ID: 1176220556

View in Genome Browser
Species Human (GRCh38)
Location 20:63967565-63967587
Sequence GTGCAGCCGCCGGTGGTAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 97}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176220556_1176220563 12 Left 1176220556 20:63967565-63967587 CCGCCTACCACCGGCGGCTGCAC 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1176220563 20:63967600-63967622 AGCACCGCTGTCCCAACACGAGG 0: 1
1: 0
2: 0
3: 3
4: 39
1176220556_1176220567 20 Left 1176220556 20:63967565-63967587 CCGCCTACCACCGGCGGCTGCAC 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1176220567 20:63967608-63967630 TGTCCCAACACGAGGGCACCGGG 0: 1
1: 0
2: 0
3: 8
4: 78
1176220556_1176220564 13 Left 1176220556 20:63967565-63967587 CCGCCTACCACCGGCGGCTGCAC 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1176220564 20:63967601-63967623 GCACCGCTGTCCCAACACGAGGG 0: 1
1: 0
2: 1
3: 1
4: 35
1176220556_1176220572 26 Left 1176220556 20:63967565-63967587 CCGCCTACCACCGGCGGCTGCAC 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1176220572 20:63967614-63967636 AACACGAGGGCACCGGGGGCAGG 0: 1
1: 0
2: 0
3: 5
4: 114
1176220556_1176220569 22 Left 1176220556 20:63967565-63967587 CCGCCTACCACCGGCGGCTGCAC 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1176220569 20:63967610-63967632 TCCCAACACGAGGGCACCGGGGG 0: 1
1: 0
2: 0
3: 3
4: 61
1176220556_1176220568 21 Left 1176220556 20:63967565-63967587 CCGCCTACCACCGGCGGCTGCAC 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1176220568 20:63967609-63967631 GTCCCAACACGAGGGCACCGGGG 0: 1
1: 0
2: 1
3: 4
4: 62
1176220556_1176220574 28 Left 1176220556 20:63967565-63967587 CCGCCTACCACCGGCGGCTGCAC 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1176220574 20:63967616-63967638 CACGAGGGCACCGGGGGCAGGGG 0: 1
1: 0
2: 0
3: 21
4: 244
1176220556_1176220566 19 Left 1176220556 20:63967565-63967587 CCGCCTACCACCGGCGGCTGCAC 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1176220566 20:63967607-63967629 CTGTCCCAACACGAGGGCACCGG 0: 1
1: 0
2: 1
3: 5
4: 91
1176220556_1176220573 27 Left 1176220556 20:63967565-63967587 CCGCCTACCACCGGCGGCTGCAC 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1176220573 20:63967615-63967637 ACACGAGGGCACCGGGGGCAGGG 0: 1
1: 0
2: 0
3: 7
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176220556 Original CRISPR GTGCAGCCGCCGGTGGTAGG CGG (reversed) Intronic
903263310 1:22142772-22142794 GGGCAGCGGCCGGTGCCAGGCGG - Intronic
903813289 1:26046521-26046543 GGGCAGCCGCCAGTCGGAGGGGG - Intergenic
904614597 1:31743046-31743068 GGGCAGGCGCCGGTGGTGGGCGG - Intronic
905278067 1:36831922-36831944 GTGCAGCATCCGGAGGTAAGAGG - Intronic
905520655 1:38597020-38597042 GTGGAGCCGCCGGAGGTGGTGGG - Intergenic
914919387 1:151837454-151837476 GTGCAGCCTCAAGTGGAAGGTGG + Intergenic
915894883 1:159804090-159804112 GAGCAGCCTCCAGTGGTAGGAGG - Intronic
916243361 1:162661653-162661675 GTGAAGCCGGAGGTTGTAGGAGG + Intronic
916733174 1:167584260-167584282 GACCAGCCGCTGGTGGTTGGGGG - Intergenic
921064251 1:211611551-211611573 GTGCAGCTGCCTCTGGCAGGGGG - Intergenic
1063033196 10:2256696-2256718 GTGCAGCTGCCCCTGCTAGGTGG - Intergenic
1070567153 10:77612583-77612605 GTGCAGCCGCCTGTTCTTGGAGG - Intronic
1070707097 10:78647681-78647703 GTGCAGCCTCTGGGGGTGGGAGG - Intergenic
1073469654 10:103714750-103714772 GTGCAGCAGCCAGTGGCAGGGGG + Intronic
1074267002 10:111914685-111914707 GTGCAGCCTCCAGTGCTAAGGGG - Intergenic
1077168914 11:1157799-1157821 GGCCAGCGGCCGGTGGCAGGCGG - Intergenic
1078318080 11:10308188-10308210 GTGCAGCTGCCGGCTGGAGGCGG + Intergenic
1084272838 11:68038391-68038413 CTGCAGCCGCGGGGGGTAGAGGG - Intergenic
1094650581 12:32371986-32372008 GTGCAGCCACCTGTGGTGGTAGG - Intronic
1096157298 12:49347754-49347776 GCGCTGCCGCCGATGGAAGGGGG - Exonic
1096371978 12:51076413-51076435 GTGAAGCTGGCAGTGGTAGGAGG + Exonic
1097104087 12:56610468-56610490 GGGCAGCCACCGATGGCAGGGGG - Exonic
1101413848 12:104491893-104491915 GTGAGGCTGCAGGTGGTAGGGGG - Intronic
1102787948 12:115619475-115619497 TTGCAGCTGCTGGGGGTAGGTGG - Intergenic
1103392468 12:120584568-120584590 GTGCAGACGCCGGCGGTGGCCGG + Intergenic
1104133802 12:125918842-125918864 GTGCTGGCGAAGGTGGTAGGTGG - Intergenic
1104636705 12:130442101-130442123 GTCCACCCGCAGGTGGGAGGGGG + Exonic
1115662614 14:35511960-35511982 TTCCAGCAGGCGGTGGTAGGTGG + Intergenic
1128783687 15:70379425-70379447 GTGCAGCCGCGGGTGTTGTGTGG + Intergenic
1131098970 15:89673365-89673387 CTGCAGCTGCCGGTGGTGAGTGG - Exonic
1136621985 16:31435747-31435769 TTGCAGCCGCCGGTGGACTGTGG - Exonic
1138600016 16:58048622-58048644 GTGCTGCAGCCTGTGGGAGGTGG + Intergenic
1138776472 16:59729658-59729680 GTGCAGCCGCAGGGGGCTGGTGG - Intronic
1142433598 16:90043601-90043623 GTGCCGCCGACTGTGGTCGGAGG - Exonic
1144625427 17:16841977-16841999 CTCCAGCAGGCGGTGGTAGGTGG + Intergenic
1144881002 17:18430744-18430766 CTCCAGCAGGCGGTGGTAGGTGG - Intergenic
1145151229 17:20513643-20513665 CTCCAGCAGGCGGTGGTAGGTGG + Intergenic
1145210445 17:21009150-21009172 GTGCAGAGGCAGGAGGTAGGAGG + Intronic
1145871341 17:28276190-28276212 TTCCAGCAGGCGGTGGTAGGTGG + Intergenic
1146233063 17:31130864-31130886 GAGCAGCCTTCGGTGGGAGGAGG + Intronic
1146929525 17:36767766-36767788 TTGCTGCTGCTGGTGGTAGGAGG + Intergenic
1150294639 17:64001369-64001391 GTGCAGGGGCTGGTGGTCGGTGG + Intronic
1152589655 17:81205324-81205346 GGGCAGGCGCCAGGGGTAGGAGG + Intronic
1158964563 18:62611564-62611586 GTGCAGGCGCCGGTGGGGCGTGG - Intergenic
1160527146 18:79544623-79544645 GTGCTGGCGGCGGTGGTGGGGGG - Intergenic
1163152728 19:15424677-15424699 GGGCAGCCGACGGTGGTGAGCGG - Exonic
1163987057 19:20963210-20963232 TTCCAGCAGGCGGTGGTAGGTGG - Intergenic
1165262858 19:34635884-34635906 GTGCTGCCTCTGGTGCTAGGGGG + Intronic
1166734237 19:45075319-45075341 GGGCAGCGGCCGGGGGGAGGGGG - Intronic
1167058826 19:47130844-47130866 GTGCTGCCGGCGGCGGTAGGTGG + Exonic
1167090610 19:47341305-47341327 GTGCAGCCGGCGGTAGATGGCGG - Exonic
926120785 2:10240270-10240292 GTGCAGCTGCAGGTACTAGGTGG - Intergenic
929874248 2:45783377-45783399 GTGCAGCCTTCGGTGGGTGGGGG - Intronic
930751939 2:54942957-54942979 GTGGAGAGGCAGGTGGTAGGAGG - Intronic
934649379 2:96082319-96082341 GGGCAGCTGCCGGAGGTGGGGGG - Intergenic
935617977 2:105104847-105104869 GTGCAGCAGGTGTTGGTAGGAGG + Intergenic
948368413 2:237473251-237473273 GAGCAGCAGCCGGTGGTGTGAGG - Intergenic
948519184 2:238524732-238524754 GTGCAGCCCCCAGGGGCAGGCGG + Intergenic
949037194 2:241821287-241821309 GGGGAGCCGCCCGTGGTGGGAGG - Intergenic
1171283107 20:23917889-23917911 GTGCAGCCCACGCTGGGAGGCGG - Intergenic
1172188119 20:33044140-33044162 AGGCAGCCACCAGTGGTAGGGGG - Intergenic
1174103293 20:48143756-48143778 GGGCACCTGCCGGTGGGAGGGGG + Intergenic
1176220556 20:63967565-63967587 GTGCAGCCGCCGGTGGTAGGCGG - Intronic
1176705845 21:10119657-10119679 GTGCAGCCCCAGGCGGTGGGTGG + Intergenic
1178363898 21:31972569-31972591 GTGCACCCGCCGAGGGTATGGGG - Intronic
1179540460 21:42080076-42080098 GTGAAGGCGCCTGTGGTGGGCGG + Intronic
1179654806 21:42838243-42838265 GTGCAGCGGGCTGTGGAAGGAGG - Intergenic
1180887655 22:19258646-19258668 TTCCAGCAGGCGGTGGTAGGTGG - Intronic
1181035812 22:20169332-20169354 GTGGAGCAGCCGGTGGTGGCTGG + Intergenic
1184357207 22:43990302-43990324 GTGCATCCGCTGGTCGTACGGGG + Exonic
1184835814 22:47020259-47020281 GACCAGCAGCCGGTGGTGGGAGG + Intronic
961389231 3:126542553-126542575 GAGCAGCCGCAGGTAGGAGGGGG - Exonic
961506844 3:127375744-127375766 GTGCAGATGCTGGGGGTAGGGGG - Intergenic
963310021 3:143699879-143699901 GTGCAGCCTACGGTTGAAGGAGG - Intronic
969675181 4:8610534-8610556 GTGTAGCCTCGGGGGGTAGGAGG - Intronic
972793999 4:42398367-42398389 ATGCAGCCGCCGCCGTTAGGCGG - Intronic
983027194 4:162752783-162752805 GTGCAGCTGGCAGTGATAGGGGG + Intergenic
989296634 5:39835431-39835453 GACCAGGCGCTGGTGGTAGGTGG - Intergenic
996584039 5:125064788-125064810 ATGCAGCGGCCGTTGTTAGGTGG - Intergenic
997304068 5:132825703-132825725 CTGAAGCCGCTGGCGGTAGGCGG + Exonic
997926092 5:138032675-138032697 GAGCAGGCGCGGGTGGCAGGCGG + Intronic
1001939810 5:175732543-175732565 TTGCAGCCGTGGGTGGTGGGAGG + Intergenic
1003836004 6:10073396-10073418 GTGCTGCTGCCGGTGGTCTGAGG - Intronic
1006366778 6:33620977-33620999 GTGCAGGCGCCCGCGGAAGGGGG - Exonic
1007623495 6:43229161-43229183 GCGCAGCTGCCGGGGGTCGGGGG + Intronic
1011242684 6:85288849-85288871 TTCCAGCAGGCGGTGGTAGGTGG - Intergenic
1016730575 6:147423261-147423283 GCTCAGCCCCTGGTGGTAGGGGG - Intergenic
1026969018 7:74456739-74456761 GTGCAGAGGCCAGGGGTAGGAGG - Intronic
1030682267 7:112446561-112446583 GTGGAGGTGCTGGTGGTAGGTGG + Intronic
1035353644 7:158264538-158264560 CTGCAGCAGCCGGTGGCAGCAGG + Intronic
1036599769 8:10249622-10249644 GTGCAGAAGCTGGTGGTGGGTGG - Intronic
1041048284 8:53907891-53907913 GTGCAGCCATCAGAGGTAGGAGG + Intronic
1053558036 9:39158731-39158753 GTTCAGCCCCAGGTGGGAGGTGG + Intronic
1054139078 9:61460221-61460243 GTTCAGCCCCAGGTGGGAGGTGG - Intergenic
1056928974 9:90858813-90858835 GGGCAGCCCCCTGTGGCAGGTGG - Intronic
1057152441 9:92807902-92807924 GTGCAGGCGTCAGTGGAAGGCGG - Intergenic
1060210398 9:121706801-121706823 GTGCATGCCCAGGTGGTAGGTGG - Intronic
1061119885 9:128636004-128636026 GGGAAGCCGTCAGTGGTAGGGGG - Intronic
1202790879 9_KI270719v1_random:89746-89768 GTGCAGCCCCAGGCGGTGGGTGG + Intergenic
1186402001 X:9268845-9268867 GTGCAGACATCGGTGGGAGGTGG + Intergenic
1187155823 X:16719755-16719777 TTGCAGCAGCCGGTGGCAGGCGG + Exonic
1189332826 X:40153754-40153776 GTGCAGCCGCGGGGGTTAGGGGG + Intronic
1193697363 X:84724919-84724941 CTGCAGCTGCCAGTGGTAGGGGG + Intergenic
1195853909 X:109310239-109310261 GTGCCCCAGCCGGGGGTAGGGGG + Intergenic
1199643993 X:149887445-149887467 GTGCAGCCTCCAGAGGTAGCAGG - Intergenic