ID: 1176215977

View in Genome Browser
Species Human (GRCh38)
Location 20:63947942-63947964
Sequence CCCCAGAGGCTGCCCCTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 644
Summary {0: 1, 1: 2, 2: 6, 3: 74, 4: 561}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176215977_1176215985 9 Left 1176215977 20:63947942-63947964 CCTGGGAGGGGCAGCCTCTGGGG 0: 1
1: 2
2: 6
3: 74
4: 561
Right 1176215985 20:63947974-63947996 ATGGCCGAGTGCCCTGCTGGGGG 0: 1
1: 0
2: 0
3: 14
4: 132
1176215977_1176215991 17 Left 1176215977 20:63947942-63947964 CCTGGGAGGGGCAGCCTCTGGGG 0: 1
1: 2
2: 6
3: 74
4: 561
Right 1176215991 20:63947982-63948004 GTGCCCTGCTGGGGGGTTGGGGG 0: 1
1: 0
2: 6
3: 115
4: 1255
1176215977_1176215983 7 Left 1176215977 20:63947942-63947964 CCTGGGAGGGGCAGCCTCTGGGG 0: 1
1: 2
2: 6
3: 74
4: 561
Right 1176215983 20:63947972-63947994 ATATGGCCGAGTGCCCTGCTGGG 0: 1
1: 0
2: 0
3: 8
4: 78
1176215977_1176215992 18 Left 1176215977 20:63947942-63947964 CCTGGGAGGGGCAGCCTCTGGGG 0: 1
1: 2
2: 6
3: 74
4: 561
Right 1176215992 20:63947983-63948005 TGCCCTGCTGGGGGGTTGGGGGG 0: 1
1: 1
2: 5
3: 70
4: 601
1176215977_1176215996 30 Left 1176215977 20:63947942-63947964 CCTGGGAGGGGCAGCCTCTGGGG 0: 1
1: 2
2: 6
3: 74
4: 561
Right 1176215996 20:63947995-63948017 GGGTTGGGGGGGCATCAACGTGG 0: 1
1: 0
2: 2
3: 6
4: 116
1176215977_1176215980 -10 Left 1176215977 20:63947942-63947964 CCTGGGAGGGGCAGCCTCTGGGG 0: 1
1: 2
2: 6
3: 74
4: 561
Right 1176215980 20:63947955-63947977 GCCTCTGGGGAGGCTCAATATGG 0: 1
1: 0
2: 0
3: 10
4: 208
1176215977_1176215982 6 Left 1176215977 20:63947942-63947964 CCTGGGAGGGGCAGCCTCTGGGG 0: 1
1: 2
2: 6
3: 74
4: 561
Right 1176215982 20:63947971-63947993 AATATGGCCGAGTGCCCTGCTGG 0: 1
1: 0
2: 0
3: 7
4: 45
1176215977_1176215993 19 Left 1176215977 20:63947942-63947964 CCTGGGAGGGGCAGCCTCTGGGG 0: 1
1: 2
2: 6
3: 74
4: 561
Right 1176215993 20:63947984-63948006 GCCCTGCTGGGGGGTTGGGGGGG 0: 1
1: 1
2: 5
3: 136
4: 1033
1176215977_1176215988 14 Left 1176215977 20:63947942-63947964 CCTGGGAGGGGCAGCCTCTGGGG 0: 1
1: 2
2: 6
3: 74
4: 561
Right 1176215988 20:63947979-63948001 CGAGTGCCCTGCTGGGGGGTTGG No data
1176215977_1176215984 8 Left 1176215977 20:63947942-63947964 CCTGGGAGGGGCAGCCTCTGGGG 0: 1
1: 2
2: 6
3: 74
4: 561
Right 1176215984 20:63947973-63947995 TATGGCCGAGTGCCCTGCTGGGG 0: 1
1: 0
2: 0
3: 7
4: 86
1176215977_1176215990 16 Left 1176215977 20:63947942-63947964 CCTGGGAGGGGCAGCCTCTGGGG 0: 1
1: 2
2: 6
3: 74
4: 561
Right 1176215990 20:63947981-63948003 AGTGCCCTGCTGGGGGGTTGGGG 0: 1
1: 0
2: 0
3: 32
4: 422
1176215977_1176215986 10 Left 1176215977 20:63947942-63947964 CCTGGGAGGGGCAGCCTCTGGGG 0: 1
1: 2
2: 6
3: 74
4: 561
Right 1176215986 20:63947975-63947997 TGGCCGAGTGCCCTGCTGGGGGG 0: 1
1: 0
2: 6
3: 28
4: 289
1176215977_1176215989 15 Left 1176215977 20:63947942-63947964 CCTGGGAGGGGCAGCCTCTGGGG 0: 1
1: 2
2: 6
3: 74
4: 561
Right 1176215989 20:63947980-63948002 GAGTGCCCTGCTGGGGGGTTGGG 0: 1
1: 0
2: 0
3: 27
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176215977 Original CRISPR CCCCAGAGGCTGCCCCTCCC AGG (reversed) Intronic
900087685 1:906182-906204 CCCAAGAAGATGGCCCTCCCGGG - Intergenic
900140464 1:1137439-1137461 CCCCCCACGCGGCCCCTCCCCGG + Intergenic
900243117 1:1626123-1626145 GCCCCGGGCCTGCCCCTCCCAGG - Intronic
900309200 1:2025208-2025230 CCTGAGAAGCTGCACCTCCCTGG - Intronic
900475298 1:2873570-2873592 CCCCAGTGGCTGCCTGTCCCAGG - Intergenic
900484716 1:2916837-2916859 CCCCACAAGCTGCCCCGCCTCGG - Intergenic
900511492 1:3063075-3063097 CCGCAGAGTCTGGCCCGCCCTGG - Intergenic
900548907 1:3243852-3243874 CCCCAGGGACTTCACCTCCCTGG - Intronic
900621823 1:3591049-3591071 CCACAGAGGCAGAGCCTCCCAGG + Intronic
900786433 1:4653383-4653405 CCTCACTGGCTGCCCCTCCCAGG + Intergenic
900811298 1:4803275-4803297 ACAGACAGGCTGCCCCTCCCAGG - Intergenic
900881144 1:5382227-5382249 CCCCAGAAGCTTCCCCTGCCAGG - Intergenic
901068036 1:6503954-6503976 CTGCAGAGGCAGGCCCTCCCTGG - Intronic
901212480 1:7534405-7534427 CCACAGTGGCTTCTCCTCCCCGG - Intronic
901229356 1:7633406-7633428 CCCCAGATGCCACCCCTCCTGGG + Intronic
901405997 1:9046170-9046192 CCCTTGAGGGAGCCCCTCCCAGG - Intronic
901432118 1:9222881-9222903 CCTAAGGGACTGCCCCTCCCAGG + Intergenic
901443463 1:9293117-9293139 CCCCCGCGCCTCCCCCTCCCGGG - Intronic
901654204 1:10760043-10760065 CTCCACAGACTACCCCTCCCTGG + Intronic
901791020 1:11653844-11653866 CTGGAGGGGCTGCCCCTCCCCGG - Intronic
901974247 1:12931908-12931930 CCCCAGAGTCTCCCCCTCCAGGG + Intronic
902010928 1:13269860-13269882 CCCCAGAGTCTCCCCCTCCAGGG - Intergenic
902293741 1:15451949-15451971 CCCCACAGGCTACACCTCCCTGG - Intergenic
902370934 1:16006368-16006390 GCCCAGAGGCTGCAATTCCCAGG + Exonic
902746106 1:18475699-18475721 CAGGAGAGACTGCCCCTCCCAGG + Intergenic
903068938 1:20717251-20717273 CCCCAGCGTCTCCGCCTCCCGGG - Intronic
903261806 1:22135684-22135706 CTCCAAAGCCTGCCCCTCCAGGG - Intronic
904478873 1:30782062-30782084 CCTCAGCGCCTGCCCCTTCCTGG - Intergenic
904613087 1:31735877-31735899 CCCCAGCTGCTGGCTCTCCCTGG - Exonic
904899834 1:33848184-33848206 CCCAGGATACTGCCCCTCCCGGG - Intronic
905223691 1:36466186-36466208 CTCCATAGGCTGGGCCTCCCAGG - Exonic
905271340 1:36789651-36789673 CCCCAGAGACAGCCAATCCCAGG - Intergenic
905369381 1:37474960-37474982 CCCCAGAAACTTGCCCTCCCCGG + Intronic
905476066 1:38229055-38229077 CCCCACAGGGTGCCACACCCAGG - Intergenic
906145678 1:43558741-43558763 CCCCCAGGGCTCCCCCTCCCTGG - Intronic
906524384 1:46485863-46485885 CCCCAACGGCTGGCGCTCCCCGG - Intergenic
906590041 1:47016415-47016437 CCCCACAAGCTCCACCTCCCAGG + Intergenic
906675226 1:47688421-47688443 CCCCACAGGCAACCCCACCCCGG + Intergenic
907245123 1:53103503-53103525 CACCAGAGGAGGCCCCTCCTCGG - Exonic
907442310 1:54486756-54486778 CCCCAGCTTCTGCCCCTCCTAGG + Intergenic
912955427 1:114152177-114152199 CCCCAGCGGCTGCAGGTCCCAGG - Intronic
913257531 1:116967255-116967277 CGCCAAAGGCTGCCCCTGACAGG - Exonic
913594156 1:120357270-120357292 TCCCAGAGGCTGCCCCGCACAGG - Intergenic
914093103 1:144521726-144521748 TCCCAGAGGCTGCCCTGCACAGG + Intergenic
914305423 1:146412158-146412180 TCCCAGAGGCTGCCCTGCACAGG - Intergenic
914384590 1:147156023-147156045 CCCTAATGGCTACCCCTCCCAGG + Exonic
914596636 1:149160645-149160667 TCCCAGAGGCTGCCCTGCACAGG + Intergenic
915061521 1:153189856-153189878 CTGCAGTGTCTGCCCCTCCCAGG - Intergenic
915290220 1:154878519-154878541 CCCCTGAGCCAGCCCCTCCCTGG + Intergenic
915650420 1:157306607-157306629 CCCCAGCAGCCGCCCCTCTCAGG + Intergenic
916548305 1:165827500-165827522 CCCCAGCCTCCGCCCCTCCCGGG - Intronic
917141618 1:171841402-171841424 GCCCCGCGGCTGCCCCGCCCCGG - Intergenic
919465047 1:197916224-197916246 CGGCAGCGGCGGCCCCTCCCCGG - Intronic
919743138 1:200992450-200992472 CCTCAGAGCTGGCCCCTCCCTGG - Intronic
919746407 1:201011719-201011741 CCTCAGAGGCTGCCCAGGCCAGG - Intronic
920093064 1:203467925-203467947 CCCCAGTGGATGGCCCTCCCAGG - Intergenic
921672474 1:217941597-217941619 CCCCAGAGCCTGCCAGTGCCTGG - Intergenic
922108132 1:222530293-222530315 CCCCAGAGGCAGGCCTGCCCAGG - Intronic
922518084 1:226223374-226223396 CCCTCCGGGCTGCCCCTCCCAGG + Intergenic
922571249 1:226635791-226635813 CCAAAGAGCCTGCCCCTCCTGGG + Intronic
922873106 1:228918910-228918932 CTGGAGGGGCTGCCCCTCCCAGG + Intergenic
922887624 1:229032052-229032074 CCCCAGAGGCTGGCCGGCCTGGG + Intergenic
923188397 1:231596383-231596405 CCCCAGAGTAGGCCCCTCCGCGG + Intronic
923224938 1:231930556-231930578 CTCCAGAGGCTCCCACTGCCTGG - Intronic
923453416 1:234141326-234141348 CCCTAGACCCTGCCCCTCACAGG + Intronic
923677817 1:236095626-236095648 CAAGAGGGGCTGCCCCTCCCAGG + Intergenic
924561099 1:245156645-245156667 GCCCTGAGGTTGCTCCTCCCGGG + Exonic
1062967366 10:1617989-1618011 CCCCTAAGGCTGCATCTCCCCGG + Intronic
1063123042 10:3118019-3118041 CACCAGACTGTGCCCCTCCCTGG - Intronic
1063167244 10:3474445-3474467 CCCCACAGTCCGCCCCTCCCCGG + Intergenic
1064155226 10:12898209-12898231 CCCCACGCGCTGCCCCTTCCTGG - Exonic
1064220842 10:13439364-13439386 CACGAGATGCTGCTCCTCCCAGG + Exonic
1064265344 10:13821116-13821138 CCGCAGCAGCTTCCCCTCCCCGG - Intronic
1065726076 10:28668880-28668902 CGCCCGAGCCCGCCCCTCCCCGG - Intergenic
1065828955 10:29597141-29597163 CCCAAGAGGTTGCTTCTCCCTGG - Intronic
1065965615 10:30768037-30768059 CTCCAGGGGGTGCCCCTCACTGG - Intergenic
1066059202 10:31707347-31707369 CTCCCCAGGCTGCCCCTCCCGGG + Intergenic
1067792963 10:49301579-49301601 TCCCACAGGCAGCCCCTTCCAGG - Intronic
1069688610 10:70335056-70335078 CCTCAGAGCCAGGCCCTCCCAGG - Intronic
1070771140 10:79082912-79082934 CCCCAGACTCTGCCCTCCCCAGG - Intronic
1071559280 10:86632556-86632578 CCCCTGAGGCTGGCCCTGCAGGG - Intergenic
1072563197 10:96596003-96596025 CTGGAGAGACTGCCCCTCCCAGG + Intronic
1073070195 10:100788433-100788455 GACCAGAGGCTGCCACTGCCTGG + Intronic
1073147198 10:101288643-101288665 CAGCAGAGGCTGTCCCTCCAGGG + Intergenic
1073749365 10:106506720-106506742 CTTGAGAGGCTGCCACTCCCAGG - Intergenic
1074312044 10:112330331-112330353 TCCCAGAGGCAGCCCCAGCCAGG - Intergenic
1075099508 10:119496254-119496276 CTGGAGAGACTGCCCCTCCCGGG + Intergenic
1075495816 10:122917572-122917594 TCCCACAGGCTTCCCTTCCCAGG + Intergenic
1075923059 10:126229137-126229159 CCTCAGAGCCTCCCCTTCCCAGG + Intronic
1076402114 10:130191058-130191080 CCCCAGAGTCGGCCCTCCCCAGG + Intergenic
1076728051 10:132422373-132422395 CCCCAGAGCCTTCTCCTCCGTGG - Intergenic
1076807365 10:132865665-132865687 CCCCAGAGGGTGTCTCTGCCAGG - Intronic
1077010255 11:376469-376491 CCACCGAGGCGGCCCCGCCCAGG + Exonic
1077116123 11:885406-885428 CCCCAGAGTCTGTCCACCCCAGG + Intronic
1077273478 11:1692628-1692650 CTCCAGCCCCTGCCCCTCCCCGG - Intergenic
1077368992 11:2172828-2172850 TCCCAGCCGCTGCCCCACCCAGG + Intergenic
1077393793 11:2311498-2311520 CCTCACAGTCTGCCCCACCCTGG + Intronic
1077491789 11:2864344-2864366 CCTCAGGGGCTGCTCTTCCCTGG + Intergenic
1077545029 11:3165432-3165454 GCCCAGGGGCTGCCCCCCACCGG + Intronic
1077555539 11:3224300-3224322 CCCAAGAGACGGCCCTTCCCAGG - Intergenic
1078328846 11:10402171-10402193 GCCCAGAGTGTGCCCCTGCCAGG - Intronic
1080742979 11:35082831-35082853 TTCCAGAGGCAGCCCCTCTCTGG - Intergenic
1081652233 11:44832182-44832204 CCCCAGTGGCTGCCCGTGCTAGG + Intronic
1083178941 11:60972044-60972066 CCCCAGATGCTGGACCTCCCTGG - Intronic
1083227805 11:61295478-61295500 CACCAGAGGCTGCGCGCCCCGGG + Intergenic
1083316453 11:61817294-61817316 CTCCAGACGCTGACCCTCCAGGG + Intronic
1083325457 11:61870793-61870815 CCCAAGAGCCAGCCCCTGCCTGG - Intergenic
1083562185 11:63681726-63681748 CCCAGGAGCCTGCCCCGCCCTGG + Exonic
1084218827 11:67665732-67665754 GCCCAGAGCCTGCTCCTCCCTGG + Intronic
1084391951 11:68883083-68883105 CCCCTGATGCAGCCCCTTCCTGG + Intergenic
1084427503 11:69093712-69093734 CCCAAGAGGTGGCCGCTCCCTGG - Intergenic
1084872950 11:72109978-72110000 CCCCAGATCCTGCCCCTGGCTGG + Exonic
1085202955 11:74712759-74712781 CCCCTCTGGCTGCCCCTCACTGG + Intronic
1085400075 11:76230584-76230606 CCCCAGGGGCTGACCCTGCTTGG - Intergenic
1086060917 11:82699105-82699127 GCCCAGAGTCTGCCCTTCACAGG + Intergenic
1086113171 11:83220082-83220104 CACCAGAGGCTCCCCCTGCATGG - Intronic
1089159307 11:116425153-116425175 CCCCTCAGGCTGGCCCTCCTTGG - Intergenic
1089616388 11:119697055-119697077 GCTCGCAGGCTGCCCCTCCCAGG - Intronic
1089760825 11:120721798-120721820 CGGGAGAGACTGCCCCTCCCAGG - Intronic
1089958586 11:122595861-122595883 CCCAAGTGACTGTCCCTCCCTGG - Intergenic
1089970617 11:122690029-122690051 CCCCAGAGAATGTCCCACCCTGG - Intronic
1090587746 11:128232902-128232924 CCCCAGAGGGTCCCCCCGCCTGG - Intergenic
1091399828 12:175057-175079 CCCCAGTGGCCAGCCCTCCCAGG - Exonic
1092160440 12:6312657-6312679 CCCCAGAGCTGGCGCCTCCCAGG + Intronic
1092754725 12:11752653-11752675 CCTCAGAGCTTGCCCCTCTCTGG - Intronic
1092892387 12:12980921-12980943 CCCCAGAGGCTGCTCAGCTCTGG - Intronic
1093583171 12:20807326-20807348 ACCCAGAGGCTGCCTCACCTGGG + Intergenic
1095730521 12:45501505-45501527 CCCCACAGGATGCCCCTTCATGG + Intergenic
1095985352 12:47995626-47995648 CCGCAGCTGCTGTCCCTCCCAGG - Intronic
1096241126 12:49961099-49961121 CCCCGGAGGCGCCCTCTCCCAGG - Intergenic
1096510200 12:52123597-52123619 AGCCAGAGGCTGCTCCTCCCAGG - Intergenic
1096624430 12:52885212-52885234 CCTGAGAGTCTGCCCCTCCGGGG + Intergenic
1097023111 12:56034783-56034805 ACCCAGATGCAGCCCCTCCCTGG + Exonic
1097906193 12:64921942-64921964 CCCAAGAAGCTGCTTCTCCCTGG + Intergenic
1098032526 12:66269062-66269084 CCTCAGAGGCTGCCATTCTCTGG + Intergenic
1098140425 12:67445050-67445072 CCCTAGAAGCTACCTCTCCCAGG + Intergenic
1098160906 12:67648171-67648193 GCTCAGCGGCCGCCCCTCCCGGG + Intergenic
1098213026 12:68186227-68186249 CCCCAGAGGTGGTCACTCCCAGG + Intergenic
1100364476 12:93907142-93907164 CTCCTGGGGCTGCCCCTCCGTGG + Intergenic
1102554633 12:113718976-113718998 CTCCTGGGGCTGCTCCTCCCTGG + Intergenic
1102558793 12:113747568-113747590 CTCCAGGAGCTGCCCCTCTCAGG + Intergenic
1102888477 12:116539359-116539381 CCCCAGAGGCTGCCTGCCCTGGG - Intergenic
1102952869 12:117041916-117041938 CCCCCGAGGCTCCCACGCCCAGG + Intronic
1103173859 12:118844719-118844741 TCTCAGAGGATGCCCCTCACAGG + Intergenic
1103906043 12:124327674-124327696 CCCCTCTGGCTCCCCCTCCCCGG - Intronic
1104039874 12:125122759-125122781 GCCCACAGGCAGCCCCTCCAGGG - Intronic
1104843413 12:131835104-131835126 CCCCCAAGACGGCCCCTCCCAGG + Intronic
1104982572 12:132580850-132580872 CCCCTGCAGCAGCCCCTCCCAGG + Intronic
1105007157 12:132728720-132728742 ACCCAGAGGCGACTCCTCCCTGG - Intronic
1105039719 12:132953245-132953267 CCCAAGAGGCCGCCCCTCCAGGG + Intronic
1105337505 13:19487306-19487328 TCCCACAGGCTGCCCCTAGCAGG - Intronic
1105344799 13:19561873-19561895 CCCCAGAGCCGGCCCCCGCCTGG + Intergenic
1105407797 13:20145927-20145949 GCCCAGAGGCTGCTCTTGCCCGG - Intronic
1105634916 13:22207834-22207856 CCTGAGAGGCTGCCCCTCCCAGG + Intergenic
1105853729 13:24358295-24358317 CCCCACAGGGGGCCCCTACCTGG + Intergenic
1106036106 13:26046878-26046900 CCCCAGTGCCAGCACCTCCCGGG - Exonic
1107195377 13:37644795-37644817 CACCACAGGCTCCACCTCCCGGG - Intronic
1110220930 13:73072393-73072415 CCACAGAGGCTGGCACTGCCAGG + Intronic
1112607319 13:100919733-100919755 CCCCAGATGATTCCCTTCCCTGG - Intergenic
1113878659 13:113609913-113609935 TCCCAGAGGCCGCCCCTCCAAGG + Intronic
1114663577 14:24366333-24366355 CCCCAGACTCTGCCCCTCCCCGG - Intronic
1114673873 14:24428844-24428866 GCCCAGGGGGTGCCTCTCCCAGG + Exonic
1117135507 14:52730717-52730739 CACCAGACGCTGCCCCTCCGCGG - Intronic
1118752924 14:68819597-68819619 CTTCAGAGGGAGCCCCTCCCTGG + Intergenic
1119106877 14:71932816-71932838 CCCAAGAGGCTGCCGGTCCCCGG + Exonic
1119125912 14:72126250-72126272 CCCCAAAGGCTACCCTTCTCTGG - Intronic
1119420792 14:74506643-74506665 CCCCAGGGCCTTCCCTTCCCTGG + Intronic
1119430773 14:74566963-74566985 CCCCAGGGGATGACCCTGCCAGG + Intronic
1121227813 14:92334274-92334296 CTCCGGAGGCTGCCCTTCTCAGG - Intronic
1121312761 14:92944126-92944148 CTCCAGAGCCAGCCCCTCTCTGG + Intronic
1121465284 14:94111783-94111805 CCCCAGCACCAGCCCCTCCCAGG - Intronic
1121701124 14:95954920-95954942 CCCCAGAGGCAGGCCCTCTGTGG + Intergenic
1121893460 14:97621502-97621524 TCCAAGATGCTGCCCCTTCCAGG - Intergenic
1122096215 14:99374868-99374890 CCCCAGAGACTGTCCCCTCCAGG + Intergenic
1122209344 14:100165075-100165097 CTAGAGAGGCTGCCCCTCCTAGG + Intergenic
1122572058 14:102711363-102711385 CCCCAGCGTCTGCCCATCCTAGG + Intronic
1122695915 14:103552024-103552046 GCCCTGACACTGCCCCTCCCTGG + Intergenic
1122788677 14:104175427-104175449 CACCAGAGGCTGCATCCCCCAGG + Exonic
1122816648 14:104317213-104317235 ACCCAGAGGCTGAGCTTCCCCGG - Intergenic
1122834250 14:104423371-104423393 GCCCTCAGCCTGCCCCTCCCAGG - Intergenic
1123047720 14:105526820-105526842 CCCCCGAGGCTTCCCCACGCAGG - Intronic
1124042570 15:26118697-26118719 CTGCAGGGACTGCCCCTCCCAGG - Intergenic
1124529253 15:30489320-30489342 CACCACAAGCTCCCCCTCCCGGG + Intergenic
1124554095 15:30709452-30709474 CGCCAGCGGCTGCCCCTCTGTGG + Intronic
1124662538 15:31562183-31562205 GGGGAGAGGCTGCCCCTCCCAGG + Intronic
1124677150 15:31696219-31696241 CGCCAGCGGCTGCCCCTCTGTGG - Intronic
1124882197 15:33652880-33652902 CCCCAGAAGCCGCCCTTACCTGG - Exonic
1126164714 15:45644980-45645002 TCCCAGAGACTGCCCCTCCCAGG - Intronic
1126582226 15:50252399-50252421 CCCACCAGGCTGCCCGTCCCTGG + Intronic
1126702981 15:51384176-51384198 GCCCACAGAATGCCCCTCCCAGG - Intronic
1127488209 15:59438304-59438326 CCCCAGAGGCCGCCCGGCCGGGG - Intronic
1127547626 15:60005204-60005226 GCCCAGAAGCTGCCCTTGCCTGG - Exonic
1127734921 15:61831240-61831262 GCCCAGCGGCTGCCCCACACTGG - Intergenic
1127868241 15:63048736-63048758 CCCCAGAGGCGCATCCTCCCGGG + Intronic
1128119216 15:65133483-65133505 CCCCAGTGTCGGCCCTTCCCGGG - Exonic
1128309721 15:66622440-66622462 CTCCCCGGGCTGCCCCTCCCAGG + Intronic
1128612389 15:69084495-69084517 CCCCAAGGTCTCCCCCTCCCTGG - Intergenic
1128643548 15:69358478-69358500 CACCAGAGGCTGCCCCTGGACGG - Intronic
1129071222 15:72953094-72953116 TCCCAAAGGCTGATCCTCCCAGG + Intergenic
1129156607 15:73722112-73722134 CCACAGAGCCAGCCCCTCCAAGG + Intergenic
1130305355 15:82709488-82709510 CCCCAGCGCCGGCCCCGCCCCGG - Intronic
1130710697 15:86278273-86278295 CCCCAGTGGCTGTCACACCCAGG - Intronic
1131268996 15:90935281-90935303 CCCCAGAGACTGCGCCTGCGCGG + Exonic
1132240704 15:100255291-100255313 GCCCAGACACGGCCCCTCCCAGG + Intronic
1132478383 16:153728-153750 CCCAGGCAGCTGCCCCTCCCAGG - Intronic
1132480468 16:164318-164340 CCCAGGCAGCTGCCCCTCCCAGG - Intronic
1132588843 16:717660-717682 ACCCAGCAGCGGCCCCTCCCCGG - Exonic
1132589637 16:721051-721073 CCCCCGAGGCTGCAGCTCGCCGG + Exonic
1132711232 16:1268899-1268921 CCCCAGAGCCGGCTCCGCCCTGG - Intergenic
1132852628 16:2031575-2031597 ACCCAGAGGAAGCCCCTCCTAGG - Intronic
1133069243 16:3234939-3234961 CCCCAGAGGCGGCCTCAGCCTGG + Exonic
1133119076 16:3595318-3595340 CCCCAGAGCCTGCCCTGTCCTGG - Intronic
1133218886 16:4309857-4309879 CCCCTGGGGCTGCACCTCCTGGG + Intergenic
1133737550 16:8627450-8627472 CTCCACAGACAGCCCCTCCCTGG + Intronic
1133937309 16:10279788-10279810 ACCCAGAGGCTCCCTCTCTCTGG + Intergenic
1135396818 16:22138140-22138162 GCCCAGAGCCTGTGCCTCCCAGG + Intronic
1136395702 16:29991433-29991455 CCCCCGAGGCTGCCCGCCGCAGG - Intronic
1136630229 16:31485615-31485637 CCCCAGATGTGGCCCTTCCCAGG + Intronic
1137328985 16:47471306-47471328 CCCAAGACCCTGCCCATCCCAGG - Intronic
1137671908 16:50284093-50284115 ACCCAGAGGCACCCCCTGCCCGG - Intronic
1137724099 16:50645497-50645519 CCCCAGATTCTGCCCATACCGGG - Intergenic
1139402791 16:66696136-66696158 GGCCAGAGCCTGCCCTTCCCAGG - Intronic
1139958153 16:70703080-70703102 CACCAGGGGCTGTCCCTGCCCGG + Intronic
1140054241 16:71511524-71511546 CCCCAGAGGTTTTGCCTCCCAGG + Intronic
1140535432 16:75705209-75705231 ACCTTGAGGCTTCCCCTCCCTGG + Intronic
1140738939 16:77924323-77924345 TCCCATAAGATGCCCCTCCCTGG + Intronic
1140778355 16:78271620-78271642 CCTCAGAGGCTCCACCTCACTGG - Intronic
1141427827 16:83955139-83955161 CCCCAGTGGCTGCTGTTCCCGGG + Intronic
1141648335 16:85379158-85379180 CCTCGATGGCTGCCCCTCCCTGG + Intergenic
1141973429 16:87497474-87497496 CCATAGACTCTGCCCCTCCCAGG + Intergenic
1142199289 16:88753432-88753454 CCCGTGAGGCTGCCCCTGCTTGG - Intronic
1142485428 17:244595-244617 CACCAGACGCTGCTCCTCCTGGG - Intronic
1142811376 17:2397070-2397092 CCACTGAGGCTTCCCCTCCCAGG - Intronic
1143037249 17:4006442-4006464 CCCCAGTGGCTGCCCAGCCTGGG - Exonic
1143186424 17:5013019-5013041 CCCCAGTGACTACCCCTCCCTGG - Intronic
1144192596 17:12860135-12860157 CCAAAGAAACTGCCCCTCCCAGG - Intronic
1144650288 17:17002927-17002949 CCCCAGAGGTTGCCCCGCTGAGG + Intergenic
1144726096 17:17503556-17503578 CCCCAGAGCCTGTCCCACCGCGG - Intergenic
1144792581 17:17869031-17869053 CCCCAAGTGCTACCCCTCCCTGG + Intronic
1144966264 17:19078592-19078614 ACCCAGGGGCTGCCTCTCCCAGG + Intergenic
1144981654 17:19173465-19173487 ACCCAGGGGCTGCCTCTCCCAGG - Intergenic
1144986570 17:19204774-19204796 ACCCAGGGGCTGCCTCTCCCAGG + Intergenic
1145266826 17:21383579-21383601 CCCCTGAGTTTGCCCCTCCCAGG - Intronic
1145912907 17:28552658-28552680 CCCCAGGTACTGCCCCGCCCCGG + Exonic
1146306898 17:31736998-31737020 CACTGGAGCCTGCCCCTCCCTGG + Intergenic
1147661520 17:42119508-42119530 CCCCCGAAGCTGCCCCTGGCTGG + Intronic
1147951535 17:44110532-44110554 GCCCAGAGCCTGCTGCTCCCCGG - Intronic
1148246111 17:46031976-46031998 CAGCAGATGCTGCCCCTTCCTGG + Intronic
1148582427 17:48752930-48752952 CCCCCGAGCCTGCCCCCACCCGG - Intergenic
1148779371 17:50112847-50112869 AGCCAGTGGCTGCCCCTGCCGGG + Exonic
1148819790 17:50353860-50353882 CCCCAGCTGCTGCCCCACTCAGG - Exonic
1149868566 17:60163630-60163652 CTCCAAAGGAAGCCCCTCCCTGG - Intronic
1151194462 17:72421663-72421685 CCCAAGAGGCAGCTCCTGCCTGG + Intergenic
1151242931 17:72772193-72772215 CCCCAAAGACTGCCCTTCCTGGG - Intronic
1151383825 17:73743200-73743222 CGCCCTTGGCTGCCCCTCCCAGG + Intergenic
1151479533 17:74362013-74362035 CCCCCGGGGCTGCCGCTCTCTGG - Intergenic
1151551797 17:74826659-74826681 CCCCAAAGGGAGCTCCTCCCAGG + Intronic
1151750511 17:76034637-76034659 CCCCAGCCACAGCCCCTCCCAGG + Intergenic
1151975241 17:77480675-77480697 CCCCTGTGGCTGCCCCTGCTGGG + Intronic
1152114533 17:78377450-78377472 CCCCAGAGGCTGCAGCTCCATGG - Intergenic
1152130609 17:78474067-78474089 TCCCAGAGGTTGGCCGTCCCTGG + Intronic
1152229444 17:79107104-79107126 CCACAGAGGCTGAACCTCCACGG + Intronic
1152587612 17:81196057-81196079 CCCCTGGGGCTGCCCCTCCTAGG + Intronic
1152637105 17:81434728-81434750 CCCCCCAGGCTGCCCTTCCAGGG - Intronic
1152637425 17:81435817-81435839 CCTCAGTGGCAGCCCCTTCCAGG + Intronic
1152779616 17:82220392-82220414 CCTCACAGGCAGCCCCTGCCTGG + Intergenic
1152811003 17:82382875-82382897 CCCCAGGCCCTGCCCTTCCCTGG + Intergenic
1154412300 18:14148082-14148104 CCCCAGATCCTGCCCAGCCCAGG + Intergenic
1155069286 18:22299221-22299243 CCCCAGTGGCTTTCTCTCCCTGG - Intergenic
1156362803 18:36399262-36399284 CCCCAGATGCTTGCCCTCCTTGG - Intronic
1157492364 18:48133116-48133138 GACCACAGGCTGCCCCTCCTAGG - Intronic
1157559589 18:48637135-48637157 CCCCACAGGCTGCCCCTCCCAGG - Intronic
1158120488 18:54042972-54042994 TCCCAGGGGCTGCCCCTCGCAGG - Intergenic
1158401385 18:57124340-57124362 CCCCAGAGGCTGTGCTTCCTGGG + Intergenic
1158945592 18:62444526-62444548 CCCCAGAAGCTGCTTCTCCCTGG - Intergenic
1159065794 18:63566864-63566886 CCCCAGTGGCTGCAGCTGCCTGG - Exonic
1159144987 18:64442592-64442614 CCCAAGAAGCTGCTCCTCCCTGG + Intergenic
1159746867 18:72247267-72247289 CACCAGAGCCTGCATCTCCCTGG - Intergenic
1159787667 18:72733627-72733649 TCCTGGAGGCTGCCCCTGCCTGG + Intergenic
1160313409 18:77818945-77818967 GCCCAGAAGCTGGCCCTCCCTGG - Intergenic
1160543355 18:79637765-79637787 ACCCAGAGGCAGCCCCTGGCCGG - Intergenic
1160660441 19:295714-295736 CCCCAGAGCCTCAGCCTCCCAGG - Intergenic
1160753867 19:747775-747797 CCCAAGAGGCTTCCTGTCCCAGG - Exonic
1160849166 19:1181797-1181819 GCACAGAGGCTGCCCCGACCTGG - Intronic
1161374711 19:3933512-3933534 CCCCAGGGGCCGCCTCCCCCGGG + Exonic
1161586384 19:5108016-5108038 CTCCAGGGGCTGCCACTGCCAGG - Intronic
1161595139 19:5147388-5147410 CCCCTGACGCTGGCCCTGCCTGG - Intronic
1162303187 19:9855888-9855910 CCCCAGGGGCTGCAGTTCCCTGG - Intronic
1163413434 19:17171326-17171348 CCCCACAATCTCCCCCTCCCCGG + Intronic
1163578307 19:18123393-18123415 CCCCAGCCCCGGCCCCTCCCTGG + Intronic
1163613039 19:18310805-18310827 CCCGAGATCCTGCCCCGCCCTGG + Intronic
1163830933 19:19546877-19546899 CCCCAGAGGCTCCCCTGCCAGGG - Intergenic
1164538647 19:29105943-29105965 CTCCAGAGGCTCCCACCCCCTGG + Intergenic
1164599006 19:29548688-29548710 CTCCTGAGCCTGCCCCACCCTGG - Intronic
1165262504 19:34632786-34632808 CTGGAGAGACTGCCCCTCCCAGG + Intronic
1165289813 19:34874133-34874155 ACTCAGATGCTGCCCCTCTCTGG + Intergenic
1165529878 19:36389772-36389794 CTGGATAGGCTGCCCCTCCCAGG + Intronic
1165725910 19:38112772-38112794 CCCCACAGGCAGCTCCTCTCTGG + Intronic
1166140553 19:40803040-40803062 AGCCAGAGCCGGCCCCTCCCTGG + Intronic
1166293051 19:41875547-41875569 CCCCAGAGGTAACCCCTCCCAGG + Intergenic
1166592036 19:44008118-44008140 CCCAAGAGGCAGCCTGTCCCAGG + Intronic
1166675339 19:44737574-44737596 CCCCAGAGCCTGGCTCTCCCTGG + Intergenic
1166881857 19:45934821-45934843 CCCTAGGGTCTGCCCCACCCTGG - Exonic
1167079875 19:47271437-47271459 CCCCAGAGGCTGCCCCCACCGGG + Exonic
1167108392 19:47444697-47444719 CCCCTGAGGGTGCGCCTGCCAGG - Intronic
1168063612 19:53907545-53907567 CCCCAGTGCCTGCCACTCTCTGG + Exonic
1168300198 19:55400568-55400590 TCCAAGAAGCTGCCCCTCCTTGG - Exonic
1168318798 19:55496302-55496324 CCTGAGGGACTGCCCCTCCCAGG - Intronic
1168462130 19:56567914-56567936 CAGCCGAGGCTGCCCCGCCCGGG - Exonic
1168547214 19:57263418-57263440 CCTGAGAGACTGCCCATCCCAGG + Intergenic
1202636797 1_KI270706v1_random:50485-50507 ACCAAGGGGCTGCCCCTCCTGGG + Intergenic
925318107 2:2940446-2940468 CCCCAGAGCCTGCCCCTGCCAGG + Intergenic
925318148 2:2940571-2940593 CCCCAGAGCCTGTCCCTGCCAGG + Intergenic
925893846 2:8456812-8456834 CCCCTGACGCTGGCCCTTCCAGG - Intergenic
926018527 2:9474801-9474823 CCCCAGTGGCTGCGCCTTCCGGG + Intronic
926093427 2:10065100-10065122 CCCGAGACCATGCCCCTCCCGGG + Intronic
926105028 2:10144730-10144752 CTCCACATGCTGACCCTCCCTGG - Intronic
927256556 2:21044699-21044721 CCCCAGAGGCCTCTCCTCGCTGG - Intergenic
928083823 2:28333309-28333331 CTCCAGAGCCTGCCCCGCACAGG + Intronic
928813099 2:35253600-35253622 CCCCAGAGTCTGGCTGTCCCTGG - Intergenic
929240359 2:39647372-39647394 CTGGAGAGACTGCCCCTCCCAGG - Intergenic
930232454 2:48856988-48857010 CCTGAGAGACTGCCCCTCCCAGG - Intergenic
931458661 2:62432147-62432169 CCCCGGAGTCTGGCCATCCCTGG - Intergenic
932143241 2:69297623-69297645 CCCCACAGGCAGCACCTCCTGGG + Intergenic
932492024 2:72128339-72128361 CCCCAGCCTCTGCCCCGCCCGGG - Intergenic
932580703 2:72991169-72991191 CTCCAAAGCCTCCCCCTCCCTGG + Intronic
932599434 2:73113310-73113332 GCCAAGAGGCTGGCCATCCCAGG - Intronic
932674913 2:73771297-73771319 CACAAGAGGCTGCCTCTCCATGG + Intronic
932715457 2:74097895-74097917 CCAGAGAGGCTGCCCCTCCCAGG - Intronic
933351810 2:81162399-81162421 GCTCAGATTCTGCCCCTCCCAGG + Intergenic
933480869 2:82855395-82855417 CCCAAGATGCTGACCCTTCCAGG + Intergenic
933993256 2:87648922-87648944 CCCCAGTGGCTGCCTTTCACAGG + Intergenic
934491167 2:94762779-94762801 ACCAAGGGGCTGCCCCTCCTGGG + Intergenic
935131560 2:100264822-100264844 CCCCAGATGCCGCCCCACCTGGG - Intergenic
935156537 2:100488369-100488391 CTGGAGAGACTGCCCCTCCCAGG + Intergenic
935262772 2:101369380-101369402 CCCCAGAGGCCTCCTCTACCTGG - Intronic
935512593 2:103994514-103994536 CCCCAAAAGCTCCACCTCCCGGG + Intergenic
935591174 2:104846477-104846499 CCCCTGAGGCTGGCCATCCAGGG + Intergenic
936300601 2:111301961-111301983 CCCCAGTGGCTGCCTTTCACAGG - Intergenic
936839707 2:116754587-116754609 CCACAGAGTCTCCTCCTCCCCGG + Intergenic
937894955 2:126971594-126971616 CCCACGGGGCTGGCCCTCCCGGG - Intergenic
939884295 2:147664458-147664480 CCCCAGAGGCAGCCCCTGAAAGG - Intergenic
940117578 2:150225868-150225890 CCCAAGAAGCTGCTTCTCCCTGG + Intergenic
942074270 2:172342392-172342414 CCTCACAGACTGCACCTCCCAGG + Intergenic
942145589 2:173023448-173023470 CCCCAGAGGAAGCGCCTCCTTGG - Intronic
942147447 2:173040506-173040528 CCCCAGAAGGAGCCCCTGCCAGG + Intronic
942153917 2:173107285-173107307 GTCCAGAGCCTGGCCCTCCCCGG - Intronic
945393166 2:209289062-209289084 CTGCAAAGGCTGCACCTCCCAGG - Intergenic
945775625 2:214103152-214103174 CCCAAGAAGCTGCTTCTCCCTGG + Intronic
948136716 2:235642124-235642146 CTCCAGAGGGTGCCCATCCACGG + Intronic
948208719 2:236177292-236177314 GCCCAGAGGCTGCCCTCCCACGG - Intergenic
948268644 2:236657035-236657057 CCCAAGGTGCAGCCCCTCCCAGG - Intergenic
948701286 2:239762061-239762083 TCTCAGAGGCTGCCTCTCACAGG - Intergenic
948720596 2:239897793-239897815 CCCCAGAGACTGCAGCACCCAGG + Intronic
948749605 2:240124158-240124180 ACCCAGAGGCTGCCCCCAGCGGG - Intergenic
1169193965 20:3673642-3673664 CCCCAGGGGCCGCGCCTTCCAGG - Exonic
1170606941 20:17881888-17881910 CCCATGAGGCTGGCCCTGCCTGG + Intergenic
1170781986 20:19434033-19434055 CCTGAGGGACTGCCCCTCCCAGG - Intronic
1170998667 20:21391712-21391734 ACCCCGCGGCTGGCCCTCCCGGG + Intergenic
1171385482 20:24766953-24766975 GCCCAGAGGAGGCCCCTCCTGGG - Intergenic
1171986918 20:31666920-31666942 CCCCACAGGCTGCTGCACCCTGG - Intronic
1172287783 20:33753283-33753305 CCCCAGAGCCTGGGCCCCCCTGG + Exonic
1172704346 20:36872125-36872147 CCCCAGGGGATTCCCATCCCAGG + Intergenic
1173496899 20:43526003-43526025 CCCCTGAAGATGTCCCTCCCTGG - Intronic
1173752385 20:45487500-45487522 CCCCACCGGCTGCCCCTCCAGGG + Intergenic
1174170452 20:48614844-48614866 CCTCAGAGGCTGTACCTCTCTGG + Intergenic
1174171599 20:48621123-48621145 GCCCAGAGGCTGCTGTTCCCCGG - Intergenic
1174524233 20:51158439-51158461 CCACACAGGCTGACCCACCCCGG - Intergenic
1175315669 20:58044915-58044937 CCCCTGAGGGTGCCTCCCCCAGG + Intergenic
1175545727 20:59776521-59776543 CCCCAGGGGCTGTCCTCCCCAGG - Intronic
1175778608 20:61668353-61668375 CCGCAGAGGATGCACCTGCCTGG + Intronic
1175891111 20:62316461-62316483 CGCAGGAGGCTGCTCCTCCCTGG + Intronic
1175925413 20:62468907-62468929 CCCCAGATGGTGTCTCTCCCTGG + Intronic
1175946932 20:62563314-62563336 TCCCAGAGTCCACCCCTCCCTGG - Intronic
1176026904 20:62990436-62990458 CCATAGAGGCAGCCCCTGCCTGG - Intergenic
1176124327 20:63468728-63468750 CCCCAGGGACAGGCCCTCCCCGG + Intronic
1176150684 20:63589207-63589229 TCCCTGAGCCGGCCCCTCCCAGG - Exonic
1176215977 20:63947942-63947964 CCCCAGAGGCTGCCCCTCCCAGG - Intronic
1176236435 20:64055879-64055901 TCCCTGAGGCGGCACCTCCCAGG - Intronic
1176257483 20:64159828-64159850 CCACACACCCTGCCCCTCCCTGG + Intronic
1176367982 21:6045143-6045165 CTCCAGTGGCTGCCACACCCTGG - Intergenic
1176860706 21:14010175-14010197 CCCCAGACCCTGCCCAGCCCAGG - Intergenic
1178609361 21:34067420-34067442 CTCCAGGGGCTGGGCCTCCCTGG - Intergenic
1179078076 21:38142802-38142824 CTGGAGAGACTGCCCCTCCCAGG - Intronic
1179732107 21:43373787-43373809 CCCCTGACCCTGCCCCACCCAGG + Intergenic
1179755537 21:43493399-43493421 CTCCAGTGGCTGCCACACCCTGG + Intergenic
1179882827 21:44300526-44300548 CCCCAGAGCCTGGCCCTTCCTGG + Intronic
1179921189 21:44508548-44508570 CCCCAGAGGACGCCCCACACTGG + Intronic
1180005057 21:45016823-45016845 CCCCAGATGTGGACCCTCCCTGG - Intergenic
1180087573 21:45514857-45514879 CCCCCAAGGCTGCCCAGCCCAGG + Exonic
1180137168 21:45869352-45869374 CCCATCAGGCTGCCCCACCCTGG + Intronic
1180173917 21:46078364-46078386 CCCCTGAGGCTGCCCCACACCGG - Intergenic
1180364074 22:11923828-11923850 ACCAAGGGGCTGCCCCTCCTGGG - Intergenic
1181107301 22:20582782-20582804 CCCTCGAGGCTGGCCCTGCCTGG + Intronic
1181510205 22:23385628-23385650 CCACAGCGGCTGCCACACCCTGG + Intergenic
1181522898 22:23459664-23459686 CCCGAGAGCCAGCCCCACCCCGG - Intergenic
1181546784 22:23606785-23606807 GACCAAAGGCTGGCCCTCCCTGG + Intergenic
1181595015 22:23908464-23908486 TGCCAGAGGCTGGCCCTGCCAGG - Intergenic
1181599219 22:23939439-23939461 CAAGAGAGACTGCCCCTCCCTGG + Intergenic
1181633966 22:24165882-24165904 CCCCAAGGGCTGCACCACCCAGG + Intronic
1181756411 22:25028101-25028123 CCCCAGAGGCTTCGCCGGCCTGG - Exonic
1181811118 22:25404640-25404662 TCCCAGATGGTGTCCCTCCCCGG - Intronic
1182112138 22:27731389-27731411 CCCCAGAGCCTGGCTCCCCCTGG - Intergenic
1182231408 22:28840118-28840140 CCCCAGGTGCTGCCCCGCCTGGG + Intergenic
1182299510 22:29329837-29329859 CTCCAGACACTGCCCCTCCTGGG - Intronic
1182429128 22:30289833-30289855 CCCCTGACGCGCCCCCTCCCTGG + Intronic
1182444929 22:30384495-30384517 CCCCGGTGACTTCCCCTCCCAGG - Exonic
1182692859 22:32175973-32175995 CGCCAGCGCCTCCCCCTCCCCGG - Intergenic
1183506187 22:38210241-38210263 CCACAGTGGCTGCCCCTGTCAGG + Intronic
1183628639 22:39020265-39020287 AACCAGAGGCTGCTCTTCCCAGG + Exonic
1183632056 22:39039597-39039619 TCCCAGAGGCTGCTCTTCCCAGG + Intergenic
1183637937 22:39076425-39076447 AACCAGAGGCTGCTCTTCCCAGG + Intronic
1183665202 22:39242763-39242785 CCGCAGGGGCCGACCCTCCCCGG + Intronic
1183745839 22:39691202-39691224 CCCCTCAGGCTGCCCCTCCAGGG + Intergenic
1183951770 22:41356534-41356556 CCCTCCAGGCTGCCCCTCCCAGG - Intronic
1184249180 22:43250574-43250596 CCCCTGAGGCTGCTCCTGCCTGG - Intronic
1184819958 22:46902976-46902998 CCCCATACGCTGCCCCTCCTCGG - Intronic
1184840988 22:47052351-47052373 CCGCTGTGCCTGCCCCTCCCAGG - Intronic
1185085342 22:48737838-48737860 CCTCAGAGGCTGCAGCTCCCTGG - Intronic
1185270056 22:49925578-49925600 CCACACAGGCTGCCCTCCCCTGG + Intronic
1185293621 22:50041538-50041560 TCCCAGAGGCTGCACTGCCCCGG + Intronic
950100976 3:10356635-10356657 CCCCACAGCCTCCCCCTTCCCGG - Intronic
950425695 3:12923746-12923768 CTCCAGGGGCTGCTGCTCCCGGG + Intronic
953020005 3:39107302-39107324 CCCGCGAGGCCGCCTCTCCCAGG + Intronic
953066263 3:39473692-39473714 CTGGAGACGCTGCCCCTCCCAGG - Intronic
953547633 3:43875368-43875390 CCCAAGAGGCAGGCACTCCCAGG + Intergenic
953979319 3:47405835-47405857 CTTGGGAGGCTGCCCCTCCCTGG - Intronic
954025737 3:47781814-47781836 CCCCACAGCCTGGCCCACCCCGG + Exonic
954105941 3:48409969-48409991 CCCCGAAGGCTGCCCCTCCGAGG + Exonic
954579768 3:51696914-51696936 GGCCTGAGGCTGCCCCTCCAGGG + Intronic
954784000 3:53080070-53080092 CCACAGCAGCTGTCCCTCCCTGG + Intronic
954814960 3:53273212-53273234 CCTCAGAGTCTGCCCCTTCCAGG - Intergenic
954967517 3:54624544-54624566 CACCAGAAGCTCCGCCTCCCGGG - Intronic
957916761 3:86695938-86695960 CACCAGAGGCTCCCCCTGCAGGG - Intergenic
957939699 3:86990361-86990383 GCTCAGAGGCTGCTCCTCCTAGG - Intronic
964223033 3:154368157-154368179 CGCCAGAGGCTCCCCCTGCAAGG + Intronic
964313041 3:155414485-155414507 CACAAGAGGCTTCCCCTTCCGGG - Intronic
964383865 3:156126504-156126526 CCCAAGAGGCTCCCCCTCCTTGG - Intronic
964619440 3:158706434-158706456 TCACTGAGGCTGCCCCTGCCTGG - Intronic
964917246 3:161852949-161852971 CGCCAGAGGCTCCCCCTGCATGG - Intergenic
965009022 3:163062675-163062697 CAGCAGAGGCTTCCCTTCCCAGG + Intergenic
967271646 3:187737981-187738003 CCCCAGCGGCCCCGCCTCCCTGG - Intronic
967893737 3:194381592-194381614 CCGCAGAGGCAGACCCTCCAGGG - Intergenic
968451772 4:679293-679315 CCAGAGAGTCAGCCCCTCCCTGG - Intronic
968519521 4:1029263-1029285 CCCCAGGTGCAGCCCCTCCCTGG - Intergenic
968541523 4:1170752-1170774 CCGAGGAGGCTGCCCCTTCCTGG - Intronic
968547269 4:1205658-1205680 CACCAAATGATGCCCCTCCCTGG - Intronic
968612746 4:1564537-1564559 CCGTGGAGGCTGCCCCTCCAAGG + Intergenic
968664973 4:1816048-1816070 CCTCAGTGGCTGCCCCTCTGGGG + Intronic
969196609 4:5568414-5568436 CCCGGGAGGCAGCCCCTCCACGG + Intronic
969358934 4:6648951-6648973 CCTCAGAGGTTGCCCCCTCCAGG - Intergenic
969564591 4:7970559-7970581 CCCCAGAGGCTCCCACAGCCTGG - Intronic
969584748 4:8085208-8085230 CCTGTGTGGCTGCCCCTCCCTGG - Intronic
970108961 4:12616553-12616575 CTCCAGAGTCTGCCCCTGCTGGG + Intergenic
971160619 4:24130011-24130033 CTCCAAATGCTGTCCCTCCCCGG - Intergenic
973394005 4:49578580-49578602 ACCAAGGGGCTGCCCCTCCTGGG - Intergenic
973910004 4:55570941-55570963 CTGTAGAGTCTGCCCCTCCCAGG + Intronic
975656019 4:76641894-76641916 CCCCAGCACCTGCCTCTCCCTGG - Intronic
975845348 4:78519402-78519424 CCCCAGGGGCTGGGCCTCCTTGG + Intronic
976011344 4:80493022-80493044 CTACAGAGGCTGCCCCTCCTAGG - Intronic
976461756 4:85320333-85320355 CCACAGAGGCTTTCCTTCCCTGG - Intergenic
976629339 4:87220600-87220622 CCCCAGAGGCCGCGGCTCGCGGG - Exonic
976709933 4:88059153-88059175 CACCAGAGGCTGTGTCTCCCCGG - Intronic
978403004 4:108350369-108350391 GCCCAGAGGCGGCCCCACCGTGG - Intergenic
980680988 4:136160020-136160042 CCCAAGAAGCTGCCTCTCCCTGG - Intergenic
981697197 4:147570803-147570825 GACCAGAGGCTCCCCCTCCTGGG + Intergenic
981770157 4:148299597-148299619 CCACAGAGTCTTCCCCTCCCCGG + Intronic
984710836 4:182882865-182882887 CCCCACAGCCTCCACCTCCCGGG - Intergenic
985005920 4:185535409-185535431 CCCCAGACGGTGATCCTCCCGGG - Exonic
985512785 5:321689-321711 CTCCAGGGACTGCCCCACCCCGG - Intronic
985528887 5:422200-422222 ACACAGAGGCTGACCCTCACAGG - Intronic
985567009 5:624091-624113 CCCGAGAGGCTGCAACTTCCAGG - Intronic
985761437 5:1751285-1751307 CCCCAGAGACTGCCCTGCACGGG + Intergenic
985903291 5:2813770-2813792 CCTCAGAGGCTGACCCTGCTTGG + Intergenic
986735020 5:10662100-10662122 CCACGGAGCCTGCCTCTCCCAGG - Intergenic
986737329 5:10677755-10677777 CTGCAGAGGCTGCCTGTCCCTGG - Intergenic
988503699 5:31803691-31803713 ATCGACAGGCTGCCCCTCCCAGG - Intronic
989141046 5:38201661-38201683 CCCCAGTGGCAGCCCCTCTTTGG + Intergenic
989306975 5:39969367-39969389 CCCAAGAAGCTGCGTCTCCCTGG - Intergenic
991614698 5:68483901-68483923 CCCAGGAGGCTACTCCTCCCAGG + Intergenic
992981585 5:82180159-82180181 CATCAGAGGTTGCCACTCCCTGG + Intronic
993096041 5:83479345-83479367 TCTCGGAGGCTGCCCATCCCTGG + Intronic
993148436 5:84127484-84127506 AGCCACAGGCTGCTCCTCCCAGG - Intronic
995854123 5:116574828-116574850 CCGGAGAGGCCGCCGCTCCCGGG + Exonic
997990798 5:138543116-138543138 CGGCAGCGGCTGCTCCTCCCCGG + Exonic
998139029 5:139689695-139689717 CCACAGGGGGTGCCCCTCCCGGG - Intergenic
1000021541 5:157322995-157323017 CCGAAGAGGCTGCCGATCCCTGG + Exonic
1001273272 5:170331774-170331796 CCACAGAGGCTGAACCTCCTGGG - Intergenic
1002097103 5:176837859-176837881 CCACAGAGGCTGTCCCTCTGCGG + Intronic
1002104937 5:176875366-176875388 CCCCAGAGCCTCCCCATTCCTGG + Intronic
1002375890 5:178788934-178788956 GCCTAGAGGCCGCCCCTCCAGGG + Intergenic
1002847554 6:961550-961572 CTCCATAGGCAGCTCCTCCCAGG - Intergenic
1003037962 6:2661716-2661738 CCCAAGAGGCTGGCCCTCAAGGG - Intergenic
1003120864 6:3318235-3318257 CCAGAGAGGCTGCTCCTCCCAGG + Intronic
1003267198 6:4576177-4576199 CCCCAGATGCTTCTTCTCCCTGG + Intergenic
1003868471 6:10383590-10383612 GCCCAGAGGCTGCACCACCCAGG + Intergenic
1004232683 6:13847210-13847232 CTGGAGAGACTGCCCCTCCCAGG - Intergenic
1004487677 6:16082623-16082645 CCCAAGAGGCAGCCACTCCCAGG + Intergenic
1004754953 6:18601149-18601171 CCCCAGAGGCTGCCTGCCCATGG + Intergenic
1005352481 6:24949829-24949851 CTCCAGGGGCTGCCCCTTCCAGG - Intronic
1006251951 6:32795065-32795087 CCCCAAGGGCTGCTCCTCACCGG + Intergenic
1006298286 6:33179679-33179701 CCCCAGAGCCTTCCCTTTCCAGG + Intronic
1006358489 6:33574332-33574354 CCGCAGAGGCTGCCCCAACCTGG + Intronic
1006451751 6:34109423-34109445 CTCCAGAGGCAGCCCCTGCAGGG - Intronic
1006532865 6:34672015-34672037 GCCCAGGGACTGCCCCACCCTGG + Intronic
1006578965 6:35065644-35065666 CCCCAGGGGCTGCATCTTCCTGG - Intronic
1007680028 6:43627671-43627693 TACCTGAGGCTTCCCCTCCCAGG + Intronic
1007698199 6:43747170-43747192 CATCACAGGCTTCCCCTCCCTGG + Intergenic
1007839260 6:44702116-44702138 CTCCTGAAGTTGCCCCTCCCCGG - Intergenic
1010529522 6:76950292-76950314 CCTCAGAAGCTTCACCTCCCTGG - Intergenic
1011674487 6:89718877-89718899 CCACAGAGGCTGGCCCGACCAGG + Exonic
1013441890 6:110179531-110179553 CCCCAGAGCCCGACCCTCCTGGG - Exonic
1013665438 6:112342672-112342694 CCCCAGGGGCTGATGCTCCCAGG + Intergenic
1014042171 6:116841040-116841062 CTGGAGAGACTGCCCCTCCCAGG + Intergenic
1016832789 6:148449771-148449793 CCCCACAGGACGGCCCTCCCCGG - Intronic
1017717792 6:157224399-157224421 CCCCAGGGACTGCAGCTCCCTGG - Intergenic
1017771147 6:157645508-157645530 CCACAGAGGCTGCTCCACGCCGG + Intronic
1017817826 6:158028030-158028052 CCCAAGATGCTCCCCCTGCCTGG - Intronic
1017908486 6:158772967-158772989 CCCCAAAGACAGCCCCACCCAGG - Intronic
1018787825 6:167121893-167121915 CCCCAGTGGCTCCCCCTTACTGG - Intergenic
1019001975 6:168761514-168761536 CCTCAAAGGCTGCCCATTCCTGG - Intergenic
1019083915 6:169456604-169456626 CTCCAGAGGCTGCCTGTCCTGGG - Intergenic
1019475534 7:1242403-1242425 CCCCACAGGCTGCGCCTGACGGG + Intergenic
1019565396 7:1676390-1676412 CACCAGAGGCTCCCCAGCCCGGG - Intergenic
1019588427 7:1816873-1816895 CCCGAGAGCCAGCCCCACCCCGG + Intronic
1019647058 7:2136595-2136617 GCCCAAAGCCTGCCCCTTCCAGG + Intronic
1019652344 7:2166855-2166877 GCCCATGGGCTGCCCTTCCCTGG - Intronic
1019708873 7:2509425-2509447 CCCCGGAGGCTGTGCTTCCCAGG + Intergenic
1021334060 7:19376445-19376467 CACTAGAGGCTGCATCTCCCAGG + Intergenic
1021723888 7:23531675-23531697 CTCCAGAGGTTGCTCCTCGCGGG + Intronic
1022230533 7:28409144-28409166 CCCCCGCCGCTGCCGCTCCCGGG + Intronic
1023054873 7:36283366-36283388 CCGCAGAGGCTTCCCCTCCAGGG + Intronic
1023805973 7:43873236-43873258 CCCCTGAGACTGCCACTCCCTGG + Intronic
1023869266 7:44254201-44254223 CCCACAAGGCTGACCCTCCCCGG - Intronic
1023907398 7:44532162-44532184 CCCCAGGAGCTGCCCCCGCCTGG - Exonic
1025202894 7:56972996-56973018 CCCCAGAGCCTGCTCATCTCAGG - Intergenic
1025669050 7:63603930-63603952 CCCCAGAGCCTGCTCATCTCAGG + Intergenic
1026574929 7:71564160-71564182 CCCCAGCAGGTGACCCTCCCTGG - Intronic
1026734847 7:72942914-72942936 CCCCGGTGGCTGCCCCTCAGCGG - Exonic
1026785180 7:73297826-73297848 CCCCGGTGGCTGCCCCTCAGCGG - Intergenic
1026871394 7:73854805-73854827 TCCCATACGCTGCCCCTCACAGG + Intergenic
1027108896 7:75422104-75422126 CCCCGGTGGCTGCCCCTCAGCGG + Exonic
1027137845 7:75637879-75637901 CCCCAGAGGGTGCCCTTTCGAGG - Intronic
1027453914 7:78363415-78363437 CACCACAGGCTCCGCCTCCCGGG - Intronic
1028640700 7:93039496-93039518 CCCCACAGGCTCCTGCTCCCTGG + Intergenic
1029203340 7:98853700-98853722 TCCATGAGGATGCCCCTCCCTGG - Intronic
1029286360 7:99468651-99468673 TCCCGGAGGCTGCCTCTGCCCGG - Intergenic
1029450904 7:100641388-100641410 CCCCTGAGGCTGGCCCCTCCTGG - Intronic
1029562240 7:101310222-101310244 CCACAGGGGCTGCCACTACCAGG + Intergenic
1029609777 7:101620703-101620725 ACCCTCAGGCTGCCCCTGCCAGG - Intronic
1031550869 7:123110100-123110122 CCGCAGTGGCTGCCACTGCCAGG + Intergenic
1032005554 7:128299486-128299508 CTGGAGAGACTGCCCCTCCCAGG - Exonic
1032086514 7:128886723-128886745 CCCCACAGGCTGTCTCTCTCAGG - Exonic
1032451545 7:132035957-132035979 GGCCAGAGGCAGCCCTTCCCTGG - Intergenic
1034162318 7:149002588-149002610 CCACCAAGGCTGCCCCTTCCTGG + Intergenic
1034488917 7:151382470-151382492 CCCAGGTGGCTGCCTCTCCCTGG + Intronic
1034985285 7:155509609-155509631 GCCCAAAGTCTGGCCCTCCCCGG + Intronic
1035050866 7:155998507-155998529 CCCAGGAGGCTGCCCTGCCCTGG + Intergenic
1035242382 7:157540698-157540720 CCCCTGAGGCTGCCGCTCACTGG + Exonic
1035311288 7:157970644-157970666 CCCCACAGGTTGCCCACCCCAGG + Intronic
1035315939 7:157997674-157997696 CCCCAGGCTCTGCCCCTCCCTGG - Intronic
1035323230 7:158047705-158047727 GCCCAGCAGCTGTCCCTCCCCGG - Intronic
1035720255 8:1785972-1785994 TCCCAGGAGCTGCCCCTCCCTGG + Exonic
1035769876 8:2138492-2138514 TCCCATAATCTGCCCCTCCCCGG - Intronic
1036642392 8:10592580-10592602 GACCACAGCCTGCCCCTCCCAGG + Intergenic
1036691779 8:10948961-10948983 CCCGAGAGGCTGCACCGCCCAGG - Intronic
1036746225 8:11412087-11412109 TCCCTGGGGCTGCCCCTCACAGG + Intronic
1039079648 8:33722406-33722428 CGCCAGAGGCTGCCCATAGCAGG + Intergenic
1040605894 8:48930794-48930816 ACACAGAGGCAGCCCTTCCCTGG + Intergenic
1040935198 8:52775189-52775211 CCAGAGAGACTGCCCCTCCCAGG + Intergenic
1041219138 8:55631769-55631791 GGAGAGAGGCTGCCCCTCCCAGG - Intergenic
1042722943 8:71844081-71844103 TCCAAGAGGCCGCCCCTCCGCGG - Exonic
1045929586 8:107606040-107606062 CGCCAGAGGCTCCCCCTGCACGG - Intergenic
1047187033 8:122642919-122642941 CCCCTGAAGCTTCCCTTCCCTGG - Intergenic
1048259840 8:132936298-132936320 TCCCAGCAGCTGCTCCTCCCGGG + Intronic
1048314866 8:133354363-133354385 GCCCAGAGGCTGCTCTTTCCTGG - Intergenic
1048439597 8:134450264-134450286 CCCCAGAGTCCACCCATCCCTGG - Intergenic
1048543803 8:135367414-135367436 CTGGAGAGGCTGCCCCTCCCAGG + Intergenic
1048543931 8:135368446-135368468 CCGGAGAGACTGCCCCTCCCAGG + Intergenic
1049279003 8:141734679-141734701 GGCCAGAGGCTGCCCCTCCGTGG - Intergenic
1049319343 8:141987713-141987735 CAGGAGAGGCTGCCCCTCCCAGG + Intergenic
1049408360 8:142461616-142461638 CCCTAGAACCTGCCCCGCCCTGG + Intronic
1049422757 8:142524232-142524254 CCCCAGCTGCTGGCTCTCCCTGG + Exonic
1049439274 8:142601804-142601826 CGCAGCAGGCTGCCCCTCCCTGG - Intergenic
1049460532 8:142725637-142725659 CCCAAAAGGCCACCCCTCCCTGG + Intergenic
1049586880 8:143436404-143436426 CCCCAAATGCAGCCCCCCCCAGG - Intergenic
1049615117 8:143572604-143572626 TCCCTGGGGCTGCCCCTGCCTGG + Exonic
1049615637 8:143574726-143574748 GCCCACGGGCTGCGCCTCCCGGG - Intergenic
1049625004 8:143615951-143615973 CCTCAGGGGCTGCCCCCACCAGG + Intronic
1049726418 8:144148447-144148469 CCCCAGTGCCCGGCCCTCCCCGG + Intronic
1049929951 9:446488-446510 TCCCCGAGGCCGCCCCTCCAGGG - Exonic
1050271653 9:3952353-3952375 CCCCAGAGGCACCACCACCCAGG + Intronic
1050330421 9:4540204-4540226 CCCCAGAGTCTGGCCATCCCTGG - Intronic
1051371366 9:16362128-16362150 ACCCACTGGCTGCCTCTCCCAGG + Intergenic
1051414285 9:16822186-16822208 CCCCGCAGCCTGCGCCTCCCAGG - Intronic
1051696050 9:19768838-19768860 CCTCAGTAGCTGCACCTCCCAGG + Intronic
1053495147 9:38544143-38544165 CCCCAGTGTTTGCCCTTCCCTGG - Intronic
1053666808 9:40322902-40322924 ACCAAGGGGCTGCCCCTCCTGGG - Intronic
1053752732 9:41273335-41273357 CCCCAGACCCTGCCCCCGCCCGG + Intergenic
1054377959 9:64462930-64462952 ACCAAGGGGCTGCCCCTCCTGGG - Intergenic
1054451116 9:65404074-65404096 CAGCAGAGGCTTCACCTCCCTGG - Intergenic
1054517802 9:66053381-66053403 ACCAAGGGGCTGCCCCTCCTGGG + Intergenic
1055120903 9:72659556-72659578 CACCACAGGCTCCCCCTTCCAGG - Intronic
1055829266 9:80359945-80359967 TCCCGGAGGCTGCCGCACCCAGG - Intergenic
1056850861 9:90082498-90082520 CCCAAGAGGCTGCCCTACGCTGG - Intergenic
1057021243 9:91699209-91699231 CCCCAGAGGGTGGCACACCCGGG + Intronic
1057225125 9:93289130-93289152 CTCCAGAGGCTGCCTCAACCAGG + Exonic
1057299078 9:93865999-93866021 CCCCAGAGCCTGCTGCTCACAGG - Intergenic
1057675052 9:97131507-97131529 CCCCAGTGTTTGCCCTTCCCTGG - Intergenic
1057709656 9:97427973-97427995 TCTCAGGGTCTGCCCCTCCCTGG + Intronic
1058242047 9:102576387-102576409 CACCAAAGGCTGCATCTCCCTGG - Intergenic
1058610362 9:106769547-106769569 CACAAGAGGCTCCCCATCCCTGG + Intergenic
1058814104 9:108668027-108668049 CCCCTTAGGGTGCCCCTGCCAGG - Intergenic
1059849467 9:118321044-118321066 CCCAAGAAGCTGCTTCTCCCGGG + Intergenic
1059945632 9:119405746-119405768 CCCCAGTGGCTCCCTCTCCCTGG - Intergenic
1060471865 9:123954784-123954806 GCCCAGAGGCAGCACCTGCCTGG + Intergenic
1060549031 9:124476561-124476583 CGCCAGCAGCTCCCCCTCCCTGG - Intronic
1060926866 9:127461319-127461341 ATCCACAGGCTGCCCCGCCCGGG + Intronic
1061842715 9:133368890-133368912 CCCGAGAGGCTGACCCCCACGGG + Intronic
1061873082 9:133531032-133531054 CACCAGTGGCTGCCCGCCCCTGG + Intergenic
1062046668 9:134427572-134427594 CCCCCGAGGCCGCCCCGCCCAGG - Intronic
1062339848 9:136089191-136089213 ACCCAGAGCCTCCCCCTGCCAGG + Intronic
1062450569 9:136614109-136614131 CCCCAGGGGGTGCACCTCCTGGG + Intergenic
1062528248 9:136987232-136987254 CCCCAGAGGCTGCCCCACCCTGG - Intergenic
1062540459 9:137039704-137039726 CTCCAGGCCCTGCCCCTCCCCGG + Exonic
1062567001 9:137167933-137167955 CCCCAGAGACTGCCCACCCTGGG + Exonic
1062628220 9:137452492-137452514 CACCTGTGTCTGCCCCTCCCAGG + Intronic
1062652918 9:137587480-137587502 CTCCAGAGGCTGCCGGTCCTGGG + Intronic
1185463014 X:341001-341023 CCCCTGAGGCAGCCCCCACCGGG + Intronic
1186110109 X:6246596-6246618 CACAAGAGGCTTCCTCTCCCAGG + Intergenic
1188004435 X:25007354-25007376 CCCCCTGGGCTGCCCTTCCCGGG - Exonic
1189228310 X:39432134-39432156 GCCCAGAGGCCTCCCCTCCCTGG - Intergenic
1190316292 X:49154028-49154050 CCCCACAAGCTCCACCTCCCAGG + Intergenic
1191214496 X:57921047-57921069 CCACTCAGGCTGCCCCTCCTGGG + Intergenic
1193251114 X:79291454-79291476 CCCAAGAGGCTGCCACACTCTGG - Intergenic
1197262564 X:124333872-124333894 TCCCAAAGAATGCCCCTCCCCGG + Intronic
1197938061 X:131761049-131761071 CCCAAGAAGCTGCTTCTCCCTGG - Intergenic
1198321391 X:135521515-135521537 TCCCCGGGGCTGCTCCTCCCCGG - Intronic
1199791199 X:151156829-151156851 CTCCAGAGGCTGCCCATGCGTGG - Intergenic
1200076534 X:153554005-153554027 GCCCAGAAGCTTCTCCTCCCAGG - Intronic
1200152219 X:153956815-153956837 CCACCGATGCTGCCCCTCCCAGG + Intronic
1201486157 Y:14496551-14496573 CACAAGAGGCTGCCTGTCCCAGG - Intergenic
1201948567 Y:19538630-19538652 CCCCAGAAGCTCCGCCTCCTGGG - Intergenic
1202598680 Y:26570260-26570282 CATCAGAGGCTCCCCCTGCCTGG - Intergenic