ID: 1176219799

View in Genome Browser
Species Human (GRCh38)
Location 20:63964510-63964532
Sequence TCCTCCTCAGGCGGGGACGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 132}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176219784_1176219799 30 Left 1176219784 20:63964457-63964479 CCCCGGCCGCCACCCCTGGAGCT 0: 1
1: 0
2: 0
3: 29
4: 293
Right 1176219799 20:63964510-63964532 TCCTCCTCAGGCGGGGACGCAGG 0: 1
1: 0
2: 0
3: 20
4: 132
1176219789_1176219799 18 Left 1176219789 20:63964469-63964491 CCCCTGGAGCTCTCATCTTACTG 0: 1
1: 0
2: 0
3: 10
4: 163
Right 1176219799 20:63964510-63964532 TCCTCCTCAGGCGGGGACGCAGG 0: 1
1: 0
2: 0
3: 20
4: 132
1176219788_1176219799 21 Left 1176219788 20:63964466-63964488 CCACCCCTGGAGCTCTCATCTTA 0: 1
1: 0
2: 0
3: 20
4: 191
Right 1176219799 20:63964510-63964532 TCCTCCTCAGGCGGGGACGCAGG 0: 1
1: 0
2: 0
3: 20
4: 132
1176219786_1176219799 28 Left 1176219786 20:63964459-63964481 CCGGCCGCCACCCCTGGAGCTCT 0: 1
1: 0
2: 3
3: 26
4: 361
Right 1176219799 20:63964510-63964532 TCCTCCTCAGGCGGGGACGCAGG 0: 1
1: 0
2: 0
3: 20
4: 132
1176219785_1176219799 29 Left 1176219785 20:63964458-63964480 CCCGGCCGCCACCCCTGGAGCTC 0: 1
1: 0
2: 4
3: 41
4: 338
Right 1176219799 20:63964510-63964532 TCCTCCTCAGGCGGGGACGCAGG 0: 1
1: 0
2: 0
3: 20
4: 132
1176219787_1176219799 24 Left 1176219787 20:63964463-63964485 CCGCCACCCCTGGAGCTCTCATC 0: 1
1: 0
2: 1
3: 29
4: 352
Right 1176219799 20:63964510-63964532 TCCTCCTCAGGCGGGGACGCAGG 0: 1
1: 0
2: 0
3: 20
4: 132
1176219790_1176219799 17 Left 1176219790 20:63964470-63964492 CCCTGGAGCTCTCATCTTACTGT 0: 1
1: 0
2: 0
3: 18
4: 157
Right 1176219799 20:63964510-63964532 TCCTCCTCAGGCGGGGACGCAGG 0: 1
1: 0
2: 0
3: 20
4: 132
1176219791_1176219799 16 Left 1176219791 20:63964471-63964493 CCTGGAGCTCTCATCTTACTGTG 0: 1
1: 0
2: 2
3: 8
4: 169
Right 1176219799 20:63964510-63964532 TCCTCCTCAGGCGGGGACGCAGG 0: 1
1: 0
2: 0
3: 20
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176219799 Original CRISPR TCCTCCTCAGGCGGGGACGC AGG Exonic