ID: 1176217290

View in Genome Browser
Species Human (GRCh38)
Location 20:63954235-63954257
Sequence CTGTGGAAGTGGGGAGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 670
Summary {0: 1, 1: 1, 2: 6, 3: 59, 4: 603}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176217290_1176217303 29 Left 1176217290 20:63954235-63954257 CCCTCTGCTCCCCACTTCCACAG 0: 1
1: 1
2: 6
3: 59
4: 603
Right 1176217303 20:63954287-63954309 AGTCACTGCTAACACCACAAAGG 0: 1
1: 0
2: 0
3: 14
4: 131
1176217290_1176217299 6 Left 1176217290 20:63954235-63954257 CCCTCTGCTCCCCACTTCCACAG 0: 1
1: 1
2: 6
3: 59
4: 603
Right 1176217299 20:63954264-63954286 ACTCCATCTCAACCGCAGCCAGG 0: 1
1: 0
2: 0
3: 15
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176217290 Original CRISPR CTGTGGAAGTGGGGAGCAGA GGG (reversed) Intronic
900349096 1:2226723-2226745 CTGGGGAAGTGAGGGGCAGGAGG + Intergenic
901501309 1:9654127-9654149 CGGGGGAAGTGGGGCTCAGAAGG - Intronic
901520282 1:9778670-9778692 CTATGGACGGGGGGAGAAGACGG - Intronic
901758187 1:11454084-11454106 ACGGGGAAGTGGGGAGGAGAGGG - Intergenic
901911125 1:12459112-12459134 CTGTGGATATGGAGAGCTGATGG - Intronic
902380811 1:16051455-16051477 CTGTGGGAGTGGGGAGCCCAGGG - Intronic
902534570 1:17112117-17112139 CAGAGGAAGTGGGGAGGAGGTGG + Intronic
902822993 1:18954928-18954950 CTCAGGGAGTGGGGAGAAGAGGG + Intronic
902917417 1:19646953-19646975 CTGTGGGAGCGAGGGGCAGAAGG + Intronic
903176706 1:21585851-21585873 CTGTGGAAATGGAGAGGGGAGGG + Intergenic
903275036 1:22216197-22216219 CAGTGGGAATGGGGAGGAGAGGG + Intergenic
903337290 1:22633618-22633640 CTGTTGAAGTGGGCAGATGAAGG - Intergenic
903344373 1:22675075-22675097 CTGTGGCAGCGGTGAGAAGATGG - Intergenic
903651711 1:24926692-24926714 CTGTGGAGTTGGGGAGCAGAGGG + Intronic
903818064 1:26079547-26079569 CTGTGGGGGTGGGGAGCGGCAGG - Intergenic
904033962 1:27549404-27549426 CAGTGGCAGTGGGTAGCAGCGGG - Exonic
904769198 1:32871316-32871338 CTGGGGCAGACGGGAGCAGAGGG + Intronic
905889458 1:41510495-41510517 CTCAGGAAGTGGGGAGCCCAGGG - Exonic
906166919 1:43693509-43693531 CTATGGAAAAAGGGAGCAGAAGG + Intronic
906170202 1:43718589-43718611 CTGTTGAAGGAGGGAGAAGAAGG - Intronic
907855896 1:58303239-58303261 CTGAGGAAGGGAGGAGGAGATGG - Intronic
908545959 1:65162350-65162372 CACTGTAAGTGGGGAGGAGATGG + Intronic
908658799 1:66416537-66416559 GTGAGGAGGTGGGGAGAAGAGGG - Intergenic
908673076 1:66570295-66570317 GTTTGGAAGTGGGGTGTAGAGGG + Intronic
908777336 1:67653249-67653271 CAGTGGAAGTGGGGAGGAGTAGG - Intergenic
909190399 1:72542464-72542486 CTGTGGGACATGGGAGCAGAGGG - Intergenic
909517922 1:76533317-76533339 TTGTGGGAATGAGGAGCAGATGG - Intronic
911350823 1:96752834-96752856 GTTTGGAAGTGATGAGCAGACGG + Intronic
912638357 1:111320102-111320124 GTGTGGAGGTGGGGTGCAGTTGG - Intronic
913311549 1:117501307-117501329 CAGTGGAAGTGATGAGAAGAGGG + Intronic
915239354 1:154508811-154508833 CTTTGGTAATGGGGAGCAGTTGG + Intronic
915244298 1:154545192-154545214 CTCTGGAAGGGGAGAGAAGAGGG + Intronic
915904599 1:159868555-159868577 GAATGGAAGTGAGGAGCAGAAGG - Intronic
916502896 1:165401665-165401687 CTGTGAATGAGGGGAGCTGAGGG - Intronic
916585151 1:166143714-166143736 CTAAGGAAGTGGGGTGGAGAGGG + Intronic
916882225 1:169030365-169030387 CTGTGGAATTGGGGAGATGTTGG + Intergenic
917136579 1:171793980-171794002 CTGGGGTAGTAGGGGGCAGATGG - Intronic
918026603 1:180755600-180755622 TTGTGGAAGTGGGTGTCAGAAGG - Intronic
918123019 1:181556484-181556506 CTGTGGGAGGGGGAGGCAGAGGG + Intronic
919830324 1:201536394-201536416 CTGTGGAGGAGGGGAACAGAGGG + Intergenic
920030453 1:203034538-203034560 CTATGGGAGTGGGGGGCAGTGGG + Intronic
920642458 1:207766126-207766148 TTGTGGAAGTGGGGATGAGGGGG + Intronic
920661630 1:207920472-207920494 CTGGGGTAGAGGGTAGCAGATGG + Intergenic
920730743 1:208481728-208481750 CAGTGACAGTGGGGAGAAGAAGG - Intergenic
921134400 1:212247348-212247370 GTGTGGAGGTGAGGAGCGGAGGG - Intergenic
921956973 1:220994884-220994906 CTGTGGATGTGGTGGGGAGAAGG + Intergenic
922345643 1:224694075-224694097 CTGTGGAGGAGGAGAGGAGAGGG + Intronic
922504453 1:226118535-226118557 GTGTGGAGGAGGGGAGGAGATGG + Intergenic
922553978 1:226519144-226519166 CTTTGGAACTGGGGAGGACATGG + Intergenic
922796918 1:228344819-228344841 CTGTGGAAGTAGGGTGGAGCTGG - Intronic
1063074756 10:2703671-2703693 CTGTGGAAGTTGGGAGGTGTTGG - Intergenic
1063427237 10:5960005-5960027 CTGTGGAATGGAGGAGCTGAGGG - Intronic
1063555511 10:7075273-7075295 CTGAGGAGGTGTGGAGCAGGTGG + Intergenic
1064198309 10:13263499-13263521 CTGGAGAAGCGGGCAGCAGAGGG - Intergenic
1064462465 10:15548334-15548356 CTGTGGAAGTCCGAGGCAGATGG - Intronic
1064971774 10:21073672-21073694 CTTTGGGAGTAGGGAGCAGTGGG - Intronic
1065121400 10:22533900-22533922 CTGTGGTTGTGGGCATCAGAAGG + Intergenic
1065978316 10:30863836-30863858 CGGTGGAAGTGGAGAGCACAAGG - Intronic
1066259746 10:33717909-33717931 CAGTGGAACCGGGGTGCAGATGG + Intergenic
1066293114 10:34031676-34031698 CAGTGTAAGTGGGCAGTAGAAGG - Intergenic
1066602868 10:37126094-37126116 CTGGGGAAGAAGGGAGCAGGTGG + Intronic
1067082847 10:43221415-43221437 CTGGAGAAGGGGGGAGCAGCAGG - Intronic
1067318697 10:45197998-45198020 CTGGGGACGAGGGGAGCAGGTGG - Intergenic
1067431846 10:46250468-46250490 CTGTGGGAGGAGGGGGCAGATGG - Intergenic
1067441574 10:46311710-46311732 CTGTGGGAGGAGGGGGCAGATGG + Intronic
1068844537 10:61657169-61657191 TTGGGGAAGTGGGGAGTAGGGGG + Intergenic
1069041422 10:63699476-63699498 GTGTGGAAGTGGAGAGGAGAGGG + Intergenic
1069911901 10:71765131-71765153 CTGGGGAAGGGGGCAGCACAGGG - Intronic
1070307602 10:75248865-75248887 CTGTGGAGGTTTGGAGGAGAAGG - Intergenic
1070573986 10:77663318-77663340 CTGTGGAGGAGGGGAGAAGGTGG - Intergenic
1070647570 10:78212389-78212411 CAGTGGAGCTGGAGAGCAGAAGG - Intergenic
1070839784 10:79476194-79476216 CTCTGGAAGTGGGCTGAAGATGG + Intergenic
1070841036 10:79488042-79488064 CTCTGAAAGTGGGGAGCCCAGGG + Intergenic
1071019587 10:81036238-81036260 TTTTGGGAGTGGGTAGCAGATGG + Intergenic
1071266560 10:83969784-83969806 TTGAGGAAGTGGGGCTCAGAGGG - Intergenic
1071292654 10:84198600-84198622 CTGTGGTGGTGGAGAGCAGGTGG - Intronic
1071474684 10:86015918-86015940 CTGTGGAAGTAGGAAGCTGAGGG + Intronic
1072076188 10:91976413-91976435 CTCTGGAGGTGGGGAGCAGGAGG + Intronic
1072626712 10:97116784-97116806 CTGTAGGAGTGGGGAGCATCTGG + Intronic
1073059495 10:100724798-100724820 CTGTGGGAGTTGGGAGCTGGGGG - Intergenic
1073062146 10:100739392-100739414 GTGTGGATGTGAGGAGCAGGCGG - Intronic
1073073105 10:100807281-100807303 CTGTGGGTGAGGGGAGCAGGTGG - Intronic
1073991816 10:109269896-109269918 CAGAGGAAGAGGGGAGGAGAAGG - Intergenic
1074216824 10:111393524-111393546 GGTTGGCAGTGGGGAGCAGAAGG - Intergenic
1074658487 10:115622003-115622025 GTGTGGAAGGGGAGAGCAGAGGG + Intronic
1074726541 10:116315935-116315957 CAGTGGAATTGGGGCACAGATGG - Intergenic
1075855985 10:125630768-125630790 CAGTGGAAGTGGGAAGGGGAGGG - Intronic
1076548267 10:131260445-131260467 CTGCGGAAGAGGGATGCAGAGGG + Intronic
1076627757 10:131832355-131832377 CTGGGGCAGCTGGGAGCAGAGGG + Intergenic
1077334593 11:1997776-1997798 CTGGGGAAGTGGGGAACCGAGGG - Intergenic
1077343763 11:2037281-2037303 GTGGGGAAGTGGAGAGGAGAAGG - Intergenic
1077424999 11:2471273-2471295 CTCTGCAAGTGGGGATCAGCAGG + Intronic
1077457445 11:2689399-2689421 CTTGGGAAATGGGGAGCATAGGG + Intronic
1078402691 11:11042344-11042366 CTGTGGAAGAGGGAAACAAAAGG + Intergenic
1078597621 11:12702056-12702078 CTGTGTAAATGGAGAGCTGAAGG + Intronic
1078616123 11:12867821-12867843 CTGGGTGGGTGGGGAGCAGAGGG + Intronic
1078624393 11:12940613-12940635 CTGGGGAAGTTGGGAACAGCTGG + Intronic
1078868953 11:15326312-15326334 TTGGGGAAGTGGAGAGGAGAAGG + Intergenic
1078910080 11:15722991-15723013 CTGTGAAAGGGAGGGGCAGAGGG + Intergenic
1079241743 11:18726736-18726758 CTGTTGAAGTGGGAAGAGGAAGG - Intergenic
1080231192 11:30018502-30018524 GTGTGGGAGTGGGGTGGAGATGG - Intergenic
1080643619 11:34173076-34173098 CTGGGGAAGAAGCGAGCAGAGGG + Intronic
1080822027 11:35816495-35816517 GTGTGTAATTGGGGAACAGAAGG + Exonic
1080885796 11:36366916-36366938 CTGTGGGAGAAGGGAGGAGAAGG - Intronic
1081581063 11:44352339-44352361 CTGTGGCAGAAGGGAGCAGACGG + Intergenic
1081622018 11:44624265-44624287 GTGTGGAGGTGGGGAGTGGAAGG + Intergenic
1082239423 11:49855277-49855299 CTTTTGGAGTGGGCAGCAGAGGG + Intergenic
1082262862 11:50090670-50090692 ATGTGGAAGAGGGAGGCAGAAGG + Intergenic
1083276042 11:61597703-61597725 ATGGGGAAATGGGGGGCAGAGGG - Intergenic
1083470797 11:62882426-62882448 CTTTGGGAGTGGGGAACACAGGG + Intronic
1083831437 11:65236363-65236385 CTGAGGAGGAGGGGAGGAGAGGG - Intergenic
1084008334 11:66334719-66334741 CGGTGCCAGTAGGGAGCAGAAGG + Exonic
1084168715 11:67389933-67389955 CTGGTGACGAGGGGAGCAGAAGG + Intronic
1084662519 11:70554542-70554564 CTGGGGGAGGGGGGAGGAGAGGG - Intronic
1084696781 11:70760652-70760674 CTGTGGGAGTGTGCAGCACAGGG + Intronic
1084911208 11:72390881-72390903 CTGTGGCAGTGGGGAGTTGCGGG + Intronic
1085156598 11:74301058-74301080 CTGGGCAAGGGTGGAGCAGAAGG + Intronic
1086392923 11:86384308-86384330 CTGTGGGGGTGGGGAGGAGTGGG + Intronic
1087262323 11:96024815-96024837 CTGAGTAAGAGGTGAGCAGAAGG - Intronic
1087700471 11:101431344-101431366 CTGTGAAAGAGGGGAAAAGAAGG - Intergenic
1087701531 11:101441315-101441337 TTGGGGAAATGGGGGGCAGATGG - Intergenic
1088627768 11:111744023-111744045 CTGTGTAAGTGGAGAGAAGCGGG + Intronic
1088688316 11:112303749-112303771 CTGTGGAAGAGAGGACCTGAGGG - Intergenic
1088843260 11:113644281-113644303 CTGTGGGGGTGGGGAGGAGCTGG - Intergenic
1088974567 11:114804225-114804247 CTATGGGAATAGGGAGCAGAGGG - Intergenic
1089010818 11:115130255-115130277 AAGGGGAAGTGGGGAGGAGAGGG - Intergenic
1090228770 11:125087033-125087055 CCCTGGAAGAGGGGAGCAGGGGG + Intronic
1090579962 11:128148794-128148816 ATGAGGGAGTAGGGAGCAGAGGG + Intergenic
1091184334 11:133634311-133634333 CTGAGCAAGTGGGGAAGAGAAGG - Intergenic
1202817576 11_KI270721v1_random:52958-52980 CTGGGGAAGTGGGGAACCGAGGG - Intergenic
1202826749 11_KI270721v1_random:92470-92492 GTGGGGAAGTGGAGAGGAGAAGG - Intergenic
1091396502 12:156852-156874 CTGTGGCAGGTGGGAGGAGATGG + Intronic
1091603985 12:1935037-1935059 CCCGGGCAGTGGGGAGCAGAGGG + Intergenic
1091753814 12:3038987-3039009 CTGGGGAAGGGGTGAGGAGAGGG - Intronic
1092283900 12:7117667-7117689 CTGTTGAAAAGGAGAGCAGATGG + Intergenic
1092764158 12:11837531-11837553 CTGCTGAAGTGGGGAACAAACGG - Intronic
1094311178 12:29085679-29085701 CTCTGGAAGGGGCAAGCAGAGGG + Intergenic
1096483450 12:51959094-51959116 TTGGGGAAGTGAGGAGCAGAAGG - Intronic
1096622790 12:52874796-52874818 CTGGGGAAGTGGGGTGTAGGGGG - Intergenic
1097242664 12:57586440-57586462 CGGTGAAGGTGGGGAGCAGGAGG - Exonic
1098743263 12:74201375-74201397 CTTTGGAACTGGGTAACAGATGG - Intergenic
1099005458 12:77230080-77230102 CTTTTGACGTGGGGAGGAGAAGG - Intergenic
1099103319 12:78470494-78470516 GTGTGGGAGTGGGGAGCAGGGGG - Intergenic
1099994629 12:89764795-89764817 CTGTCGTGGTGGGGAGCAGGTGG + Intergenic
1100557602 12:95711603-95711625 CTGTTGAACTGGTGAGTAGAAGG + Intronic
1100634635 12:96423964-96423986 AAATGGAAGGGGGGAGCAGAAGG - Intergenic
1101847332 12:108373022-108373044 CGGTGGAAGTGGGTTGTAGAGGG + Intergenic
1103587706 12:121968428-121968450 GTGTGGATATGTGGAGCAGAGGG - Intronic
1104231906 12:126893109-126893131 CTGTGGGGGTGGGGAACAAAAGG + Intergenic
1104935309 12:132361218-132361240 CTGTGGAAGGAGGGAGCATCGGG - Intergenic
1105223870 13:18409155-18409177 CTGGGGACGAGGGGAGCAGGTGG + Intergenic
1106091851 13:26603123-26603145 CTGTGGAAGTGTGGAGCTGCAGG + Intronic
1106233947 13:27845652-27845674 CTGAGGCGGTGGGGAGGAGAAGG - Intergenic
1106578427 13:30997545-30997567 CTGCCGAAATGGGGAGCTGAGGG + Intergenic
1107013680 13:35692197-35692219 CTGTGTGAGAGGGGAGGAGAAGG + Intergenic
1107469055 13:40675023-40675045 CTGGGGAAGTAGGGTGGAGAAGG + Intergenic
1109150045 13:58835742-58835764 CTGGAGGAGTGGGGAGCAGAGGG - Intergenic
1109702061 13:66039068-66039090 CTGTGGAAGTGGGGAAAATATGG - Intergenic
1110532125 13:76609993-76610015 CAGTGGACGTGGGGAGGAAAAGG - Intergenic
1110603502 13:77403775-77403797 CTGTGGAACTTGGGGGCAAAGGG - Intergenic
1111507535 13:89213633-89213655 CTGGGGTGGTGGGGAGGAGAGGG - Intergenic
1112508914 13:99991414-99991436 CGGTGGCCCTGGGGAGCAGAAGG + Intergenic
1113247957 13:108419974-108419996 GCGAGGAAGTGGTGAGCAGATGG + Intergenic
1113447703 13:110382385-110382407 CTGGGGAAGTGGGCGGAAGACGG - Intronic
1113876533 13:113598147-113598169 CTGGGGTGGTGGGGAGTAGAGGG - Intronic
1113885816 13:113657941-113657963 CTCAGGAGGAGGGGAGCAGAGGG - Intronic
1114008017 14:18333981-18334003 CTGGGGACGAGGGGAGCAGGTGG + Intergenic
1114461042 14:22886441-22886463 CTGTGGAGGTGCGAAGGAGAGGG - Intronic
1114518849 14:23320643-23320665 AAATGGAACTGGGGAGCAGAAGG + Intronic
1114967375 14:27979794-27979816 CTGTTGAAGTGGAGAGCATCAGG + Intergenic
1117226487 14:53666119-53666141 CTGTGGAAATAGGTAGAAGAAGG - Intergenic
1117285599 14:54283069-54283091 CGGTGGGAGTGGGGAACAGGTGG - Intergenic
1117641622 14:57805615-57805637 CTGTTGGAGTGGGGAGTAGGGGG + Intronic
1117839550 14:59845453-59845475 CTGTGGCAGTGGAGAGCAAGAGG - Intronic
1117946177 14:61024398-61024420 CTGAGGAAATGGGCTGCAGAGGG - Intronic
1117994677 14:61467475-61467497 CGCTGGATGTGGGGAGGAGAAGG + Intronic
1118303534 14:64635886-64635908 CTATGGAAGTGGAGGGGAGATGG - Intergenic
1119072737 14:71604236-71604258 CTGTGGGAGGCTGGAGCAGATGG - Intronic
1119182128 14:72612346-72612368 CAGAGGAGGTGGGGAGCAGGTGG - Intergenic
1119196011 14:72717068-72717090 CTGTGTAAGTGGGTTGTAGATGG - Intronic
1119541281 14:75439786-75439808 CTGGGAAGGTGAGGAGCAGAGGG - Intronic
1119802464 14:77458009-77458031 CGGTGGGAGTGGGGAGGAGCCGG + Exonic
1119855853 14:77900226-77900248 CTGTGGAAGTGGGCATCAGAAGG + Intronic
1119905607 14:78299001-78299023 CTGTGGAAGTGGGCAGTCGAGGG + Intronic
1119949958 14:78734826-78734848 AGGTGGAAGTGGGGAGGAGAGGG + Intronic
1120932292 14:89860951-89860973 TAGTGGAAGTGGGTACCAGATGG - Intronic
1120989445 14:90362244-90362266 CTGGGGTACTGGGGAGCAGGAGG + Intergenic
1121167848 14:91824532-91824554 GTGTGGATTTTGGGAGCAGAAGG - Intronic
1121321699 14:92995273-92995295 CTGTGGAGTGGGTGAGCAGAGGG - Intronic
1121364772 14:93299157-93299179 CTCTGGAACTGGGGAACACAGGG - Intronic
1121554381 14:94825214-94825236 CTGTGGAAATGGAGTGCAGTGGG + Intergenic
1122146514 14:99692054-99692076 CTTTTGATGTGGGGAGTAGATGG + Intronic
1122159909 14:99775421-99775443 CTGGGGAAATGTGGAGCAGTGGG + Intronic
1122293795 14:100693865-100693887 CTGGGGGAGAGGGGAGCAGGGGG - Intergenic
1122347097 14:101067441-101067463 CTGGGGAAGAGGGGTGCTGAGGG - Intergenic
1123476130 15:20593523-20593545 CTGTGGTGGTGGGGACCAGCTGG + Intergenic
1123641882 15:22406841-22406863 CTGTGGTGGTGGGGACCAGCTGG - Intergenic
1124216632 15:27812928-27812950 GTGGGGAAGTGGGGAGGAGGAGG - Intronic
1125202563 15:37112862-37112884 CTATGGAAGAAGTGAGCAGAAGG - Intergenic
1125391011 15:39192987-39193009 TTGTGGAAGTGGGTATCTGAAGG - Intergenic
1125551644 15:40549540-40549562 CTGTGGAAGTTGTAAGCACAAGG - Intronic
1127005443 15:54564066-54564088 CTGTTGAAGTGAGGAGCCTATGG + Intronic
1127039919 15:54963276-54963298 CTGCGGGAGTGAGGTGCAGATGG - Intergenic
1127665675 15:61144419-61144441 CTGTGCATGTGGGTAGCAGAAGG - Intronic
1127836514 15:62795077-62795099 CTCTGGAAGAGGAGAGCAGGGGG + Intronic
1128220312 15:65964227-65964249 CTTTGGAAGTGGGGGGTGGAGGG + Intronic
1128799760 15:70489940-70489962 CTGTAGGGGTGGGGAGCTGAGGG + Intergenic
1129169185 15:73797525-73797547 CTGTGGGAGTGGGGCGCCCATGG + Intergenic
1129190029 15:73931733-73931755 CTGTGGAGGTGGGGTGGAGCAGG - Intronic
1129506661 15:76087190-76087212 CTTTGGAAGTGGTGTGGAGAAGG + Intronic
1129659634 15:77545844-77545866 CTGAAGAAATGGGGAGCAGGGGG + Intergenic
1129843476 15:78757617-78757639 ATGTTGAATTGGGGAGCAGCAGG + Intergenic
1129940801 15:79495252-79495274 CTGGGGAAGTGGGAAGCAGGGGG + Intergenic
1130252312 15:82307540-82307562 CCGTGGTAGAGGGAAGCAGAAGG + Intergenic
1130795390 15:87203251-87203273 CTGTGGAAGTGGGGAAAGGTGGG + Intergenic
1130826137 15:87548111-87548133 CTGAGGAGATGGGGAGAAGATGG + Intergenic
1131513682 15:93063830-93063852 CTGTGGAGGTGGGGGTCAGTTGG + Intronic
1131937130 15:97519095-97519117 CAGTGGGAGTGGGGAATAGATGG + Intergenic
1132064854 15:98722526-98722548 ATATGGAGGTGGGGGGCAGAGGG - Intronic
1132657329 16:1046761-1046783 CTGTGGCTGTGGGCAGCAGGTGG - Intergenic
1132857110 16:2050979-2051001 GCGTGGAAATGGGGAGCAAAGGG + Intronic
1132871998 16:2119486-2119508 CTCTGGGAGTGGGGAGCTCAAGG - Intronic
1133030284 16:3007629-3007651 CCCTGCAAGTGGGGAGCAAAGGG + Intergenic
1133068747 16:3231114-3231136 TGGAGGAAGTGGGGAACAGAGGG + Intronic
1133236424 16:4389327-4389349 CCCTGGCAGTGGGGAGCTGAGGG + Intronic
1133344654 16:5061786-5061808 TGATGGGAGTGGGGAGCAGAGGG + Intronic
1134491911 16:14702038-14702060 CTCTGGGAGATGGGAGCAGAGGG + Intergenic
1134497292 16:14741160-14741182 CTCTGGGAGATGGGAGCAGAGGG + Intronic
1134520529 16:14917410-14917432 CTCTGGGAGTGGGGAGCTCAAGG + Intronic
1134551045 16:15138564-15138586 CTCTGGGAGTGGGGAGCTCAAGG - Intronic
1134708201 16:16316061-16316083 CTCTGGGAGTGGGGAGCTCAAGG + Intergenic
1134715416 16:16356094-16356116 CTCTGGGAGTGGGGAGCTCAAGG + Intergenic
1134951401 16:18352584-18352606 CTCTGGGAGTGGGGAGCTCAAGG - Intergenic
1134959341 16:18396065-18396087 CTCTGGGAGTGGGGAGCTCAAGG - Intergenic
1135077576 16:19407371-19407393 ATGAGGGAGTGGGGAGCAGCGGG + Intergenic
1135553550 16:23416938-23416960 CTGGGGAACTGGGGACCAGACGG - Intronic
1135833741 16:25803956-25803978 CTCTGGAGGTGAGGAGGAGAGGG - Intronic
1135879032 16:26235303-26235325 CTGGTGAAGTGAGGAGCATATGG + Intergenic
1136030672 16:27500283-27500305 GTGGGGGAGTGGGGAGCAGGGGG + Intronic
1136083595 16:27868810-27868832 CTATGGCAGAGGGCAGCAGACGG - Intronic
1136116313 16:28097150-28097172 CTGGGGAAGTGGGGAGCTGTGGG - Intergenic
1136394909 16:29987457-29987479 CTATGGCAGCGGGGGGCAGATGG + Exonic
1136452347 16:30360448-30360470 CTGTGGAGGTGGAGAGGAGCAGG - Intronic
1136643854 16:31591686-31591708 GTGTAGGGGTGGGGAGCAGAAGG - Intergenic
1136661751 16:31769084-31769106 GTGTAGGGGTGGGGAGCAGAAGG + Intronic
1136684668 16:31987017-31987039 CTGTGGAAGGGGGGCTGAGATGG + Intergenic
1136785292 16:32930553-32930575 CTGTGGAAGGGGGGCTGAGATGG + Intergenic
1136884490 16:33923251-33923273 CTGTGGAAGGGGGGCTGAGATGG - Intergenic
1137458747 16:48638593-48638615 ATGAGGACGTGGGGAGAAGACGG + Intergenic
1137967803 16:52953772-52953794 CTGAAGAAGCTGGGAGCAGAAGG + Intergenic
1138453043 16:57105187-57105209 TAGTGGAAGTGGGGAGAGGACGG + Intronic
1138530404 16:57631466-57631488 GGGTGGAAGTAGGGAGGAGAGGG + Intronic
1138551882 16:57752946-57752968 CTGTGGGAGTGGGGGGCGGTGGG - Intronic
1139507427 16:67406150-67406172 GTGTGGAAGTGGGGAGGCAAAGG - Intronic
1139516280 16:67454169-67454191 CTGTGGGAGTGGAGTGGAGAGGG + Intronic
1139759318 16:69171670-69171692 CTGTGGGAGAGGGGAGAGGAGGG + Intronic
1139910602 16:70395176-70395198 CTGTGGAAGGGAGGGGAAGATGG + Intronic
1139956934 16:70697659-70697681 CTGCAGAGGTGGGGAGGAGATGG - Intronic
1140587636 16:76312299-76312321 TCTTGGAAGTGGGGAGCAGTAGG + Intronic
1140891549 16:79289374-79289396 GAGTGGCAGTGGGGAGAAGATGG + Intergenic
1141134775 16:81458142-81458164 ATGAGGAAGTGGGGAGGAGAGGG + Intronic
1141651662 16:85396191-85396213 TTGGGGAACTGGGGAGGAGACGG - Intergenic
1141675916 16:85517240-85517262 CTGTGGGAGGCGGGAGGAGATGG + Intergenic
1141743571 16:85910756-85910778 ATGGGGAAGTAGGGAGCAGGTGG - Intronic
1141848385 16:86626811-86626833 CTGCAGATGTGGGGAGAAGAGGG - Intergenic
1141897387 16:86967060-86967082 CTGTGGCAGTGTGGAGAAGGGGG + Intergenic
1141956594 16:87376079-87376101 CTGTGGCAGTGGAGGGCAGGGGG - Intronic
1142493731 17:294984-295006 CTGTAGAAATGGAAAGCAGAGGG + Intronic
1143034300 17:3985741-3985763 CTGGGGGAGCAGGGAGCAGAGGG + Intergenic
1143095240 17:4475356-4475378 CTGGGAAACTGGGGAGGAGATGG + Intronic
1143115800 17:4581391-4581413 ATGTGGACCTGGGGTGCAGAGGG + Intergenic
1143381000 17:6496332-6496354 GTGTGGGAGAGCGGAGCAGAAGG - Intronic
1143993124 17:10983975-10983997 CTGTAGAAGTTGGAAGAAGAGGG - Intergenic
1144171536 17:12664126-12664148 ATGTAGAAGAGGGAAGCAGAAGG + Intergenic
1144877926 17:18412039-18412061 GAGTGGAAGAGGGGAGAAGAGGG - Intergenic
1144979349 17:19158948-19158970 ATGTGGAAGTGCAGAGGAGAAGG - Exonic
1144988873 17:19219284-19219306 ATGTGGAAGTGCAGAGGAGAAGG + Exonic
1145084511 17:19925450-19925472 TTGTGGAGGTGGGGAGTAGGAGG - Intronic
1145154303 17:20532386-20532408 GAGTGGAAGAGGGGAGAAGAGGG + Intergenic
1146794903 17:35774007-35774029 CTGAGGAAGCGAGGAGGAGAGGG - Intronic
1147047454 17:37764506-37764528 CTGTGGAGGTTGGAAGCAGTGGG + Intergenic
1147145601 17:38482698-38482720 CTGTGGAAGAGGGGCTGAGATGG + Intronic
1147438746 17:40433845-40433867 CTCTGGAGGTGGGGAGCGGGAGG + Intergenic
1147622693 17:41878367-41878389 ATGAGGTAGTAGGGAGCAGAGGG - Intronic
1148130255 17:45257950-45257972 CTGTGGGAGTGGGAAGCACCAGG + Intronic
1148681026 17:49473560-49473582 CTGTAGAAGAAAGGAGCAGAAGG + Intronic
1148856593 17:50582350-50582372 CCCTGGAAATGGAGAGCAGAGGG + Intronic
1149265929 17:54927666-54927688 CTGTGGATGTGGGGAGCCAGGGG - Intronic
1149445679 17:56711585-56711607 CTGTGGAAGAGGTGAGCAAAGGG - Intergenic
1149549231 17:57527633-57527655 CTTCAGAAATGGGGAGCAGAAGG + Intronic
1150206496 17:63412516-63412538 CTGTGGGCTTGGGGAGCAGCTGG - Intronic
1151316362 17:73325054-73325076 CATTGGAGGTGGGGCGCAGAGGG - Intergenic
1151365890 17:73616310-73616332 CTGTTGAGGTGGGGAGCCGGGGG - Intronic
1151672482 17:75579059-75579081 GTGGGAAAGTGGGAAGCAGAGGG + Intergenic
1152354330 17:79799334-79799356 CTGTGGAAGTGGGAGGGAGGGGG + Intronic
1152562718 17:81086635-81086657 CTGTGGACGAGGGGGGCCGAGGG - Intronic
1153641941 18:7165093-7165115 GTGAGGAAGAGGGAAGCAGAAGG - Intergenic
1153758766 18:8310267-8310289 CTGTGGGAGTGGGGAGACAATGG - Intronic
1154031080 18:10755128-10755150 CTTTAGAAGTGGGGATAAGATGG + Intronic
1154145358 18:11862136-11862158 CTGTGGCAGTGGAGAAGAGAGGG + Intronic
1154308915 18:13252780-13252802 CTGTGGATGTGGAGGGCCGACGG - Intronic
1154475295 18:14748725-14748747 CTGGGGACGAGGGGAGCAGGTGG + Intronic
1154529435 18:15329959-15329981 CTGGGGACGAGGGGAGCAGGTGG - Intergenic
1155375396 18:25151632-25151654 CTAAGGGAGTGGGGTGCAGAGGG - Intronic
1155576040 18:27248047-27248069 CAGTGGAAGTGGGGAGAAGTGGG - Intergenic
1157177596 18:45465604-45465626 CTGAGGAAGGGAGGAGGAGAAGG - Intronic
1157279339 18:46335369-46335391 GAGTGGAGGTGGGGAGAAGAGGG - Intronic
1158116908 18:54005717-54005739 CTGAGGAAGTAGGGGCCAGAGGG + Intergenic
1158283673 18:55854970-55854992 CTGTGGAAGTTTGGAGAAGGTGG + Intergenic
1159467152 18:68798300-68798322 CTGTAGAGCTGGGAAGCAGAAGG + Intronic
1160353134 18:78201976-78201998 CTGAGGGAGTGGGGAGGAGGAGG - Intergenic
1160745742 19:709996-710018 CTGTGGGAGTGAGGGGCAGAGGG - Intronic
1161218830 19:3108467-3108489 GTGTGGAAGTGGGGAGGTGCCGG + Intronic
1161720281 19:5898442-5898464 CTGTGCTTGTGGGGAGCAGATGG - Intronic
1161787026 19:6333120-6333142 CTGTGGTAGGGGGAGGCAGAGGG - Intronic
1161983648 19:7642960-7642982 CTGGGGAAGTAGGGGGAAGAGGG - Intronic
1162318988 19:9959813-9959835 CTGGGGAGGTGGGGGGCAGGGGG + Exonic
1164721269 19:30433319-30433341 TTGGGGAAGTGGGGGGAAGATGG - Intronic
1164998668 19:32742983-32743005 CTGTAGAAGTGCTGAGCAGGAGG + Intronic
1165856399 19:38881242-38881264 CAGTGGGAGTTGGGAGCAGTGGG + Intronic
1166698499 19:44867965-44867987 ATGAGGCAGTGGGGGGCAGAGGG + Intronic
1167236607 19:48319448-48319470 CTTTGGAGATGGGGAGCATACGG - Exonic
1167643476 19:50694405-50694427 GTGGGGATGTGGGGATCAGAGGG + Intronic
1167787840 19:51650363-51650385 CAGTGGAAGTGGTGAGAAGAGGG + Intergenic
1167902866 19:52635257-52635279 CTGGTGCAGTGGGCAGCAGAGGG - Exonic
1167932074 19:52874173-52874195 CTGGTGTAGTGGGCAGCAGAGGG - Intronic
1167933812 19:52890431-52890453 CTGGGGCAGTGGGCAGCAGAGGG - Intronic
1168001163 19:53447071-53447093 CTGGTGCAGTGGGCAGCAGACGG + Intronic
1168271648 19:55253240-55253262 ATGTGGAAGAGGGGCCCAGAGGG + Intronic
1168710588 19:58497905-58497927 CTTTGTAGGTGGGGAGCAGTGGG - Intronic
925336011 2:3099806-3099828 CTGGTGGAGTGGGGAGCAGGTGG - Intergenic
925712891 2:6758669-6758691 ATGTGGAAGAGGGAGGCAGAGGG + Intergenic
925783200 2:7402914-7402936 CTGGAGTAGAGGGGAGCAGAAGG + Intergenic
925999511 2:9319095-9319117 CTGTTTAAGGGGGCAGCAGACGG + Intronic
927719673 2:25374545-25374567 CCTTGGAAGTAGGAAGCAGAGGG + Intergenic
927857411 2:26536121-26536143 CTGAGGAAATGGGGAGGGGAGGG + Intronic
928096260 2:28406912-28406934 CTGAGGAGGTGGGGAGGGGAGGG + Intronic
928461128 2:31473659-31473681 CTGAGGAGGTGGTTAGCAGAGGG + Intergenic
928463255 2:31495630-31495652 CTGTCGGGGTGGGGAGCAGGGGG + Intergenic
928922453 2:36539659-36539681 CCGTGGAGGTGGGGAGAAGTGGG + Intronic
929121146 2:38484917-38484939 CTGGGGAGGAGGGGAGCAGCAGG + Intergenic
929121747 2:38489453-38489475 CTGGGGGAGTGTGGAGCAGTTGG - Intergenic
929898055 2:45978550-45978572 CTGTGGAAGAGGGCTGCAGCTGG - Intronic
929906596 2:46051363-46051385 CTGTGAAGGTGGGGAGCTGTGGG + Intronic
929982212 2:46692140-46692162 CTTTGGGAGTGAGGATCAGAAGG - Intergenic
930167153 2:48214323-48214345 CAGTGGAACAGGGCAGCAGAGGG + Intergenic
932216506 2:69969640-69969662 CTGGGGCAGTGGGGAGAGGATGG - Intergenic
932320536 2:70819321-70819343 CAGTGGGGGTGGGGTGCAGAGGG - Intronic
932734245 2:74243237-74243259 CTGCAGAACGGGGGAGCAGAAGG - Intronic
932839634 2:75069945-75069967 CTGTGAATGTGGGCAGCACATGG - Intronic
933250624 2:80024941-80024963 CAGTGGAAGTGGGTCTCAGAGGG + Intronic
933370553 2:81410137-81410159 CTGTGGAGGAGGGTTGCAGAGGG + Intergenic
934061992 2:88303437-88303459 GTGAGGAAGAGGGGAGCAGTGGG - Intergenic
935206851 2:100903732-100903754 CTGTGGGAGTGGGAGGCTGAAGG - Intronic
935327307 2:101948547-101948569 CTGTGGAGGTGGAGAGTGGATGG + Intergenic
935361952 2:102252852-102252874 ATGAGGCAGTGTGGAGCAGATGG + Intergenic
935386897 2:102509306-102509328 GTGTGGAAGAGGGAGGCAGAAGG - Intronic
935549035 2:104432227-104432249 TGGGGGGAGTGGGGAGCAGAGGG - Intergenic
935691983 2:105740397-105740419 CAGGGGAACTGGAGAGCAGAAGG + Intergenic
936049102 2:109209609-109209631 CTGTGTAGGTGGGGAGGAAAGGG + Intronic
936662734 2:114560209-114560231 CTGTGGGAGTTGGGAGGAGAAGG + Intronic
936904768 2:117524781-117524803 CTGTGGAAGTAGGGGGCTGGGGG - Intergenic
936933576 2:117815333-117815355 GTGTGGAAGTGGGTAGAGGAAGG - Intronic
937067469 2:119028702-119028724 CTGTGGACTTGGGGAGCACCTGG + Intergenic
937345216 2:121121163-121121185 CTGTGGAAGGGGAGGGCAGGGGG + Intergenic
938528533 2:132161381-132161403 CTGGGGACGAGGGGAGCAGGTGG - Intronic
939290417 2:140187384-140187406 CATTGGAAGTAGGGAGCAGTAGG - Intergenic
940468713 2:154065108-154065130 CTGTGGCAGTGGGGACCACAGGG + Intronic
943458109 2:188133045-188133067 CAGTGGAACTGGGAAGAAGATGG + Intergenic
944594329 2:201247421-201247443 CTGGGGAAATGTGGAGCTGAGGG - Intronic
944842781 2:203640452-203640474 GTGGGGAAGTGGGGAGCTGAGGG - Intergenic
944916372 2:204364840-204364862 CTGTGGCAGTGAGGAGGTGAGGG - Intergenic
945396560 2:209325337-209325359 GTGTGGAAATGGGGAGAGGAGGG - Intergenic
945578185 2:211558372-211558394 CTTTGTAAGTGGGAGGCAGAAGG - Intronic
946171327 2:217897730-217897752 ATGTAGAGGTGGTGAGCAGATGG + Intronic
946194397 2:218024475-218024497 CTGCAGAGGTGGGGAGCTGATGG + Intergenic
946661990 2:222010998-222011020 CTGAGAGGGTGGGGAGCAGAAGG + Intergenic
946704389 2:222443962-222443984 CTGTGGAAGTGCTGAACACATGG + Intronic
947449899 2:230198200-230198222 CTGTGGAAGTGTGTGGAAGAGGG - Intronic
948010699 2:234648033-234648055 CAGTGGAAGTAGGCAGCAGCGGG - Intergenic
948011025 2:234649319-234649341 CAGTGGAAGTAGGCAGCAGCGGG - Intergenic
948486630 2:238285410-238285432 CTCTGAAAGTGGGGAGGATAGGG - Intronic
948627734 2:239279556-239279578 CTGTCGGGGTGAGGAGCAGAAGG + Intronic
948903636 2:240967879-240967901 GTGAGGCAGTGGGGGGCAGAAGG - Intronic
948904759 2:240973550-240973572 CTGGGGATGTGGGGAGCTGGGGG - Intronic
1168814618 20:728230-728252 CGGTGGGGGTGGGGAGCAGACGG + Intergenic
1169194965 20:3678034-3678056 CTTCGCAAGTGGGGAGCAGATGG + Intronic
1169496730 20:6122870-6122892 CTGGCGAAGTGGGGAGCGGGGGG + Exonic
1171106679 20:22440109-22440131 CTGTGGCACAGGGGAGCAGCAGG - Intergenic
1171847749 20:30287734-30287756 CAGTGGAAGTGCTGAGCACAGGG - Intergenic
1172589255 20:36105930-36105952 CTGGGGAGGAGGGGAGGAGAGGG - Intronic
1172766899 20:37355843-37355865 CCATGGAGGTGGGGAGCAGCAGG + Intronic
1172775007 20:37402238-37402260 CTGCGGGAGTAGGGAGCACAGGG - Intronic
1173064690 20:39699200-39699222 CAGTGTTAGTGGGGAGCATATGG - Intergenic
1173197540 20:40928255-40928277 CTGTGGGAGTGCAGAGGAGAGGG - Intergenic
1173317062 20:41954587-41954609 ATCTGGATGAGGGGAGCAGATGG + Intergenic
1174153275 20:48500974-48500996 CTGTGGACCTGGGGAGGAGCCGG - Intergenic
1174402371 20:50282950-50282972 CCGTGGAGGTGGGGAGACGAGGG - Intergenic
1175369753 20:58480344-58480366 CTGAGGATGTGAGAAGCAGAAGG + Intronic
1176142116 20:63549297-63549319 CGGTGGGTGTGGGGAGGAGACGG - Intronic
1176217290 20:63954235-63954257 CTGTGGAAGTGGGGAGCAGAGGG - Intronic
1176239344 20:64068745-64068767 CTGTGGAAGTTGGCAGAAGCAGG - Intronic
1176767963 21:13038509-13038531 CTGGGGACGAGGGGAGCAGGTGG + Intergenic
1177351187 21:19944023-19944045 CTATCGGAGTGGGGAGTAGAAGG - Intergenic
1179403890 21:41109595-41109617 CTGTGGCAGTGGGGAAGTGAAGG + Intergenic
1179546040 21:42112813-42112835 CTCTGGATGTGTAGAGCAGATGG - Intronic
1179575738 21:42307209-42307231 CAGTGGGATGGGGGAGCAGAGGG + Intergenic
1179663174 21:42891497-42891519 GTGTGGAAGTGGGGAGCTCCAGG + Intronic
1180162566 21:46004809-46004831 CTGCGGGAGGGAGGAGCAGACGG - Exonic
1180432524 22:15264791-15264813 CTGGGGACGAGGGGAGCAGGTGG + Intergenic
1181237647 22:21457391-21457413 CTGAGGAAGTAAGGTGCAGATGG + Intergenic
1181339308 22:22165672-22165694 CTGTGTAAGTGAGGGGCAGAAGG + Intergenic
1181635027 22:24170553-24170575 CTGTGGGAGTGCGGGGCAGGAGG - Intronic
1181669900 22:24421153-24421175 CTGTGGGACTGGGGTGCACATGG + Intronic
1181745825 22:24954185-24954207 CTCTGCAAGGGGGGATCAGAGGG - Intronic
1182624905 22:31638454-31638476 GTGGGGAAGTGGGGAGAACAGGG + Intronic
1182645434 22:31805162-31805184 CTGTGGGAGTTGGGAATAGAAGG - Intronic
1182662811 22:31936861-31936883 CTAAGGAAGTGGGAAGCAGAAGG + Intronic
1183030547 22:35100825-35100847 CTAAGGCAGTGGGGAGTAGACGG + Intergenic
1183424691 22:37733219-37733241 CTGTTGGAGGTGGGAGCAGAGGG + Intronic
1183786316 22:40031034-40031056 CTCTGGCAGTGGGGAGGGGAAGG + Exonic
1184392525 22:44212694-44212716 CTTGGGCAGTGGTGAGCAGAGGG + Intronic
1184678422 22:46055933-46055955 GTGGGGAAGTGGGGGGCACAGGG - Intronic
1185363261 22:50422231-50422253 CTGTGGATGAGGAAAGCAGATGG - Intronic
949903737 3:8840943-8840965 CTGTGGAACAGGGCAGGAGAAGG + Intronic
951141577 3:19168325-19168347 TTATAGAAGTGGGGAACAGAGGG - Intronic
951159954 3:19407434-19407456 CTGCGTAGGTGTGGAGCAGAGGG - Intronic
952189892 3:31011610-31011632 CTGTGGATGTTGGTAGCTGAGGG - Intergenic
952777692 3:37061796-37061818 CTGTGGGAGTGAGTAGCTGAGGG - Intronic
953133575 3:40163673-40163695 CTGTGGAATAGGGGAGCTGCTGG - Intronic
953749823 3:45600659-45600681 CTGCAGAGGTGGGGTGCAGAGGG + Intronic
953845457 3:46422866-46422888 CTGTGGAACAAGGGAGCAGATGG - Intergenic
954330960 3:49890061-49890083 CTGTGGAAAGGGGGAGGTGAGGG + Intronic
954672098 3:52296692-52296714 CTGTGGAAGTGGGGAGCTCAGGG + Intergenic
954754130 3:52829874-52829896 CTGCGGAAGTGGGGATGAGTTGG - Intronic
958801695 3:98763662-98763684 CTGAGGAAGCAGGGAACAGAAGG + Intronic
958821941 3:98985244-98985266 CTTGGGAAGTGGGAAGCAGTAGG + Intergenic
958981056 3:100720494-100720516 CTATGGAAGGGGGCAGGAGAAGG + Intronic
959306411 3:104671831-104671853 CTATGGTAATGGTGAGCAGATGG + Intergenic
959358976 3:105366819-105366841 CCGGGGAAGTGGGGAGGAGACGG + Intergenic
961620533 3:128220627-128220649 AGTTAGAAGTGGGGAGCAGAAGG - Intronic
961739626 3:129025001-129025023 CTGAGGGAGGGAGGAGCAGATGG + Intronic
961757043 3:129134415-129134437 TTGTGGAAGTGGGGAGGATTTGG - Intronic
962089704 3:132230381-132230403 CACTGGAACTGGGGAGGAGAGGG - Intronic
962342350 3:134596257-134596279 CTGTAAAGGTGGGTAGCAGAGGG - Intergenic
963546518 3:146666072-146666094 CTGTGGAAGTAAGAAGAAGAGGG - Intergenic
963786277 3:149537693-149537715 CTGAGGAATTGTGGGGCAGATGG - Intronic
964118650 3:153161168-153161190 TTGGGGAAGTGGGAGGCAGAGGG + Intergenic
964402691 3:156315403-156315425 TTGTGGAAGTGGTGGACAGATGG - Intronic
967052408 3:185797044-185797066 CTGGGGAAGTGGGGAGAAACAGG - Intronic
967716821 3:192772135-192772157 GTGTGGAAGTGGGGAAGACAAGG - Intergenic
967948271 3:194821035-194821057 CTGTGGTTGAGGGAAGCAGAGGG + Intergenic
968614993 4:1573735-1573757 CTGAGGATGGGGGGAGCTGAGGG - Intergenic
969065298 4:4474638-4474660 ATGTGGAAGTGGGAGGCAGAAGG + Intronic
969183668 4:5460318-5460340 AGGTGGAAGTGGCCAGCAGAGGG - Intronic
969411337 4:7030209-7030231 CAGTGGAAGTGGGGAGCCGGGGG + Intronic
969644532 4:8419807-8419829 GTGTGGAACTGGGGTGCAGGAGG - Intronic
970604608 4:17667477-17667499 CTCTGGAAGTGGGCATCACATGG - Intronic
971944872 4:33261392-33261414 CTGTGGTTGTGGGCAGTAGAAGG - Intergenic
972099017 4:35388707-35388729 TTCTGGAAGTGGGGAACAGCAGG - Intergenic
972717374 4:41660888-41660910 GTCTGAAAGTGGGGAGGAGAGGG + Intronic
974026736 4:56739432-56739454 GTGGGGTAATGGGGAGCAGATGG - Intergenic
976106868 4:81628340-81628362 CTGGGAAAGTTGGAAGCAGAAGG - Intronic
978621402 4:110637353-110637375 CTGTGGAAAGGAGGACCAGAAGG + Intronic
980103673 4:128566488-128566510 CTGTGGAAGAGGGGCCCCGATGG + Intergenic
982073132 4:151713319-151713341 CTGTGGACTTGGGGGGCCGAAGG - Intronic
982096813 4:151930867-151930889 CAGAGGAAGGGGGAAGCAGAGGG - Intergenic
982932735 4:161429093-161429115 CTGGGGCAGTGGGGACCACAAGG + Intronic
983740153 4:171120771-171120793 CTGTGGAATTGGGAAGACGATGG - Intergenic
984159127 4:176229916-176229938 GGGTGGGAGTGGAGAGCAGAAGG + Intronic
985268150 4:188169335-188169357 TTGTGGAAGTGGGCATCAGAAGG - Intergenic
985475082 5:74297-74319 CTGGGGAACTGGGGAGCTGTGGG + Intergenic
985641020 5:1063606-1063628 AGGTGGAGGTGGGGAGGAGAAGG - Intronic
986163704 5:5253733-5253755 CTGTGGATGTGGTGACCAGGTGG - Intronic
986685500 5:10272459-10272481 CTGTGGGTGGAGGGAGCAGAAGG - Intergenic
988320008 5:29682928-29682950 CTGTGGCAGTGGGTAACAGTTGG - Intergenic
988793401 5:34630125-34630147 CTGGGGAGGTGGGGAGAGGAGGG - Intergenic
989270952 5:39532294-39532316 CTGTTGAAGGGGGAAGCTGAAGG - Intergenic
989557061 5:42809592-42809614 CTTTGGAGGTGGGGAGCTAATGG + Intronic
989648155 5:43659007-43659029 CTGTGGAAGTGTTGGTCAGATGG + Intronic
989993134 5:50792779-50792801 CAGTGGAAGTGGTGAGAAAAGGG - Intronic
990149724 5:52802288-52802310 GTGTGGAGGTGGGGAGAAAAGGG - Exonic
990995267 5:61726753-61726775 CTCTGGAAGTGGGGAGCAAAGGG + Intronic
991248817 5:64536289-64536311 GTGAGGAAGTGGAGAGCATATGG + Intronic
992158536 5:73978539-73978561 CCGTGGAAGTGGGGTGGAGATGG + Intergenic
993663729 5:90669577-90669599 TTGTAGAAGTGGGCATCAGAAGG + Intronic
994561718 5:101382363-101382385 CTTTGGAACTGGGTAACAGATGG - Intergenic
995074927 5:107971351-107971373 GTGTGGAAGTTGGCATCAGAAGG - Intronic
995735342 5:115295092-115295114 CTGTCAGAGTGGGGAGCAGGGGG - Intronic
996026705 5:118654498-118654520 CTTTGCAAGTGTGCAGCAGAGGG - Intergenic
996494731 5:124140780-124140802 CTCTGAAGGTGGGGAGAAGAAGG + Intergenic
996841197 5:127849292-127849314 CTGTAGAACTGGGGAGAATAAGG - Intergenic
997295893 5:132768171-132768193 CTGTGGAAGTGTGGGGTACAGGG + Intronic
997709394 5:135990952-135990974 CAGCGGAAGTGGAGAGCAGTGGG + Intergenic
997870704 5:137502859-137502881 CTGTGGAAGTGGGGTGAAGTGGG - Intronic
998667101 5:144309843-144309865 CTGAGGAACAGGGAAGCAGAAGG + Intronic
998883232 5:146666644-146666666 CTATGAAAGTGGAGAGGAGATGG - Intronic
998936705 5:147236647-147236669 CTGTGGAAGGGGGAAGCAGATGG - Intronic
999362758 5:150999641-150999663 CTGTGGGAGTAGGGAGCACAGGG - Intergenic
999666741 5:153920613-153920635 ATGGGGAGGTGGGAAGCAGAAGG - Intergenic
999854392 5:155578071-155578093 CTGTGAAAGTAGGGAACAGCTGG + Intergenic
1000790907 5:165605987-165606009 CAGTGGTAATGGTGAGCAGAAGG - Intergenic
1001416963 5:171552102-171552124 ATGTGGCAGTGGAGAGCAGTGGG + Intergenic
1001456770 5:171868177-171868199 TTGTGGTAGTGGGGAAGAGAGGG + Intronic
1002213614 5:177612511-177612533 GTGGGGAGGTGGGCAGCAGAGGG + Intergenic
1002258632 5:177978587-177978609 CTGTGGGACTGGAGAGCAGACGG + Intergenic
1002399207 5:178981860-178981882 CCATGGAAGAGGGGACCAGATGG + Intronic
1002501229 5:179648959-179648981 CTGTGGGACTGGAGAGCAGACGG - Intergenic
1002606404 5:180385367-180385389 CGGTGGAGATGGGGAGAAGATGG + Intergenic
1003285667 6:4731889-4731911 CTGTGGAAGGAGGGGGAAGATGG + Intronic
1003571413 6:7258710-7258732 CTGGGGAAGTCGGGAGGAAATGG + Intergenic
1004825114 6:19411516-19411538 CAGTAGTGGTGGGGAGCAGAGGG - Intergenic
1005805282 6:29468538-29468560 GTGTGGATGTGGGGAGAGGAGGG + Intergenic
1005997557 6:30940683-30940705 CTGGGGAAGTGGGGAGCAGATGG - Intergenic
1006143166 6:31943202-31943224 CTGTGGGTGTGAGGATCAGATGG - Intronic
1006209197 6:32378868-32378890 CTGGGGAAGTGGGGCGAATATGG + Intergenic
1006516154 6:34546813-34546835 CTGGGGATGTGGGGGACAGAGGG + Intronic
1006582130 6:35083255-35083277 CTGTGGGACTGGCCAGCAGAAGG + Intronic
1006699754 6:35962484-35962506 CTGAGGAAGGGGAGGGCAGAGGG - Intronic
1006786900 6:36674254-36674276 CTATGGAACTGGGGATCAGGAGG + Intergenic
1006945796 6:37783748-37783770 CCGGGGAAGCGGGGAGCAGGGGG - Intergenic
1007345143 6:41223479-41223501 CTGTGCATGTGAGGAGCAGGAGG - Intergenic
1007380759 6:41488755-41488777 GTGTGTCAGTGGGGAGCAGATGG + Intergenic
1007617063 6:43186448-43186470 CTGTGCAGGTGGGCAGCACATGG + Exonic
1007675926 6:43594946-43594968 CTGGGGAGGTGGGGGGCATATGG + Intronic
1007703849 6:43779686-43779708 CTCTGGAAGCTGGGAGCTGAGGG - Intronic
1007854254 6:44838416-44838438 CTGTGTAAGAGGGCAGTAGAGGG + Intronic
1008970914 6:57366805-57366827 ATCTGTAAGTGGGGAGCAGCTGG + Intronic
1009159874 6:60268609-60268631 ATCTGTAAGTGGGGAGCAGCTGG + Intergenic
1010450595 6:75997899-75997921 CTGTGGAATCAGGGAACAGATGG + Intronic
1012414390 6:98997043-98997065 ATGGGGAAGTGGGGAGCAAGAGG + Intergenic
1012570099 6:100713640-100713662 GTGTGGGAGTAGGGAGCACATGG + Intronic
1012953688 6:105545659-105545681 GTGTGGATGAGGAGAGCAGAAGG - Intergenic
1013680704 6:112522337-112522359 CAGTGTAAGTGAAGAGCAGAGGG - Intergenic
1013890117 6:115016797-115016819 CTGTGTAATTGGGCAGCAGGGGG - Intergenic
1013998344 6:116335969-116335991 CTGTGGGAGTCTGGTGCAGAAGG + Intronic
1014019501 6:116571379-116571401 ACGTGGAAGTAGGGAGCAGGCGG + Exonic
1014550334 6:122782793-122782815 AGATGGAGGTGGGGAGCAGAGGG + Intronic
1016471548 6:144379907-144379929 CTGTGGAGGAGTGGAGGAGAAGG + Intronic
1017588569 6:155953692-155953714 CTGTGGAAGTGGAGGGGAGCTGG + Intergenic
1017712813 6:157185113-157185135 CTCTGTCAGTGGGGAGGAGAGGG - Intronic
1019126284 6:169842372-169842394 CCATGGAAGTGGGAAGCAGCCGG - Intergenic
1019734465 7:2644013-2644035 CTCTGCAAGTGGAGAGCAGAGGG + Intronic
1020654394 7:10912171-10912193 CAGTGGAGGTGGAGAGAAGAGGG - Intergenic
1020899804 7:13990442-13990464 CTGTGGCTGTGGGGAGGAGGAGG + Intronic
1021086661 7:16428656-16428678 CTGTGGAAGGGAGGAACATATGG + Intergenic
1021667400 7:22998649-22998671 CTGTGGAGATGGAGAGCAGATGG - Intronic
1022031312 7:26493780-26493802 CTCTGGTACTGGGAAGCAGAGGG - Intergenic
1022259185 7:28687773-28687795 AGGTGGAAGTGGGGAGCAGAGGG + Intronic
1022469571 7:30674067-30674089 CTGTGGAAATAGGGAGTTGAGGG - Intronic
1022729620 7:33010221-33010243 CTGTGGAACTGGAGAGAAGTGGG - Intergenic
1023179135 7:37463668-37463690 GTGAGGAAGTGGGGAGAGGAAGG + Intergenic
1023203075 7:37719935-37719957 CTTTGGAAATGGGGAGCAGCAGG + Intronic
1023246695 7:38212622-38212644 TTGTGGCAGTGGTGAGCAGGTGG + Intronic
1023591339 7:41783635-41783657 CTGTAGATGTGGAGAGAAGACGG + Intergenic
1023857397 7:44193098-44193120 CTGATGAATTGGGGAGCAGGTGG + Intronic
1024855924 7:53779151-53779173 CTGTGGAAATGGGGGACAGTGGG - Intergenic
1025910589 7:65825438-65825460 ATGTGGAAGAGGGAGGCAGAAGG - Intergenic
1026044765 7:66899383-66899405 ATGTGGAAGAGGGAGGCAGAAGG - Intergenic
1026592594 7:71710045-71710067 CTTTGTAAGTGGGGAGGAAATGG + Intronic
1026776668 7:73235090-73235112 CCGAGGAAGTGGGGGGCAGTAGG - Intergenic
1027017520 7:74788460-74788482 CCGAGGAAGTGGGGGGCAGTAGG - Intronic
1027070503 7:75157472-75157494 CCGAGGAAGTGGGGGGCAGTAGG + Intergenic
1029195800 7:98804490-98804512 CTGTGGCAGAGGGGAGGAGGGGG - Intergenic
1030190484 7:106805752-106805774 TTGTAGAAGTTGGGAGCAGGTGG + Intergenic
1030654168 7:112147995-112148017 CAGTGGGAGTGTGGAGGAGAGGG - Intronic
1030781848 7:113610679-113610701 ATGGGGAAGAGGGGAGAAGAGGG + Intergenic
1031072772 7:117180296-117180318 ATGTGGAAGAGGGGAACAGGTGG + Intronic
1033242510 7:139691769-139691791 CTGTGCAAGTGGGGATGAAACGG + Intronic
1033350478 7:140558167-140558189 CTGGAGAAGATGGGAGCAGAAGG - Exonic
1033735452 7:144217415-144217437 CTGTGGCAGTGGAGAGGATATGG + Intergenic
1033747602 7:144333554-144333576 CTGTGGCAGTGGAGAGGATATGG - Intergenic
1034362768 7:150515078-150515100 CTGTGGGAGGGGTGAGTAGAAGG + Intronic
1034951449 7:155299054-155299076 CTGGGGAACTGGTGAGCAGCGGG + Intronic
1034982375 7:155487406-155487428 CTGTGGAAATGTGGACCATATGG + Intronic
1034983353 7:155491949-155491971 CTGGTGAAGTGGGGGGCTGAAGG + Intronic
1036576912 8:10036237-10036259 CTGTGGAAGAGGAGAGCTGTAGG - Intergenic
1037620148 8:20556294-20556316 CTGTGGACATTGTGAGCAGAGGG + Intergenic
1037620160 8:20556363-20556385 CTGTGGACATTGTGAGCAGAGGG + Intergenic
1037693991 8:21207899-21207921 CTGTGGGGGTGGGGGGTAGAGGG - Intergenic
1037805950 8:22057926-22057948 CTGTGGGAATGGGGAGCCCAGGG + Intronic
1038023856 8:23571965-23571987 CTAAGGCATTGGGGAGCAGAGGG - Exonic
1038308389 8:26425139-26425161 TGGTGGAAATGGGGATCAGAAGG + Intronic
1038407145 8:27330618-27330640 CTGTGCAAGGGGGCGGCAGAGGG + Intronic
1038450823 8:27637758-27637780 GGGTGGAAGTGGGGAGAGGAGGG + Intronic
1039516634 8:38139236-38139258 CACTGGAAGTGGGGAGAAAATGG - Exonic
1039588094 8:38723712-38723734 CTGGGGGCGTGGGGAGCAGAGGG - Intergenic
1040797430 8:51301137-51301159 CGGTGGAAGTGCTGAGCAAAAGG + Intergenic
1041618493 8:59935960-59935982 TTGTGGAATTGGGCAGTAGAAGG + Intergenic
1041640508 8:60194776-60194798 CTTTGGAAGCTGGAAGCAGATGG - Intronic
1042104884 8:65315797-65315819 CTGTGGAAGAGGATGGCAGAAGG - Intergenic
1042506170 8:69563176-69563198 GTTTGCATGTGGGGAGCAGATGG - Intronic
1043398192 8:79858493-79858515 CAGTGGATTTGGGGAGGAGAAGG - Intergenic
1043418924 8:80079289-80079311 CTGTAGAAGTTGGGGGCAGGAGG - Intronic
1043607731 8:82023259-82023281 ATGTGGAAGAGAGGATCAGATGG + Intergenic
1045959138 8:107946504-107946526 CTGTGGGACTGGGGCACAGAAGG + Intronic
1046776832 8:118173321-118173343 TTATGGAGGTGGAGAGCAGAAGG + Intergenic
1047332516 8:123904632-123904654 CACTGGAAGTGTTGAGCAGAGGG + Intronic
1048070691 8:131017595-131017617 GTGTGGGGGTGGGGAGTAGATGG - Intronic
1049010559 8:139884405-139884427 GTGGGGAAGTGGGCAGCAGGTGG - Intronic
1049039682 8:140103070-140103092 CTGTGGGAGTGGGGAGCGGCAGG - Intronic
1049190615 8:141285371-141285393 CCGTGTAACTGGGGAGCACACGG - Intronic
1049303032 8:141881841-141881863 AATTGGAAGTGGGGAGCTGAGGG - Intergenic
1049560357 8:143307164-143307186 GTGTGGCAGAGGGCAGCAGAGGG + Intronic
1049797489 8:144503332-144503354 CTGTGGAGGTGGGGCTCTGACGG + Intronic
1049831597 8:144704592-144704614 CTGGGGAGGAGGGGAGCAGGTGG + Intergenic
1050120153 9:2299658-2299680 CTGTGGAAGGTTGGAGGAGAGGG + Intergenic
1051512383 9:17892798-17892820 ATGTGGGAGTGGGGAGGTGATGG - Intergenic
1051726185 9:20089692-20089714 CTGTGGCAGTGGTGGGCAGGGGG - Intergenic
1051874685 9:21778996-21779018 CTGTAGAAGCTGAGAGCAGAAGG - Intergenic
1052079021 9:24180286-24180308 CTGTGAAAGTGGCCAGGAGAGGG - Intergenic
1053423572 9:37996646-37996668 CTGGGGAGGTGGGGACCAGCAGG - Intronic
1053707151 9:40767721-40767743 CTGGGGACGAGGGGAGCAGGTGG - Intergenic
1053785870 9:41652377-41652399 CAGTGGAAGTGCTGAGCACAGGG - Intergenic
1054159171 9:61661800-61661822 CAGTGGAAGTGCTGAGCACAGGG + Intronic
1054174585 9:61866340-61866362 CAGTGGAAGTGCTGAGCACAGGG - Intergenic
1054417064 9:64888489-64888511 CTGGGGACGAGGGGAGCAGGTGG - Intergenic
1054449443 9:65395388-65395410 CAGTGGAAGTGCTGAGCACAGGG - Intergenic
1054478945 9:65592805-65592827 CAGTGGAAGTGCTGAGCACAGGG + Intergenic
1054662953 9:67714451-67714473 CAGTGGAAGTGCTGAGCACAGGG + Intergenic
1054724136 9:68633627-68633649 CTTTTGAAGTGGGGTACAGAGGG + Intergenic
1056581152 9:87888721-87888743 CTGTGGTGGTGGGGACCAGCTGG - Exonic
1056790880 9:89624573-89624595 CTGTGGATTTGGGGTTCAGAGGG + Intergenic
1057027757 9:91747925-91747947 CTGTGGAACTGGGGAGATGTTGG + Intronic
1057217390 9:93236643-93236665 CTGTGCATGAAGGGAGCAGAGGG - Intronic
1057268843 9:93635919-93635941 CTGGGGAGGTGGGGAGGAGACGG + Intronic
1057667607 9:97058036-97058058 CTTTGGTGGTGGGCAGCAGATGG - Intergenic
1057743784 9:97735283-97735305 CTGTGGGAGGGGAGAGAAGAGGG + Intergenic
1057918318 9:99074771-99074793 CTGAGGAGGTGGAGAGCAGGTGG - Intergenic
1058056414 9:100453624-100453646 CTGTGGAAATGGGACGCAGTGGG - Intronic
1058205410 9:102100016-102100038 CTGTGGCAGTTGGCAACAGAGGG + Intergenic
1058426087 9:104876284-104876306 GTGTGGAAACGGGGAACAGAGGG + Intronic
1059299405 9:113300042-113300064 CTGTGGAAGAGGGGATCTGGGGG + Intronic
1059429536 9:114241506-114241528 CTGTGGGGGTGGGGAGCACCTGG + Intronic
1059459071 9:114418285-114418307 GTGTGGGGGTGGGGAGAAGAGGG + Intronic
1060591113 9:124817511-124817533 ATGGGGTAGTGGGGAGCAGATGG - Intergenic
1060730882 9:126036277-126036299 CAGTGGAGGTGGGGACAAGAGGG - Intergenic
1060931231 9:127490796-127490818 CTGTTGCAGGGGAGAGCAGAGGG - Intronic
1061177769 9:129007956-129007978 CTGTGGAAGAGTGGGGCAGAGGG + Intronic
1061329280 9:129881998-129882020 CTGTGGAGGTGAGCAGAAGAGGG + Intergenic
1061416640 9:130450813-130450835 CTGGGGAAGTGGAGCCCAGAAGG - Intronic
1061629985 9:131866210-131866232 CTGAGGAAGGGAGGAGGAGATGG - Intronic
1061832357 9:133304072-133304094 CTGGGGAAGGGGTGAGCCGAGGG - Intergenic
1061952388 9:133943703-133943725 CTGGGGCTGTGGGGAGCAGGAGG - Intronic
1062169899 9:135129193-135129215 CTGGGGAAGTGGGGTGGGGATGG + Intergenic
1185640531 X:1587879-1587901 GAGGGGAAGTGGGGAGGAGAGGG - Intergenic
1185640553 X:1587925-1587947 CAGGGGAAGGGGGGAGGAGAGGG - Intergenic
1186390200 X:9151143-9151165 CTCTGGAATGCGGGAGCAGAAGG + Intronic
1187492372 X:19764109-19764131 TTTTTGAAGTGGGGAGCAGGTGG - Intronic
1187519855 X:20003749-20003771 CTCAGGAAGTGGGGAGCAGCAGG - Intergenic
1188642843 X:32527892-32527914 CTGTGGAAGGGGGGAAGATAGGG + Intronic
1189560135 X:42183829-42183851 GTGTGGAAGTGCAGAGAAGATGG + Intergenic
1190204799 X:48394294-48394316 CTGCGGAAGGGGAGCGCAGATGG + Intergenic
1190205737 X:48401109-48401131 CTGCGGAAGGGGAGCGCAGATGG - Intergenic
1190262326 X:48805267-48805289 CAGTGGCAGTGGTGAGGAGAGGG + Intronic
1190525367 X:51324296-51324318 CTGTGAAAGAGGGGAAAAGAGGG - Intergenic
1192362623 X:70449163-70449185 CTGGGGAATTGGGGAGGGGATGG + Intronic
1193330707 X:80232679-80232701 CTGTGGAAGGCAGGAGCAGAGGG + Intergenic
1194986856 X:100499856-100499878 GAGTGGAAGTGGGGAGAGGAGGG + Intergenic
1195329198 X:103782947-103782969 CTGGGGATGGGGGGAGAAGAAGG - Intronic
1195938859 X:110150297-110150319 CTGTGGCAATGGGGAGCACAAGG + Intronic
1196668502 X:118341859-118341881 TTGTGGAAGTAGGTATCAGAAGG + Intergenic
1197733284 X:129830115-129830137 CTCTGGAAGTGAGGACCACAGGG - Intronic
1198367033 X:135951465-135951487 CTGTGGGAGAGAGCAGCAGAGGG + Intergenic
1198405061 X:136304127-136304149 CTGTAGATATGGAGAGCAGATGG + Exonic
1199136079 X:144254775-144254797 TTGTGGAGGTGGGGAGTACAAGG - Intergenic
1200078738 X:153565185-153565207 CTGTGGGTGTCGGGTGCAGACGG - Intronic
1200215237 X:154365367-154365389 CGCTGGCAGTGGGGAGCTGAAGG - Exonic
1200327987 X:155262913-155262935 TTGTGGAAGTGGGGAGCTGGAGG + Intronic
1201489397 Y:14524606-14524628 CCGTGGCAGTGGGGAGGGGACGG - Intronic