747852 11:35125129-35125151 CGAGGCCTATTGGGGGCTGGGGG + Intergenic
1080763508 11:35275175-35275197 AGAGCCCTCCTGGAGGGTGGAGG + Intronic
1081074454 11:38652607-38652629 CAAGGACTTGTGGAGGGTGGTGG - Intergenic
1081354930 11:42101054-42101076 TGAGGCCTTTTGGAGAGTGGAGG - Intergenic
1081437585 11:43043909-43043931 TGGGGCCTTTTGGAGGGTGGAGG - Intergenic
1081626672 11:44660037-44660059 AGAGGCCCTGTGAGGGATGGGGG - Intergenic
1082078390 11:47992964-47992986 AGATGCCTGGTGGGGGATGGAGG + Intronic
1083069229 11:59959948-59959970 TGGGGCCTTTTGGAGGGTGGAGG + Intergenic
1083515067 11:63249700-63249722 TGGGGCCTTTTGGAGGATGGAGG + Intronic
1083747895 11:64745334-64745356 ACAGGCCTAGTGGAGGTCGGGGG + Exonic
1083756854 11:64796585-64796607 AGAGGCCTTGTGGGGGCCTGGGG - Intronic
1083899327 11:65636167-65636189 ACAGCCCTTGTGAAGCCTGGGGG - Exonic
1083955791 11:65982192-65982214 AGAGGCTTGGAGGAGCCTGGAGG - Intergenic
1084641485 11:70429178-70429200 AGAGGCCAGGAGGAAGCTGGAGG + Exonic
1085000081 11:73025477-73025499 TGAGGCCTTTTGGAGGGTGGAGG + Intronic
1085298187 11:75442711-75442733 TGTGGCCATGTGGAGGCTGTAGG + Intronic
1086041006 11:82478916-82478938 TGAGGCCTTTTGGAGAATGGAGG + Intergenic
1086830775 11:91560440-91560462 AGAAGCCTACTGGAGGGTGGAGG - Intergenic
1087310273 11:96533595-96533617 GGAGGCCTATTGGAGGGTGGAGG + Intergenic
1088057761 11:105606160-105606182 TGGGGCCTTTTGGAGGGTGGAGG + Intergenic
1088523198 11:110722097-110722119 TGGGGCCTTTTGGAGGGTGGAGG - Intergenic
1088945627 11:114509758-114509780 AGGGGCCTGTTGGAGGGTGGAGG + Intergenic
1089085629 11:115814823-115814845 AGAGACCATGTGGAGGGAGGAGG - Intergenic
1089306230 11:117528020-117528042 AACGGCCTTGTGAAGTCTGGAGG - Intronic
1089306327 11:117528550-117528572 AGATGCCCTGGGGAGGCTGCTGG + Intronic
1089571838 11:119416357-119416379 GCAGGCCTTGTGGAGGCTGTGGG - Intergenic
1090073003 11:123560536-123560558 GGGGGCCCTGAGGAGGCTGGAGG - Intronic
1090178439 11:124673036-124673058 AGTGGCATAGGGGAGGCTGGTGG - Intronic
1090198746 11:124839334-124839356 AGAGGCCGTGGAGAGGCCGGCGG - Intergenic
1090223839 11:125056484-125056506 AGAGGCGGGGTGGGGGCTGGGGG + Intergenic
1090512171 11:127387006-127387028 GGAGGCATGATGGAGGCTGGTGG - Intergenic
1090658690 11:128865146-128865168 AGGGGCCTACTGGAGGCAGGGGG - Intronic
1090954736 11:131504099-131504121 AGGGGCCTGGAGGAAGCTGGTGG - Intronic
1091302137 11:134514599-134514621 AGGGGCCTTGTGTAGACTGGTGG - Intergenic
1091615038 12:2044315-2044337 AGTGGCCAAGTGGAGCCTGGTGG - Intronic
1091966798 12:4750347-4750369 TGAGGCCTTTTGGAGGGTGGAGG - Intronic
1091994400 12:4981918-4981940 ACAGGCCTTGTGTAGGCTCTGGG + Intergenic
1092083277 12:5735687-5735709 ACAGGCCTTGCAGAGTCTGGGGG + Intronic
1092155767 12:6280699-6280721 AGCAGCCATGTGGAGCCTGGAGG - Intergenic
1092514158 12:9190531-9190553 TGAGGCCTATTGGAGGGTGGAGG + Intronic
1092570833 12:9719620-9719642 CATGGCCTTCTGGAGGCTGGAGG + Intronic
1092988905 12:13875637-13875659 AGAGGCTTTGTGGAGGGATGCGG - Intronic
1093790119 12:23238881-23238903 AAGGGCCTTGAGGAGGCTGCTGG + Intergenic
1096310190 12:50513925-50513947 AGAGGACTCACGGAGGCTGGTGG - Intronic
1096314477 12:50552022-50552044 AGAGCCCTTGTGCATGCTGGTGG - Intronic
1096323600 12:50637801-50637823 AGATAACATGTGGAGGCTGGTGG + Intronic
1096463229 12:51834354-51834376 AGAGGCCCTGTGGAGTCTCTGGG - Intergenic
1096500822 12:52063051-52063073 AGAGACCTTCTGAAGGCAGGAGG + Intergenic
1097630964 12:62061939-62061961 AGAGGCCCAGGGGAGGCTCGGGG + Intronic
1097725760 12:63074137-63074159 TGGGGCCTTTTGGAGGGTGGAGG - Intergenic
1099289731 12:80761836-80761858 AGGGGCCAGGTGGGGGCTGGGGG + Intergenic
1099656113 12:85494131-85494153 TGGGGCCTTTTGGAGGGTGGCGG - Intergenic
1100287741 12:93183419-93183441 TGGGGCCTTTTGGAAGCTGGAGG - Intergenic
1100905684 12:99295762-99295784 TGGGGCCTTTTGGAGGGTGGAGG - Intronic
1101284335 12:103294923-103294945 TGGGGCCTTTTGGAGGGTGGAGG - Intronic
1101541372 12:105668694-105668716 AGAGGGGATGGGGAGGCTGGTGG + Intergenic
1101857122 12:108453086-108453108 GGAATCTTTGTGGAGGCTGGGGG + Intergenic
1102660396 12:114522161-114522183 TGGGGCCTTTTGGAGGGTGGAGG + Intergenic
1102753329 12:115315491-115315513 AAGGGCCTTGAGGAGGGTGGTGG - Intergenic
1103735534 12:123058523-123058545 AGAGGCCCTGGAGAGGCTGTGGG - Intronic
1103939970 12:124496230-124496252 AGAAGCCTTGTTGGGGGTGGGGG - Intronic
1104342387 12:127962920-127962942 AAAGTCCTTGTGGAGGCTGGTGG - Intergenic
1104393074 12:128407601-128407623 AGAGACCATGTGGAGGCGAGCGG - Intronic
1104396545 12:128438762-128438784 AGAGGCTTTGGGGAGACAGGAGG - Intronic
1104941711 12:132398339-132398361 AGAGGCCATGGGGACACTGGTGG - Intergenic
1105407400 13:20143564-20143586 AGAGGGCTTGAGCAGTCTGGAGG - Intronic
1105883849 13:24625906-24625928 AGAGGCCTCATGGAGGAAGGAGG + Intergenic
1106602429 13:31199739-31199761 AGAGGAGGGGTGGAGGCTGGTGG + Intergenic
1106673897 13:31936733-31936755 AGAGGCAAAATGGAGGCTGGAGG - Intergenic
1107634712 13:42380651-42380673 GGAGGCCTGGCCGAGGCTGGTGG + Intergenic
1108291601 13:48967417-48967439 ACAGGCGTTGTGGGGGTTGGGGG - Intergenic
1108944709 13:56007065-56007087 GGAGACTGTGTGGAGGCTGGTGG + Intergenic
1109175986 13:59156274-59156296 TGGGGCCTTTTGGAGGGTGGAGG + Intergenic
1110787293 13:79544438-79544460 AGAGGCCTTCAAAAGGCTGGGGG - Intronic
1110848709 13:80219453-80219475 TGAGGCCTTTTGGAGGGTGCAGG - Intergenic
1111514893 13:89316942-89316964 TGAGGCCTGCTGGAGGGTGGCGG + Intergenic
1112266904 13:97932633-97932655 TGGGGCCTTTTGGAGGGTGGAGG - Intergenic
1113369240 13:109707566-109707588 AGAGCCCTTCTCTAGGCTGGAGG + Intergenic
1113599441 13:111558197-111558219 AGACGTCTTGGGGAAGCTGGTGG + Intergenic
1113655411 13:112065592-112065614 AGAGTGCTTGTGGAGATTGGTGG - Intergenic
1114893888 14:26961364-26961386 ACAGGCATTTTGGAGCCTGGAGG + Intergenic
1116299162 14:43154894-43154916 TGGGGCCTTTTGGAGGGTGGAGG - Intergenic
1116361479 14:44004098-44004120 AGGGGCCTATTGGAGGGTGGAGG + Intergenic
1116582743 14:46662793-46662815 AGAGGCCTATTGGAAGTTGGAGG + Intergenic
1118119322 14:62820493-62820515 TGAGGCCTAGTGGAAGATGGAGG - Intronic
1119710399 14:76818018-76818040 AGGGGTCTTTTGGAGGATGGTGG - Intronic
1120104215 14:80475988-80476010 AGAGTCCTTGTGGTGACTGACGG + Intergenic
1120331797 14:83102682-83102704 TGGGGCCTTTTGGAGGGTGGAGG + Intergenic
1120678411 14:87450200-87450222 AGAGGCCTTGGGGAGAGTAGAGG - Intergenic
1120759794 14:88275047-88275069 AGGGGCCCTGAAGAGGCTGGGGG - Intronic
1121242772 14:92441895-92441917 GAATGCCTGGTGGAGGCTGGAGG + Intronic
1121257696 14:92543246-92543268 AGAGGCTTTATGGGGGGTGGGGG + Intronic
1121390053 14:93566047-93566069 AGGAGTCTTGGGGAGGCTGGAGG + Intronic
1121740011 14:96245072-96245094 TGAGGTCTAGTGGAGGGTGGGGG - Intronic
1121763071 14:96462061-96462083 ACAGGCCCTCTGGAGCCTGGGGG - Intronic
1121833948 14:97075473-97075495 AGGGGCCTTTTGGAGGGTAGAGG - Intergenic
1122581850 14:102776590-102776612 AGCGGCCTGGTGGAGGGTGCAGG + Intergenic
1123098430 14:105777227-105777249 GGAGGCCTTGTGCAGTCTGTGGG + Intergenic
1123901196 15:24878908-24878930 AGAGGACTTGTAGAGGCTTCAGG + Intronic
1125719686 15:41839339-41839361 AGGGTCCTTGTGGAGGCAGGTGG + Intronic
1126442977 15:48711774-48711796 TGGGGCCTTTTGGAGGGTGGAGG - Intergenic
1126588457 15:50314576-50314598 AGAGGCATTTTGGAGACTGAAGG + Intronic
1127302922 15:57675232-57675254 AGGGGCATTGTGCAGGGTGGAGG + Intronic
1127314627 15:57783142-57783164 AGAGGCCAAGTAGAAGCTGGGGG + Intergenic
1127598526 15:60511845-60511867 AGAGGCCTGGTGCAGGTAGGAGG + Intronic
1128256077 15:66197864-66197886 GGAGGCCTTGTTAAGGCGGGGGG - Intronic
1128511743 15:68317595-68317617 AGAGGCGGTGGGGAGGATGGCGG + Intronic
1128532612 15:68464909-68464931 AGAGGCCAGAGGGAGGCTGGGGG - Intergenic
1128724256 15:69976161-69976183 AGAGGGCATGGGGAGGCAGGGGG - Intergenic
1128913269 15:71536215-71536237 GCAGGCCTTGTGGAGGCTTTAGG + Intronic
1129565184 15:76614234-76614256 TGGGGCCTTTTGGAGGATGGAGG + Intronic
1129709266 15:77812212-77812234 AGAGGGCATGGGGAGCCTGGTGG - Intronic
1130324451 15:82868412-82868434 AGAAGCCTACTGGAGGGTGGAGG + Intronic
1131280826 15:91019739-91019761 AGAGGCCTGATTTAGGCTGGTGG + Intronic
1131472471 15:92709013-92709035 AGAGGGCTTGAGGAGTCGGGGGG - Intronic
1132470477 16:100085-100107 AGTGTCCTTGGGGAGGCCGGAGG - Intronic
1132547871 16:541457-541479 AGGGGCCGTGTGGGGCCTGGTGG + Intronic
1132622504 16:874470-874492 AGTGCCCTAGTGGAGGCTGATGG + Intronic
1132663661 16:1072375-1072397 AGTGGGTGTGTGGAGGCTGGTGG - Intergenic
1133446260 16:5863462-5863484 AGAGGCCTGCTGGAGGATGGAGG - Intergenic
1133542349 16:6768455-6768477 AGAAGGCTTGTGTGGGCTGGGGG - Intronic
1133684338 16:8151469-8151491 TGGGGCCTTTTGGATGCTGGGGG - Intergenic
1133976351 16:10602089-10602111 ACAGGCCTTCTGGGGGCTGGCGG + Intergenic
1134081588 16:11328498-11328520 AGAGGGCTTGGGGGAGCTGGAGG - Intronic
1134130487 16:11646319-11646341 TGGGGCCTTTTGGAGGGTGGAGG - Intergenic
1135501022 16:22995807-22995829 TGGGGCCTTTTGGAGGGTGGAGG - Intergenic
1135525845 16:23212998-23213020 AATTACCTTGTGGAGGCTGGGGG + Intronic
1136070170 16:27782710-27782732 AGAGGCCAGGTGGAGCCTGGGGG - Intergenic
1136172578 16:28497646-28497668 GGAGCCATGGTGGAGGCTGGGGG + Exonic
1136556617 16:31010809-31010831 AGAGGCCTGGAGGCGGGTGGGGG + Intergenic
1136598176 16:31265948-31265970 GGGGGTCTTGTGGAGGGTGGAGG + Intronic
1137555195 16:49465848-49465870 AAAGGCCCTGTGGTGACTGGCGG - Intergenic
1137667441 16:50259920-50259942 AGAGGCCTGGAGGAGGTGGGTGG + Intronic
1137704649 16:50526297-50526319 AGTGGCCTTGGGGAGGCAGGAGG - Intergenic
1138094333 16:54200252-54200274 AGATACCTTGTGGAGGGTGGGGG + Intergenic
1138556088 16:57772038-57772060 AGAGGCCTTGTGGCTCCAGGGGG - Intronic
1138561496 16:57803250-57803272 AGAGGCCTGGGGGAGGCCAGGGG + Intronic
1138878831 16:60986038-60986060 TGGGGCCTTTTGGAGGCTGGAGG - Intergenic
1139465894 16:67153914-67153936 AGAGAAGTTGTGGAGGATGGAGG - Intergenic
1139978270 16:70832737-70832759 ACAGGCCTCGTGGAGGGAGGGGG + Intronic
1140867627 16:79077894-79077916 AGAGGCATTGTGGACGCCTGTGG + Intronic
1141064000 16:80899455-80899477 AGGGGCCTGTTGGAGGGTGGGGG - Intergenic
1141450006 16:84092891-84092913 AGAGGCCTGGGGAAGCCTGGAGG + Intronic
1141650983 16:85393036-85393058 AGAGGCCCTGTCAAGGCTGCTGG + Intergenic
1142259241 16:89034886-89034908 ACAGGGCTTGTAGAGGCAGGTGG + Intergenic
1142375811 16:89706635-89706657 AGATGCCATGAGGAGGCAGGTGG - Intergenic
1142677114 17:1520726-1520748 AGCAGCCTCGGGGAGGCTGGAGG - Intronic
1143141441 17:4743857-4743879 AGGGGCCCTGTGGAAGCTAGGGG + Intronic
1143243644 17:5465197-5465219 AGAGGCCTGGTGGTAGCTAGAGG - Intronic
1144064990 17:11616956-11616978 AGGGTCCTTGTGAAGGCTGAAGG - Intronic
1144156303 17:12507349-12507371 AGAGGCCTTTTCGATGCTGGTGG + Intergenic
1144231692 17:13211818-13211840 TGAGGCCTATTGGAGGGTGGAGG + Intergenic
1146607700 17:34275439-34275461 CGGGGCCTTTTGGAGGGTGGGGG - Intergenic
1147182268 17:38693849-38693871 TGAGCCCATGTGGAGGCTGCCGG + Intergenic
1147580240 17:41623849-41623871 AGAGGCCTTGTGGAGCCCCTTGG - Intronic
1147608955 17:41790248-41790270 AGAGGCCTCGTGGAAGATGAGGG - Intergenic
1148130642 17:45260800-45260822 AGAGGCCACATGGAGTCTGGGGG - Intronic
1148445744 17:47735890-47735912 AGAGGCCTGGCAGAGGCTGTGGG - Intronic
1148902589 17:50889532-50889554 AGTGCCCTTGTGGTGGCTGATGG - Intergenic
1149100692 17:52902901-52902923 AGAGGCCATCTGCAGGCTGAAGG - Intergenic
1149553443 17:57556686-57556708 AGAGGCTTTGCAGAGGCTTGCGG + Intronic
1149995178 17:61402422-61402444 AAAGGTCTTAGGGAGGCTGGGGG - Intronic
1150454783 17:65298486-65298508 AAAGGGCTTGGAGAGGCTGGAGG + Intergenic
1150996853 17:70328544-70328566 TGAGGCCTGTTGGAGGGTGGAGG - Intergenic
1151328265 17:73391938-73391960 AGAGGAGTGGTGCAGGCTGGGGG - Intronic
1151757123 17:76081429-76081451 AGAGGGCTGCTGGAGGCGGGTGG + Intronic
1152294594 17:79459308-79459330 GGAGGCGCTGGGGAGGCTGGAGG + Intronic
1152576512 17:81143603-81143625 AGAGGGGTCGAGGAGGCTGGAGG - Intronic
1152818779 17:82425025-82425047 AGAAGGCTGGAGGAGGCTGGAGG + Intronic
1152818812 17:82425160-82425182 AGAAGGCTGGAGGAGGCTGGAGG + Intronic
1152818821 17:82425190-82425212 AGAAGGCTGGAGGAGGCTGGAGG + Intronic
1152887121 17:82859035-82859057 AGAGGCCATGGGGAGCCTGCCGG + Intronic
1152891472 17:82883937-82883959 AGACGCCATGTGGGAGCTGGGGG - Intronic
1153922819 18:9806422-9806444 AGGGGCCTTGAGGATGCTGGTGG + Intronic
1153947262 18:10028977-10028999 AGAGGCCTAATGAAGGCTTGTGG + Intergenic
1153959701 18:10130455-10130477 TGAGGCTTTCTGGGGGCTGGTGG - Intergenic
1155056765 18:22191359-22191381 AGAGGCGTTGGGGGGGCGGGTGG - Intronic
1155069172 18:22298302-22298324 AGGTGCCCTGTTGAGGCTGGAGG + Intergenic
1155530830 18:26764765-26764787 AGAGGTCTTGGAGAGGGTGGGGG + Intergenic
1156238174 18:35224520-35224542 AGGGGCCTTTTGGAGGGTGAAGG + Intergenic
1157714255 18:49872345-49872367 AGTGGACTTGTGGAGGGTGGGGG - Intronic
1157975986 18:52327450-52327472 TGTGGCCTTTTGGAGGGTGGAGG - Intergenic
1158330234 18:56354353-56354375 TGGGGCCTTTTGGAGGGTGGAGG - Intergenic
1158418006 18:57266792-57266814 AGAGTCATTGTAAAGGCTGGTGG - Intergenic
1158759132 18:60364024-60364046 AGAGACCTTGAGGTGGGTGGGGG + Intergenic
1158990720 18:62865869-62865891 TGGGGCCTATTGGAGGCTGGAGG + Intronic
1159524417 18:69569040-69569062 AGGGGGTTTGTGGGGGCTGGGGG - Intronic
1159849254 18:73507217-73507239 TGGGGCCTTTTGGAGGGTGGAGG - Intergenic
1159959926 18:74547397-74547419 TGAGGCTTTGTGGGGGGTGGAGG + Intronic
1160421429 18:78749558-78749580 AGAGGCCTTTTGGAAGCATGTGG + Intergenic
1160964280 19:1739184-1739206 AGAGGCCTTCACCAGGCTGGTGG + Intergenic
1161140413 19:2643864-2643886 AGAGGTCGCCTGGAGGCTGGGGG - Intronic
1161283246 19:3456777-3456799 AGAGGCCAGGTGGGGGCTCGAGG - Intronic
1161319599 19:3634805-3634827 AGGGGTCTTGTGGAAGCTGTAGG - Intronic
1161470105 19:4453005-4453027 AGAGGCTCTGTGGAGACGGGTGG - Intronic
1161621653 19:5300879-5300901 AGAGGCCTTGCAGAGACTAGAGG + Intronic
1161934086 19:7360623-7360645 AGGGTCCTTGTGGAGGCCTGAGG - Intronic
1162355837 19:10184245-10184267 AAAGGCCTGGTGGGGGGTGGTGG + Intronic
1162853270 19:13448337-13448359 TGGGGCCTTTTGGAGGGTGGAGG + Intronic
1162997384 19:14344815-14344837 AGAGCTCTTGTGGAAGCTGATGG - Intergenic
1163214519 19:15866015-15866037 TGGGGCCTATTGGAGGCTGGAGG + Intergenic
1163870140 19:19814529-19814551 TGAGGCCTAGTTGAGGGTGGAGG + Intronic
1163879552 19:19905369-19905391 TGAGGCCTAGTTGAGGGTGGAGG - Intronic
1163904781 19:20142938-20142960 TGAGGCCTAGTAGAGGGTGGAGG + Intergenic
1163908969 19:20171873-20171895 TGAGGCCTAGTTGAGGGTGGAGG - Intronic
1163912910 19:20213651-20213673 ACAGGCCTAGTTGAGGCTGGAGG + Intergenic
1163927113 19:20356401-20356423 TGAGGCCTAGTTGAGGGTGGAGG + Intergenic
1163933367 19:20420389-20420411 TGAGGCCTAGTTGAGGGTGGAGG + Intergenic
1163969828 19:20781387-20781409 TGAGGCCTAGTTGAGGGTGGAGG - Intronic
1164043638 19:21514340-21514362 TGAGGCCTAGTTGAGGGTGGAGG - Intronic
1164095321 19:22004747-22004769 TGAGGCCTAGTAGAGGGTGGAGG + Intronic
1164147141 19:22518962-22518984 AGTGCCCTGGTGGTGGCTGGGGG + Intronic
1164159491 19:22617367-22617389 AGTGCCCTGGTGGTGGCTGGGGG - Intergenic
1165039044 19:33055841-33055863 GGAGGCCCTGTCCAGGCTGGAGG + Intronic
1165693705 19:37884374-37884396 AGAGTGCTTGGGGAGGATGGTGG + Intergenic
1166071880 19:40392815-40392837 AGAGACATGGAGGAGGCTGGAGG + Intergenic
1166354259 19:42217597-42217619 AGAGGCCTAATGGTGACTGGTGG - Intronic
1166366430 19:42280694-42280716 AGCGGCTTTGTGGAGCCTGCCGG + Intronic
1166561362 19:43734363-43734385 AGAGGCTTTCTGGGGACTGGAGG - Intronic
1167089204 19:47331867-47331889 AGAGGCCTGGAGGTGGCTGGGGG + Intergenic
1167250138 19:48395012-48395034 AGAAGCCTCGTGGAGGGAGGGGG + Intronic
1168221703 19:54965207-54965229 AGAGGTCTTTTGGGGGCGGGGGG - Intronic
1168221868 19:54966297-54966319 AGAGGTCTTTTGGGGGCGGGGGG - Intronic
1168323918 19:55528534-55528556 AGAGGACGTGTGGAGGAGGGAGG - Intergenic
1168324073 19:55529461-55529483 AGAGGCCCTGGGGAAGGTGGCGG + Intergenic
1168356053 19:55700687-55700709 AGGGGCCATGAGGAGGCTGTAGG - Intronic
1168640002 19:58024828-58024850 CGGGGCCGTGTGGAGGCTGGCGG + Intergenic
1168645436 19:58056322-58056344 AGAGGCAGTGTGGAGTCAGGTGG - Intergenic
925366359 2:3314756-3314778 AGAGGCTAGCTGGAGGCTGGGGG - Intronic
925390929 2:3493400-3493422 AGAGAGCCTGTAGAGGCTGGTGG - Intergenic
925636020 2:5942007-5942029 ACAGGCTCTGTGGAGGATGGAGG - Intergenic
925740196 2:6998882-6998904 AAATGCCTTGTGGGGGGTGGGGG + Intronic
925816373 2:7754909-7754931 TGAGGCCTTTTGGAGGGTGGAGG + Intergenic
926695581 2:15768076-15768098 AGTGGCTGTGTGGATGCTGGAGG - Intergenic
927261611 2:21097237-21097259 AGTGGACTTGTGGAGTCTGGGGG + Intergenic
927672701 2:25082328-25082350 AGAGGCCTTGGGCAGACAGGAGG + Intronic
927943273 2:27118926-27118948 AGCGGCCCGGGGGAGGCTGGCGG - Exonic
928713828 2:34037245-34037267 TCAGGCCTGCTGGAGGCTGGGGG + Intergenic
929344400 2:40863437-40863459 TGGGGCCTTTTGGAGGGTGGAGG + Intergenic
929357590 2:41044639-41044661 TGAGGCCTATTGGAGGGTGGAGG + Intergenic
930327121 2:49933925-49933947 AGAGGCCTTGTGAATTCAGGTGG + Intronic
930525934 2:52529738-52529760 AGAGGCCTTTTGGAGGGTGAGGG + Intergenic
930926533 2:56824653-56824675 TGGGGCCTGCTGGAGGCTGGAGG + Intergenic
931206937 2:60156779-60156801 GAAGGCTTGGTGGAGGCTGGAGG - Intergenic
932284495 2:70520811-70520833 ACAGGCCTTGTGGAGAGTGGTGG - Intronic
933150095 2:78903985-78904007 TGAGGCCTATTGGAGGGTGGAGG - Intergenic
934965220 2:98715629-98715651 TGGGGCCTTTTGGAGGGTGGAGG + Intronic
935108477 2:100069112-100069134 AGTGGCCTGTTGGAGGGTGGAGG - Intronic
935514477 2:104019646-104019668 AAAGGCTTTGTGGAGGATGAGGG + Intergenic
935720390 2:105974210-105974232 AGTGGCGTTGAGGAGCCTGGAGG - Intergenic
937257836 2:120567347-120567369 AGGGGCCTGGAGGAGGCTGTGGG - Intergenic
937281370 2:120719653-120719675 GGAGGCCCTCTGGAGGTTGGTGG - Intergenic
937335562 2:121060117-121060139 AGTGGCCTTGTGGAGGTGGGGGG + Intergenic
937491739 2:122376335-122376357 AGTGACTTTGTGGAGCCTGGTGG + Intergenic
937649057 2:124299343-124299365 TGAGGCCTTTTGGAGGGTGGAGG - Intronic
937900252 2:127014370-127014392 AGAGGCAGTGTGGTGGCTGCAGG - Intergenic
937956857 2:127426570-127426592 AGTTCCCATGTGGAGGCTGGAGG - Intronic
937972377 2:127560590-127560612 ACAGGCCTTGAGAAGCCTGGCGG + Intronic
938248308 2:129795723-129795745 GCAGGCCACGTGGAGGCTGGGGG + Intergenic
938264336 2:129915682-129915704 AGAGGCCTGGTGGTAGATGGGGG - Intergenic
938971706 2:136438922-136438944 AGAGGCCTTGGGGGGGGGGGGGG - Intergenic
939791829 2:146587519-146587541 CGAGGCCATGTGGTAGCTGGGGG - Intergenic
940133249 2:150407786-150407808 TGGGGCCTTTTGGAGGGTGGAGG + Intergenic
940277988 2:151959412-151959434 AGATGTCTTGAGGAGGTTGGGGG - Intronic
941113745 2:161447798-161447820 AGTGACCTGGTGGAGGATGGAGG + Intronic
941306039 2:163868563-163868585 GGGGGCCTTATGGAGGATGGAGG + Intergenic
942222486 2:173784199-173784221 GGCGGCCCTGTAGAGGCTGGGGG + Intergenic
942709339 2:178815000-178815022 AAAGGCCATGTGGAGACAGGAGG + Intronic
942751006 2:179287323-179287345 TGGGGCCTAGTGGAGGGTGGAGG + Intergenic
942868104 2:180699851-180699873 AGAGGCCAAGGGGAGGCTGAGGG - Intergenic
943434726 2:187850335-187850357 TGGGGCCTTTTGGAGGATGGAGG + Intergenic
943626835 2:190210705-190210727 AGAGGCCGTGTGGAAGCGGATGG - Intronic
943793606 2:191964490-191964512 AGAGCCCTTGAGGATGATGGAGG - Intronic
943825345 2:192384322-192384344 AGGGGCCTTTTGGAGAGTGGGGG - Intergenic
944593268 2:201238232-201238254 AGAAGCCTTGAGAAGGCTTGTGG + Intronic
945466641 2:210177109-210177131 TGGGGCCTTTTGGAGGATGGAGG - Intergenic
945734113 2:213576828-213576850 TGGGGCCTTTTGGAGGGTGGAGG + Intronic
945988260 2:216371773-216371795 AGAGTGCTTCTGGAGGGTGGGGG + Exonic
946130105 2:217600118-217600140 AGCTGCAGTGTGGAGGCTGGGGG - Intronic
946144469 2:217718565-217718587 TAAGGCTTTGAGGAGGCTGGAGG + Intronic
946352125 2:219162040-219162062 AGAGGCAGTGGAGAGGCTGGGGG + Exonic
946690374 2:222304809-222304831 AGAGGGCTCTTGGAGGTTGGCGG - Exonic
947443848 2:230148125-230148147 GGAGGCTTGATGGAGGCTGGAGG + Intergenic
947503232 2:230687000-230687022 TGGGGCCTTTTGGAGGGTGGAGG + Intergenic
947622265 2:231598199-231598221 AAAGGGTTAGTGGAGGCTGGTGG + Intergenic
1168909912 20:1439572-1439594 AGAGGGCATGTGGAGGCTTGGGG - Intergenic
1169191721 20:3662340-3662362 GGAGAACTTGTGGAGGCTGGGGG - Intronic
1169562504 20:6817259-6817281 CGGGGCCTTTTGGAGGGTGGGGG + Intergenic
1170571496 20:17635340-17635362 AGCGTCCCTGTGGTGGCTGGTGG - Intronic
1172659700 20:36559263-36559285 AATGGCCCTGTGGAGGGTGGAGG - Intergenic
1172784367 20:37456954-37456976 AGAGGCCTACTTGAGGGTGGAGG - Intergenic
1173185448 20:40836756-40836778 GAAGGGGTTGTGGAGGCTGGAGG - Intergenic
1173213711 20:41059156-41059178 AGGGGCCTTTTGGAGGGTGGAGG + Intronic
1173253047 20:41374674-41374696 TGAGGACTTGAGGAGGCTGGGGG + Intergenic
1173354925 20:42278433-42278455 AGAAGCTTAGAGGAGGCTGGAGG + Intronic
1173397689 20:42695914-42695936 AGGGTCATTGTAGAGGCTGGAGG - Intronic
1173554146 20:43953659-43953681 AGAGGCCCTGTGGAAGATGGTGG + Intronic
1174176643 20:48649613-48649635 AAAGGCCCAGTGGATGCTGGGGG - Intronic
1174619084 20:51860229-51860251 AGAGCCCTGGTGGAGGGTGGTGG - Intergenic
1176077562 20:63255161-63255183 TGAGGCCTTGTGCACGGTGGAGG + Intronic
1176125652 20:63473385-63473407 GGAGGGTCTGTGGAGGCTGGAGG + Intergenic
1176215349 20:63945180-63945202 AGAGGCCTTGTGGAGGCTGGGGG + Intronic
1176902903 21:14465108-14465130 TGAGGCCTGTTGGAGGGTGGAGG - Intergenic
1177506374 21:22024136-22024158 TGAGGCCTTTTGGAGGGTGGAGG + Intergenic
1177867157 21:26526004-26526026 GGGGGCCTTTTGGAGGGTGGAGG + Intronic
1177890349 21:26797288-26797310 TGGGGCCTTTTGGAGGGTGGAGG + Intergenic
1178133650 21:29601587-29601609 AGAGGCTGAGTGGAGGCTGCAGG - Intronic
1179069651 21:38059758-38059780 GGAGGTGTTGAGGAGGCTGGTGG + Intronic
1179380273 21:40892219-40892241 GGGGGCCTTTTGGAGGGTGGAGG + Intergenic
1179809161 21:43859247-43859269 AGAGACCAAGTGGAGGCTGCTGG - Intergenic
1179987006 21:44927669-44927691 TGAGACCTTTTGCAGGCTGGGGG + Intronic
1180233765 21:46443992-46444014 TGAGGCCCTATGTAGGCTGGAGG - Intronic
1180796948 22:18610517-18610539 GGAGGCCTTGGGGAGGCTCCGGG + Exonic
1180799292 22:18624335-18624357 AGAAGCCAGGTGGAGGCTAGAGG - Intergenic
1180834551 22:18923331-18923353 AGAGGCCCTGTGGAGATGGGAGG + Intronic
1181222426 22:21370931-21370953 AGAAGCCAGGTGGAGGCTAGAGG + Intergenic
1181224776 22:21384754-21384776 GGAGGCCTTGGGGAGGCTCCGGG - Exonic
1181253856 22:21550059-21550081 GGAGGCCTTGGGGAGGCTCCGGG + Exonic
1181388014 22:22558672-22558694 AGAGGCAGTGGGGAGGCGGGGGG + Intronic
1181756619 22:25028881-25028903 AGAGGCCTTGCTGAGGAAGGTGG + Exonic
1182764361 22:32747994-32748016 CGAGGCCATGTCCAGGCTGGTGG - Intronic
1183023140 22:35043435-35043457 GGACCCCTTGTGGAGGCTGATGG - Intergenic
1183367868 22:37416810-37416832 AGGGGGCTTGTGCAGGGTGGTGG - Intronic
1183927401 22:41216102-41216124 AGAGGCTATGTGTAGCCTGGCGG - Intronic
1184411085 22:44326939-44326961 AGAGGCCTTGAGGAGCTTTGGGG - Intergenic
1184520336 22:44990079-44990101 AGAGGCCTACTAGGGGCTGGGGG + Intronic
1184783223 22:46659359-46659381 GGAGGCTAAGTGGAGGCTGGAGG - Intronic
1185154271 22:49183751-49183773 AGAGGACTTTTGGGGGCAGGCGG + Intergenic
1185388837 22:50548326-50548348 GGGGGCCTGGTTGAGGCTGGAGG + Exonic
1203284640 22_KI270734v1_random:148630-148652 AGAGGCCCTGTGGAGATGGGAGG + Intergenic
950547253 3:13645895-13645917 AGAGCCCTGGTGGAGGCTCGTGG - Intergenic
950621903 3:14212737-14212759 AGAGGCCATCAGGAGGCAGGTGG - Intergenic
950677871 3:14565473-14565495 TGTTGCCATGTGGAGGCTGGAGG - Intergenic
951040535 3:17984140-17984162 AGAGACATCCTGGAGGCTGGAGG - Intronic
951153929 3:19326033-19326055 AGGGACATTGTTGAGGCTGGAGG + Intronic
952419926 3:33121719-33121741 AGAGGCCAAGTGGAGGCATGAGG - Intronic
952744082 3:36761765-36761787 TGAGAACTTCTGGAGGCTGGTGG + Intergenic
952979744 3:38725100-38725122 AGTGGGCTGGTAGAGGCTGGAGG - Intronic
953038985 3:39238056-39238078 GAAGTCCTTGTGAAGGCTGGTGG + Intergenic
953039487 3:39242681-39242703 TGAGGCCTATTGGAGGATGGAGG + Intergenic
953417938 3:42733652-42733674 AGAGGCCTAGAGAAGGCAGGAGG + Intronic
954380872 3:50218391-50218413 AGAGGCCTAGGCTAGGCTGGGGG + Intronic
955493175 3:59503450-59503472 TGTGGCCTTTTGGAGGGTGGAGG - Intergenic
956003281 3:64751631-64751653 TGAGGCCCTTTGGAGGGTGGAGG - Intergenic
956462728 3:69487524-69487546 GGAGGACTGGTGGAGGCAGGAGG + Intronic
957655571 3:83069739-83069761 TGGGGCCTTTTGGAGGGTGGAGG + Intergenic
959313641 3:104773796-104773818 ATAGGCCTTCTGCAGGCTGAAGG - Intergenic
960047832 3:113213912-113213934 TTGGGCCTTGAGGAGGCTGGAGG + Intronic
960640228 3:119816397-119816419 AGAGTCGTTGTGGAGGTTAGGGG - Intronic
961177298 3:124846247-124846269 AGAGGACTTGTGGAGAGGGGAGG + Intronic
962629792 3:137264224-137264246 GGAGGCTGGGTGGAGGCTGGGGG - Intergenic
962874366 3:139524589-139524611 AGAGCCCATGTGGGGGTTGGGGG - Intronic
964764791 3:160169467-160169489 TGAGGCCTGGTGGGGGCTGCAGG - Intergenic
964815296 3:160710760-160710782 AGAGGGCTTTTGGAGCTTGGGGG + Intergenic
964902445 3:161675940-161675962 AGGGGCAATGTGGAGGATGGGGG - Intergenic
965111308 3:164427473-164427495 AGAGTCCTTGTGGAGTACGGAGG + Intergenic
966358700 3:179110095-179110117 AGAGGCCATGTGGGGGCCAGTGG + Intergenic
967017923 3:185498441-185498463 AGTGGACTTGAAGAGGCTGGGGG + Intronic
967902621 3:194471831-194471853 AGTGGCCTTCAGGTGGCTGGAGG + Intronic
968460408 4:721853-721875 AGAGGCCTGTGGGAGACTGGTGG + Intronic
968514536 4:1010696-1010718 GGAGGCCATGGGGCGGCTGGAGG + Intronic
968629338 4:1642103-1642125 AGGGGCCTTATGGGGGCAGGTGG - Intronic
969439382 4:7208296-7208318 AGAAACCCTGTGGGGGCTGGAGG - Intronic
969668685 4:8577142-8577164 AGAAGCCTTGGAGGGGCTGGGGG - Intronic
969718574 4:8880500-8880522 AGAGGCCAAGTGGAGGCTCAGGG - Intergenic
969936435 4:10686597-10686619 AGAGGCCTGGAAAAGGCTGGAGG - Intergenic
970193066 4:13533392-13533414 AGATGCCTTGTTGAGGCTAGAGG - Intergenic
970290397 4:14565000-14565022 AGAGGCCCTATAGAGGATGGGGG - Intergenic
970291496 4:14577826-14577848 TGGGGCCTTTTGGAGGGTGGAGG + Intergenic
971592486 4:28485678-28485700 TGGGGCATTGTGGAGGCTTGGGG - Intergenic
972662889 4:41133878-41133900 AGAGGTATTTTGGTGGCTGGGGG - Intronic
976762556 4:88566129-88566151 TGAGGCCTTTTGGAGGGTGAAGG - Intronic
976914067 4:90348103-90348125 TGGGGCCTTTTGGAGGCTGGAGG + Intronic
977512380 4:97977862-97977884 AAAGGCCTTGAGGAGACTGCTGG + Intronic
977566220 4:98583414-98583436 TGGGGCCTGGTGGAGGGTGGAGG - Intronic
978025085 4:103863618-103863640 TGGGGCCTTTTGGAGGGTGGAGG - Intergenic
978073126 4:104495049-104495071 GGAGGAGGTGTGGAGGCTGGGGG + Intergenic
978293262 4:107171961-107171983 TGGGGCCTTTTGGAGGGTGGAGG - Intronic
979259383 4:118633802-118633824 GCAGGCCTTCTGGAGGCAGGAGG - Intergenic
979279774 4:118852705-118852727 TGGGGCCTATTGGAGGCTGGAGG + Intronic
979362201 4:119777867-119777889 TGGGGCCTTTTGGAGGCTGGAGG - Intergenic
981201662 4:141987251-141987273 TGGGGCCTTTTGGGGGCTGGGGG - Intergenic
983059901 4:163147339-163147361 TCAGGTCCTGTGGAGGCTGGTGG + Intronic
983096253 4:163565787-163565809 AGAAGCTTTGTGGAGACTGCTGG - Intronic
983613059 4:169671435-169671457 CGAGGCCTGTTGGAGGGTGGGGG + Intronic
984294216 4:177832936-177832958 AGAGGCCTTGGGAAGGCAGAAGG + Intronic
985092406 4:186377822-186377844 TGGGGCCTTTTGGAGGGTGGAGG - Intergenic
985312195 4:188614692-188614714 TGGGGCCTTTTGGAGGGTGGAGG + Intergenic
985558109 5:568065-568087 AGAGGCCTCCTGGCTGCTGGCGG - Intergenic
986309056 5:6537827-6537849 AGAGGCATTGTGTATGATGGGGG - Intergenic
986494757 5:8331384-8331406 TGAGGCCGTGAGGATGCTGGAGG + Intergenic
986935583 5:12881458-12881480 TGTGGCCTTTTGGAGGGTGGAGG - Intergenic
987502209 5:18727477-18727499 AGAGGCCTTTCAGAGGATGGAGG - Intergenic
988049643 5:26010166-26010188 AGATGGGTTCTGGAGGCTGGTGG + Intergenic
988428371 5:31090560-31090582 GGAGGCCCTGAGGAGGATGGAGG + Intergenic
988862645 5:35300594-35300616 TGGGGCCTTTTGGAGGGTGGAGG + Intergenic
989490736 5:42049404-42049426 AGGGGCCTGGTTGAGGGTGGAGG + Intergenic
990823940 5:59875947-59875969 TGGGGCCTATTGGAGGCTGGAGG + Intronic
991183189 5:63778199-63778221 TGGGGCCTTTTGGAGGCTGGAGG - Intergenic
991186088 5:63809595-63809617 TGGGGCCTACTGGAGGCTGGAGG - Intergenic
992591869 5:78303959-78303981 TGGGGCCTTTTGGAGGATGGAGG - Intergenic
993033783 5:82734404-82734426 AGGAGCCATGTGGAGACTGGAGG + Intergenic
994149232 5:96429609-96429631 TGGGGCCTTTTGGAGGGTGGAGG - Intronic
996649620 5:125858428-125858450 AGAGGCCTGGTGGGGGGTTGGGG - Intergenic
997303596 5:132823591-132823613 GAAGGGCTGGTGGAGGCTGGGGG - Intronic
997743631 5:136279474-136279496 AGAGGACTTCTGGTGACTGGGGG - Intronic
997790902 5:136761184-136761206 AGAGGCCTACTTGAGGGTGGAGG + Intergenic
998049721 5:139022270-139022292 AGGGGCCCTGTGGAATCTGGAGG - Intronic
998378325 5:141706232-141706254 AGAGGCCATGTGGAGGTGGGAGG + Intergenic
999441090 5:151601494-151601516 AGAAGCCTGGTGAAAGCTGGAGG - Intergenic
1001553491 5:172620859-172620881 AGAGGTCTGGTGGAGGATGATGG - Intergenic
1002161150 5:177314754-177314776 AGTGGGCTGGTGGAGGCAGGAGG - Intergenic
1002522469 5:179799349-179799371 AGAGGCCGTGTTGAGGAAGGAGG - Intronic
1003613125 6:7630963-7630985 AGGAGCGCTGTGGAGGCTGGAGG + Intergenic
1003737179 6:8889890-8889912 TGAGGCCTTTCGGAGGGTGGTGG + Intergenic
1004011219 6:11689755-11689777 TGAGGCCTATTGGAGGGTGGAGG + Intergenic
1005777335 6:29149467-29149489 TGTGGCCTGGTGGAGGGTGGAGG - Intergenic
1006079941 6:31559256-31559278 GGGGGCCATGAGGAGGCTGGGGG + Intergenic
1006134654 6:31888217-31888239 ACAGGCCTTGTGGAAGCGGTGGG + Exonic
1007366805 6:41399803-41399825 ATAGGCTTGGTAGAGGCTGGAGG - Intergenic
1008309170 6:49944089-49944111 TGAGGCCTCTTGGAGGGTGGAGG - Intergenic
1008677536 6:53836111-53836133 AGAGGCCTTGTGGAGCACAGAGG + Intronic
1009263566 6:61526460-61526482 AGTGGCCTTGGAGAAGCTGGTGG - Intergenic
1009842172 6:69091627-69091649 CGGGGTCTTTTGGAGGCTGGCGG + Intronic
1011007353 6:82661680-82661702 TGAGGCCTTGTGGGGGCTGAGGG - Intergenic
1012177109 6:96101397-96101419 AGATGTGTTGTGGGGGCTGGGGG + Intronic
1012612632 6:101234608-101234630 AGAGTCCTCTTGGAAGCTGGAGG + Intergenic
1014777015 6:125522796-125522818 TAAGGCCTTTTGGAGGGTGGAGG - Intergenic
1016065716 6:139681083-139681105 AGTGGCCATGTGGAGGGAGGTGG - Intergenic
1016780251 6:147950351-147950373 GGAGGCCATGCTGAGGCTGGGGG - Intergenic
1017013442 6:150080912-150080934 ACAGGCCTTGGGGAGGCGGTAGG + Intergenic
1017942585 6:159066155-159066177 AGAGGCCTTCTGGTGGTTGGTGG + Intergenic
1017981149 6:159402018-159402040 AGAGGCTTGGAGGGGGCTGGTGG - Intergenic
1018067040 6:160131579-160131601 AGTGGCCTAGTGGAGGCAGATGG + Intronic
1018124448 6:160668500-160668522 AGAAGCCTAGTGGGGGATGGTGG + Intergenic
1018180128 6:161216113-161216135 AGAAGCCTTGTCAAGGCAGGAGG - Intronic
1018982839 6:168613670-168613692 AGAGGCCCTGTGCTGGCTGTAGG - Intronic
1018982844 6:168613698-168613720 AGAGGCCCTGTGCTGGCTGTAGG - Intronic
1018982856 6:168613756-168613778 AGAGGCCCTGTGCTGGCTGTAGG - Intronic
1018982861 6:168613784-168613806 AGAGGCCCTGTGCTGGCTGTAGG - Intronic
1018982888 6:168613926-168613948 AGAGGCCCTGTGCTGGCTGTAGG - Intronic
1018982900 6:168613984-168614006 AGAGGCCCTGTGCTGGCTGTAGG - Intronic
1018982919 6:168614070-168614092 AGAGGCCCTGTGCTGGCTGTAGG - Intronic
1018982949 6:168614246-168614268 AGAGGCCCTGTGCTGGCTGTAGG - Intronic
1018982954 6:168614274-168614296 AGAGGCCCTGTGCTGGCTGTAGG - Intronic
1018982959 6:168614302-168614324 AGAGGCCCTGTGCTGGCTGTAGG - Intronic
1018982968 6:168614358-168614380 AGAGGCCCTGTGCTGGCTGTAGG - Intronic
1018982973 6:168614386-168614408 AGAGGCCCTGTGCTGGCTGTAGG - Intronic
1018982978 6:168614414-168614436 AGAGGCCCTGTGCTGGCTGTAGG - Intronic
1018982987 6:168614472-168614494 AGAGGCCCTGTGCTGGCTGTAGG - Intronic
1018982992 6:168614500-168614522 AGAGGCCCTGTGCTGGCTGTAGG - Intronic
1018982997 6:168614528-168614550 AGAGGCCCTGTGCTGGCTGTAGG - Intronic
1018983016 6:168614616-168614638 AGAGGCCCTGTGCTGGCTGTAGG - Intronic
1018983021 6:168614644-168614666 AGAGGCCCTGTGCTGGCTGTAGG - Intronic
1018983026 6:168614672-168614694 AGAGGCCCTGTGCTGGCTGTAGG - Intronic
1018983035 6:168614730-168614752 AGAGGCCCTGTGCTGGCTGTAGG - Intronic
1018983040 6:168614758-168614780 AGAGGCCCTGTGCTGGCTGTAGG - Intronic
1018983045 6:168614786-168614808 AGAGGCCCTGTGCTGGCTGTAGG - Intronic
1018983050 6:168614814-168614836 AGAGGCCCTGTGCTGGCTGTAGG - Intronic
1018983055 6:168614842-168614864 AGAGGCCCTGTGCTGGCTGTAGG - Intronic
1018983076 6:168614958-168614980 AGAGGCCCTGTGCTGGCTGTAGG - Intronic
1018983081 6:168614986-168615008 AGAGGCCCTGTGCTGGCTGTAGG - Intronic
1018983086 6:168615014-168615036 AGAGGCCCTGTGCTGGCTGTAGG - Intronic
1018983113 6:168615158-168615180 AGAGGCCCTGTGCTGGCTGTAGG - Intronic
1018983118 6:168615186-168615208 AGAGGCCCTGTGCTGGCTGTAGG - Intronic
1018983147 6:168615326-168615348 AGAGGCCCTGTGCTGGCTGTAGG - Intronic
1018983159 6:168615384-168615406 AGAGGCCCTGTGCTGGCTGTAGG - Intronic
1018983171 6:168615442-168615464 AGAGGCCCTGTGCTGGCTGTAGG - Intronic
1018983175 6:168615470-168615492 AGAGGCCGTGTGCTGGCTGTAGG - Intronic
1018983200 6:168615618-168615640 AGAGGCCCTGTGCTGGCTGTAGG - Intronic
1018983212 6:168615676-168615698 AGAGGCCCTGTGCTGGCTGTAGG - Intronic
1019049257 6:169170482-169170504 AGGGCCCTGGTGGAGGCTGCAGG - Intergenic
1019409293 7:899659-899681 AGGTGCCGTGTGGAGGCTGGAGG - Intronic
1019411435 7:908459-908481 AGCAGCCTTGTAGAGGCTTGGGG - Intronic
1019707280 7:2502698-2502720 AGAGCCCTGGTGGTGGCTCGTGG - Intergenic
1019960172 7:4452436-4452458 GGAGGCCTGGGTGAGGCTGGGGG - Intergenic
1021825170 7:24543579-24543601 TGGGGCCTAGTGGAGGGTGGAGG - Intergenic
1022201275 7:28120054-28120076 AGAGTCTTTGTGGAGGTTGGAGG - Intronic
1022865318 7:34412289-34412311 TGGGGCCTTTTGGAGGGTGGAGG + Intergenic
1024200293 7:47099594-47099616 TGGGGCCTTTTGGAGGTTGGGGG + Intergenic
1024511286 7:50207011-50207033 ATCGGCCTGGTGGGGGCTGGGGG - Intergenic
1024672286 7:51607105-51607127 AGAGGCCTCTCAGAGGCTGGAGG + Intergenic
1024995388 7:55270125-55270147 AGAGGCCTGTTGGAGGCTGTGGG - Intergenic
1025002082 7:55324943-55324965 AGAGTCCTTGAGAAGGCTGCTGG + Intergenic
1025775544 7:64557844-64557866 ACAGGCCTAGTTGAGGGTGGTGG + Intronic
1025815628 7:64908403-64908425 AGAGGCCAAGTTGAGGGTGGAGG - Intronic
1026115502 7:67492304-67492326 TGAGGCCTACTGGAGGGTGGAGG - Intergenic
1026617005 7:71914207-71914229 TGGGGCCTTTTGGAGGGTGGAGG - Intronic
1026983169 7:74538300-74538322 CGAGGCCTAGTGGAGGCAGGTGG - Intronic
1027902960 7:84141666-84141688 AGAGGCTTACTGGAGGGTGGAGG - Intronic
1028160386 7:87477476-87477498 AGAAGGCTTGTGGTGACTGGAGG + Intronic
1028288216 7:89031008-89031030 TGGGGCCTTTTGGGGGCTGGGGG + Intronic
1028498066 7:91484457-91484479 TGGGGCCTTTTGGAGGGTGGAGG - Intergenic
1029436151 7:100565144-100565166 AGAGGCTTTGTGGAATCTGAGGG - Exonic
1029629922 7:101743840-101743862 AGAGGCCTCATGGAGGGGGGCGG - Intergenic
1030461424 7:109840416-109840438 AGAGGCCATTTGGAGGGTAGGGG + Intergenic
1030573544 7:111257934-111257956 CGAGGCCTGTTGGGGGCTGGGGG - Intronic
1030753794 7:113263953-113263975 TGCGGCCTTTTGGAGGGTGGAGG - Intergenic
1031751301 7:125578377-125578399 TGGGGCCTTTTGGAGGGTGGAGG + Intergenic
1031816845 7:126448873-126448895 TGGGGCCTTTTGGAGGGTGGAGG + Intronic
1032172862 7:129600384-129600406 ACAGGCCTTGTGGAGGGAGAAGG - Intergenic
1033030836 7:137824712-137824734 TGGGGCCTTTTGGAGGGTGGAGG - Intronic
1034296740 7:149979857-149979879 AGAGGCCTTTTGGATGCTGGAGG + Intergenic
1034806983 7:154097755-154097777 TGAGGGCTTGTGGAGGCAGCAGG + Intronic
1034809289 7:154116972-154116994 AGAGGCCTTTTGGATGCTGGAGG - Intronic
1035286229 7:157809194-157809216 AGATGCCTTATGGAGCCAGGAGG + Intronic
1035295500 7:157864916-157864938 TGAGCCCTTGTGCAGGTTGGGGG - Intronic
1035386246 7:158474982-158475004 ACAGGCCCTGAGGAGCCTGGTGG + Intronic
1035649961 8:1256884-1256906 ACAGGCCTTGTGAATGGTGGTGG + Intergenic
1035739222 8:1913655-1913677 AGCGGCCTTCTGGAAGCTGCAGG - Intronic
1037692970 8:21198260-21198282 GAAGGCTTTGTGGAGGCTGGGGG - Intergenic
1037694906 8:21215074-21215096 AGAGGCTATGTGGAGGGGGGAGG + Intergenic
1037880906 8:22572957-22572979 AGAGGCCATGTGAAGCCTGGTGG - Intronic
1040981908 8:53252579-53252601 ACAGGCCTGGGGGAGACTGGGGG + Intergenic
1042176001 8:66037356-66037378 AGAGGCTTCGTGGGTGCTGGGGG + Intronic
1045479923 8:102583579-102583601 AGAGGCCTTGGCAAGGCTGAGGG - Intergenic
1045554211 8:103199812-103199834 TGAGGCCTATTGGAGGGTGGAGG - Intronic
1045610295 8:103832540-103832562 TGGGGCCTTTTGGAGGGTGGAGG - Intronic
1046592905 8:116227298-116227320 AGAAGCCATGTGGGGGCTGCTGG + Intergenic
1046756096 8:117974340-117974362 AGAGGGCTTGGGAAGGCAGGAGG - Intronic
1046989105 8:120429335-120429357 TGAGGCCTATTGGAGGGTGGAGG + Intronic
1047502535 8:125453365-125453387 AGAGCTCTTCTGGAGGCTGTGGG + Intergenic
1047664414 8:127074950-127074972 AGAGGCAGTGGGGAGGGTGGTGG + Intergenic
1047859322 8:128947297-128947319 AGAGGCTTTCTGGAGGATGATGG - Intergenic
1048320836 8:133399146-133399168 TGGGGCCTTTTGGAGGGTGGAGG - Intergenic
1048970484 8:139642719-139642741 GCAGGCCCTGTGGGGGCTGGAGG - Intronic
1049048742 8:140174209-140174231 TGAGGCCTCTTGGAGGATGGAGG + Intronic
1049072357 8:140365925-140365947 TGGGGCCTTTTGGAGGGTGGAGG - Intronic
1049720936 8:144115192-144115214 AGTGGCCATGTGGATGCTCGAGG + Intronic
1051001359 9:12286529-12286551 TGGGGCCTTTTGGAGGGTGGAGG + Intergenic
1052340159 9:27357309-27357331 AGGGGCCTTGTTGATCCTGGAGG + Intronic
1053008723 9:34621477-34621499 GGGGGCCCTGTGGAGGGTGGGGG + Exonic
1053123292 9:35561380-35561402 TGAGGCCCTGTGCATGCTGGTGG + Exonic
1053442456 9:38127609-38127631 AGGGGCCCTGTGGAGGAAGGAGG - Intergenic
1054451425 9:65405381-65405403 AGAGGCCCTGTGCAGCCTGCAGG - Intergenic
1054927676 9:70604537-70604559 TGAGGCCTTGAGGGGTCTGGAGG + Intronic
1055408303 9:75999213-75999235 CGAGGCCTGTTGGGGGCTGGGGG - Intronic
1056537860 9:87546570-87546592 TGAGGCCTTGTTGACCCTGGAGG - Intronic
1056802036 9:89699006-89699028 AGAGGCTCTGTGGAGGCTCCTGG + Intergenic
1056831434 9:89920308-89920330 GGAGGCCAGGTGGAGGGTGGCGG + Intergenic
1057731401 9:97612017-97612039 TGGGGCCTTTTGGAGGGTGGAGG - Intronic
1058506024 9:105667024-105667046 ATAGGCATTGTGGAGGGTGAAGG - Intergenic
1059580225 9:115537703-115537725 TGGGGCCTTTTGGAGGGTGGAGG + Intergenic
1061011226 9:127955779-127955801 CAAAGCCTTGTGGAGCCTGGAGG - Intronic
1061678517 9:132231418-132231440 AGAGCCCTGGTGGAGGGTGACGG - Intronic
1062121435 9:134835974-134835996 TGTGGCCTTTTAGAGGCTGGAGG + Intronic
1062160528 9:135077090-135077112 GAAGGCCTGGTGGAGGGTGGTGG + Intronic
1062198293 9:135286869-135286891 GGAGGCCTGGGGGAGGATGGGGG - Intergenic
1062218666 9:135402865-135402887 TGAGGGCTGATGGAGGCTGGAGG - Intergenic
1062276915 9:135735648-135735670 AGAGGCCTGTGGGAGGCAGGTGG - Intronic
1062384263 9:136302876-136302898 GGAGGCTTTGTGGAGTCTGGAGG + Exonic
1062430718 9:136525758-136525780 GAGGGGCTTGTGGAGGCTGGGGG + Intronic
1062433249 9:136535246-136535268 AGGGGCCTTGTGAACCCTGGGGG - Intronic
1062477472 9:136735932-136735954 ACGGGCCCTGTGGAGGGTGGAGG + Intergenic
1062707180 9:137952187-137952209 GGAGGCCTGTTGGGGGCTGGGGG + Intronic
1185732437 X:2472314-2472336 AGGGGCCTGCTGGAGGGTGGAGG + Intronic
1186465276 X:9779911-9779933 AGAGGGCTTGGAGAGGGTGGAGG - Intronic
1187184907 X:16974869-16974891 TGAGGCCTATTGGAGGATGGAGG - Intronic
1187959211 X:24552406-24552428 AGAGTCCTAGTGGTGGATGGTGG - Intergenic
1189310124 X:40012931-40012953 AGAGGCCATGTGGAGACCTGCGG + Intergenic
1189858004 X:45242904-45242926 TGAGGCCTACTGGAGGATGGAGG - Intergenic
1190777328 X:53563449-53563471 GGAGGCCTAGAGGAGGCTGTAGG - Intronic
1191192142 X:57678851-57678873 AGAGGACTTGGCGAGGCTCGGGG - Intergenic
1193276646 X:79596513-79596535 TGGGGCCTTTTGGAGGGTGGAGG - Intergenic
1193932174 X:87566901-87566923 TGAGGCGTTTTGGAGGGTGGAGG + Intronic
1193986028 X:88241498-88241520 AGGGGCCTTTTGGAGGGTGCAGG + Intergenic
1194614550 X:96085423-96085445 TGGGGCCTTTTGGAGGGTGGAGG - Intergenic
1194891332 X:99383738-99383760 TGGGGCCTTTTGGAGGGTGGAGG + Intergenic
1196116522 X:112005298-112005320 TGGGGCCTTCTGGAGGATGGAGG + Intronic
1197134216 X:123041989-123042011 AGAGTTATTGTGGAGGCTGGAGG - Intergenic
1197505650 X:127300402-127300424 CGAGACCTTTTGGAGGGTGGAGG + Intergenic
1197942115 X:131801430-131801452 GAAGGCACTGTGGAGGCTGGGGG + Intergenic
1198755025 X:139973681-139973703 AGAGGTCATGTGGAGGGTAGAGG + Intergenic
1198931340 X:141864612-141864634 AGAAGCCTGTTGGAGGTTGGAGG + Intronic
1199620649 X:149697490-149697512 AGAGGTCTTTTCGAGGCTGATGG + Intronic
1200085109 X:153600204-153600226 AGAGGACTTGGGGAGGCTGGTGG - Intergenic
1200380975 X:155836922-155836944 TGGGGCCTTTTGGAGGGTGGAGG + Intergenic
1201708535 Y:16963785-16963807 GGAGGCCTTTTGGAGACTGGAGG + Intergenic
1201727595 Y:17170832-17170854 AGGGGCCATGTGGTGGCTGCTGG + Intergenic