ID: 1176220557

View in Genome Browser
Species Human (GRCh38)
Location 20:63967568-63967590
Sequence CCTGTGCAGCCGCCGGTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 123}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176220557_1176220573 24 Left 1176220557 20:63967568-63967590 CCTACCACCGGCGGCTGCACAGG 0: 1
1: 0
2: 0
3: 12
4: 123
Right 1176220573 20:63967615-63967637 ACACGAGGGCACCGGGGGCAGGG 0: 1
1: 0
2: 0
3: 7
4: 128
1176220557_1176220568 18 Left 1176220557 20:63967568-63967590 CCTACCACCGGCGGCTGCACAGG 0: 1
1: 0
2: 0
3: 12
4: 123
Right 1176220568 20:63967609-63967631 GTCCCAACACGAGGGCACCGGGG 0: 1
1: 0
2: 1
3: 4
4: 62
1176220557_1176220569 19 Left 1176220557 20:63967568-63967590 CCTACCACCGGCGGCTGCACAGG 0: 1
1: 0
2: 0
3: 12
4: 123
Right 1176220569 20:63967610-63967632 TCCCAACACGAGGGCACCGGGGG 0: 1
1: 0
2: 0
3: 3
4: 61
1176220557_1176220566 16 Left 1176220557 20:63967568-63967590 CCTACCACCGGCGGCTGCACAGG 0: 1
1: 0
2: 0
3: 12
4: 123
Right 1176220566 20:63967607-63967629 CTGTCCCAACACGAGGGCACCGG 0: 1
1: 0
2: 1
3: 5
4: 91
1176220557_1176220572 23 Left 1176220557 20:63967568-63967590 CCTACCACCGGCGGCTGCACAGG 0: 1
1: 0
2: 0
3: 12
4: 123
Right 1176220572 20:63967614-63967636 AACACGAGGGCACCGGGGGCAGG 0: 1
1: 0
2: 0
3: 5
4: 114
1176220557_1176220564 10 Left 1176220557 20:63967568-63967590 CCTACCACCGGCGGCTGCACAGG 0: 1
1: 0
2: 0
3: 12
4: 123
Right 1176220564 20:63967601-63967623 GCACCGCTGTCCCAACACGAGGG 0: 1
1: 0
2: 1
3: 1
4: 35
1176220557_1176220574 25 Left 1176220557 20:63967568-63967590 CCTACCACCGGCGGCTGCACAGG 0: 1
1: 0
2: 0
3: 12
4: 123
Right 1176220574 20:63967616-63967638 CACGAGGGCACCGGGGGCAGGGG 0: 1
1: 0
2: 0
3: 21
4: 244
1176220557_1176220563 9 Left 1176220557 20:63967568-63967590 CCTACCACCGGCGGCTGCACAGG 0: 1
1: 0
2: 0
3: 12
4: 123
Right 1176220563 20:63967600-63967622 AGCACCGCTGTCCCAACACGAGG 0: 1
1: 0
2: 0
3: 3
4: 39
1176220557_1176220567 17 Left 1176220557 20:63967568-63967590 CCTACCACCGGCGGCTGCACAGG 0: 1
1: 0
2: 0
3: 12
4: 123
Right 1176220567 20:63967608-63967630 TGTCCCAACACGAGGGCACCGGG 0: 1
1: 0
2: 0
3: 8
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176220557 Original CRISPR CCTGTGCAGCCGCCGGTGGT AGG (reversed) Intronic
900461121 1:2802545-2802567 CCAGGGCAGCTGCCGGTGGTGGG - Intergenic
901455540 1:9360905-9360927 CCTGTGCTGCCACCTGTGGGGGG + Intronic
903415223 1:23177777-23177799 CCTGGGAAGCCGCCGGTGCCGGG + Exonic
903453897 1:23473777-23473799 CCTGTGCAGAGGCTGTTGGTAGG + Intronic
904614598 1:31743049-31743071 GATGGGCAGGCGCCGGTGGTGGG - Intronic
905534382 1:38708862-38708884 CCTGTGCTGCGGCCTGTGGCTGG + Intergenic
913260315 1:116991839-116991861 CCTGCGCAGCCTCCCATGGTGGG - Intergenic
913518307 1:119623491-119623513 CGTGTGCAGGCGCAGGTGGTTGG + Exonic
922484439 1:225962455-225962477 CCTGGGCAGCTGCAGGTGGGTGG - Intergenic
923001099 1:230007008-230007030 CCTCTGCAGCCTCCAGTGGATGG - Intergenic
923580520 1:235207371-235207393 CCTGTGCAGCCGATCGTGGTTGG - Intronic
1063173871 10:3534449-3534471 CCTTTGCAGCAGACTGTGGTAGG + Intergenic
1066464254 10:35639563-35639585 CCTGTGCACCCGCTGCTGCTGGG - Exonic
1070567154 10:77612586-77612608 CCTGTGCAGCCGCCTGTTCTTGG - Intronic
1070707098 10:78647684-78647706 TCTGTGCAGCCTCTGGGGGTGGG - Intergenic
1075239846 10:120768351-120768373 CCTGAGCAGCCTTCGATGGTGGG - Intergenic
1077444860 11:2586213-2586235 CCTGGGCAGCCCCCGCTGGCTGG + Intronic
1078631672 11:13009453-13009475 CTAGTGCAGCCGCCGGAGGGGGG + Intergenic
1083459051 11:62798890-62798912 CCTGTGCAGCCCCGGGAGGAGGG + Intronic
1083750731 11:64759304-64759326 CCTGTGCAGCAGGCGGGGCTGGG - Intronic
1091242488 11:134063265-134063287 CTTGGGCAGCAGCTGGTGGTAGG + Intergenic
1094731687 12:33183699-33183721 CCTCTGCTGCTGCCCGTGGTAGG - Intergenic
1095949417 12:47773671-47773693 TCTGTGCAGCCGGCAGTGGCGGG - Intronic
1096113273 12:49041132-49041154 CCTGCGCAGCCCCCGATGCTGGG - Exonic
1101888964 12:108694312-108694334 CATGTGCAGCGACCTGTGGTGGG - Intronic
1105804628 13:23945967-23945989 CCTGCTCAGGAGCCGGTGGTTGG - Intergenic
1115199780 14:30840580-30840602 CCTGTGCAGCTGCAGGCGTTGGG + Intergenic
1128308466 15:66615505-66615527 CCTGTCCAGCCCTCGATGGTCGG + Intronic
1128332074 15:66762503-66762525 CCTGGGCAGCCCTCCGTGGTGGG + Intronic
1130156633 15:81356411-81356433 CCTGTGCAGCCTGCGGGGGTGGG - Intronic
1130234906 15:82124829-82124851 CCTGTGCTGCCCCACGTGGTGGG + Intergenic
1130449523 15:84036841-84036863 CCTGTACAGCAGCCTGTGGCAGG + Exonic
1132111411 15:99104916-99104938 CCTTGGCGGCCGCAGGTGGTCGG - Intronic
1132579367 16:678053-678075 CCTGTGCAGCCTCAGGTAGCCGG - Exonic
1132645835 16:998882-998904 CCTGGGCAGCCGGTGCTGGTGGG + Intergenic
1136462121 16:30418069-30418091 CGTGTGCACGCGCCGGTGCTTGG - Exonic
1136490420 16:30604411-30604433 CGTGTGCAGCAGCTGGTGCTGGG + Exonic
1142184115 16:88686338-88686360 CGTCTCCAGCCGCCGGTAGTTGG + Exonic
1142738523 17:1917077-1917099 TCTGTGCAGCAGCCGGTGCAGGG + Intergenic
1145059713 17:19724859-19724881 CCTGTGCAGCCCCCGAGGGCAGG - Intergenic
1146052881 17:29567047-29567069 CCTGGGCAGCCGCCGCCGGCGGG - Exonic
1148102270 17:45099515-45099537 CCAGTGCTGCCCCGGGTGGTGGG + Intronic
1149313735 17:55420978-55421000 GCTGTGGAGGCGCCGGTGTTAGG - Intronic
1150294638 17:64001366-64001388 GCTGTGCAGGGGCTGGTGGTCGG + Intronic
1151965112 17:77427159-77427181 CCTGTGCAGAGGCCGGAGGTGGG + Intronic
1160385605 18:78494513-78494535 CTTGGGCAGACGTCGGTGGTGGG - Intergenic
1160942478 19:1626919-1626941 CCCATGCAGCCTCCGGTGCTGGG - Intronic
1161066999 19:2243556-2243578 ACCGTGCAGCTGCCTGTGGTGGG + Intronic
1161295740 19:3519365-3519387 CTTGTGAAGCCGCCAGTGCTGGG + Intronic
1161849740 19:6732155-6732177 CCTGCGCAGGCGGCGGGGGTGGG + Exonic
1162573486 19:11485669-11485691 CATGTGCCGCCGCAGGTGGTTGG + Exonic
1163371890 19:16905775-16905797 CCAGTGCAGCTGCTGGGGGTAGG + Intronic
1166201016 19:41238133-41238155 CCTGTGGAGACGCCGGAGGGAGG + Exonic
1166332749 19:42088308-42088330 CCTGTGCAGCCGGGGGTGCTGGG - Intronic
1167374336 19:49103063-49103085 CCTCTGCAGACGCAGCTGGTGGG + Intronic
1167631614 19:50629504-50629526 CCTGTGCACCTGGTGGTGGTGGG + Exonic
1168251449 19:55144627-55144649 CCTGCGCAGCGGCAGGTGGGAGG - Intronic
1168307045 19:55441438-55441460 CCCGTGCAGCTGGCGGCGGTGGG - Intronic
1168315390 19:55482686-55482708 CGTGTGCACCCGCTGGTGGATGG - Exonic
1168468368 19:56621808-56621830 CGTGTGCACCCGCTGGTGGATGG - Exonic
1168474197 19:56664296-56664318 CGTGTGCACGCGCCGGTGCTGGG + Exonic
1168474241 19:56664548-56664570 CGTGTGCACGCGCCGGTGCTGGG + Exonic
1168684352 19:58338953-58338975 CGTGTGCACCCGCTGGTGCTGGG - Exonic
1202647116 1_KI270706v1_random:152832-152854 CCTCTGCAGCCACCGGGGATGGG + Intergenic
927441088 2:23118435-23118457 CATGTGCTGCAGCCTGTGGTAGG - Intergenic
927852676 2:26510235-26510257 CCTTTGCAGCTGCAGGTCGTGGG - Intronic
927948139 2:27149626-27149648 ACTGAGCAGCAGCCAGTGGTAGG + Intronic
928799377 2:35068168-35068190 CCTGTTCAGCCCCAGGTGGTGGG - Intergenic
929246415 2:39708172-39708194 CGTGAGAAGCAGCCGGTGGTAGG + Intronic
929461104 2:42102489-42102511 CCTGCAAAGCCGCCGATGGTTGG - Intergenic
934649382 2:96082322-96082344 CCTGGGCAGCTGCCGGAGGTGGG - Intergenic
938143064 2:128812262-128812284 CCCTTGCAGAAGCCGGTGGTTGG - Intergenic
938548033 2:132352920-132352942 CCTGTGCAGCCGCCGCCGCCGGG - Intergenic
942142323 2:172989669-172989691 CCTGAGAAGCCACGGGTGGTGGG - Intronic
1171876902 20:30585692-30585714 CCTGTGCAGCCGCCGCCGCCGGG - Intergenic
1174460724 20:50680574-50680596 CGTGTGCAGCCGCCTGTGCGAGG + Intronic
1176220557 20:63967568-63967590 CCTGTGCAGCCGCCGGTGGTAGG - Intronic
1176604754 21:8819942-8819964 CCTCTGCAGCCACCGGGGATGGG - Intergenic
1180347044 22:11711547-11711569 CCTCTGCAGCCACCGGGGATGGG - Intergenic
1180763079 22:18223611-18223633 GCTGGGCAGCCGACTGTGGTGGG - Intergenic
1180772566 22:18400936-18400958 GCTGGGCAGCCGACTGTGGTGGG + Intergenic
1180803946 22:18650552-18650574 GCTGGGCAGCCGACTGTGGTGGG + Intergenic
1180806817 22:18718897-18718919 GCTGGGCAGCCGACTGTGGTGGG - Intergenic
1182024918 22:27110644-27110666 GCTGTGCAGCCACCTGGGGTGGG - Intergenic
1183612762 22:38921713-38921735 CCTGTCCATCCGCAGGTTGTGGG - Intergenic
1184129032 22:42506372-42506394 CCTGTGCAGCAGCCAGTGCCTGG - Intergenic
1184138979 22:42566686-42566708 CCTGTGCAGCAGCCAGTGCCTGG - Intronic
1184835813 22:47020256-47020278 GCTGACCAGCAGCCGGTGGTGGG + Intronic
1185222502 22:49636099-49636121 CCAGTGCAGAAGCAGGTGGTGGG - Intronic
1203234404 22_KI270731v1_random:141924-141946 GCTGGGCAGCCGACTGTGGTGGG + Intergenic
953532167 3:43748552-43748574 CCTGCGCAGCAGCTTGTGGTAGG + Intergenic
953557667 3:43959744-43959766 CCTGAGCAGCTGTCTGTGGTGGG - Intergenic
953782976 3:45887769-45887791 CCTGTGCAGCCCCTGCTGGGCGG + Intronic
968942605 4:3646591-3646613 ACGGTGCAGCCGCCAGTGCTGGG + Intergenic
969352712 4:6606832-6606854 CCTGTGCAGAGGCCTGGGGTGGG + Intronic
969626722 4:8309377-8309399 CCTGTGCAGCCCCAGCTGCTGGG + Intergenic
972457853 4:39271975-39271997 CCTGTGCAGTCTCCTGTGGTAGG - Intronic
972738248 4:41866102-41866124 CCTGTTCAGCCGGCCGGGGTGGG - Intergenic
973373370 4:49270995-49271017 CCTCTGCAGCCACCGGGGATGGG + Intergenic
973387640 4:49524213-49524235 CCTCTGCAGCCACCGGGGATGGG - Intergenic
985122773 4:186660607-186660629 CCTGTGCTCCCGCCGGGGCTGGG + Intronic
985791782 5:1931858-1931880 GCTGCGCAGCCGGCGGTGGAGGG + Intergenic
988201841 5:28078100-28078122 CCAGTGCAGCCGCCGGCTGAAGG + Intergenic
989578529 5:43010772-43010794 CCTGTGCAGCAGAAGGTGGATGG + Intergenic
993900503 5:93581268-93581290 CCGCTGCCGCCGCCGGGGGTGGG - Intergenic
998517681 5:142770643-142770665 CCTGTGGAGCCGGCGGCCGTCGG + Exonic
1001748519 5:174110401-174110423 CCTGTGCAGCCCCAGCTGGGAGG - Intronic
1002000590 5:176194522-176194544 CCGGTGCTGCCGCCGCTGCTCGG - Intergenic
1008648954 6:53544568-53544590 CCCGTGCCGCCGCACGTGGTCGG + Exonic
1018222597 6:161595981-161596003 CCTGTGGAGTGGCCGGTGGCAGG + Intronic
1022301971 7:29110301-29110323 CCTGTGCAGCCTGTGGAGGTTGG - Intronic
1024097696 7:45997605-45997627 CCTGTGCAGCCTGTGGAGGTTGG + Intergenic
1031237778 7:119197972-119197994 CCTGATCAGCCTCCGGGGGTTGG - Intergenic
1033933573 7:146554743-146554765 CCTGGGCAGCTGTCTGTGGTCGG - Intronic
1034176483 7:149104056-149104078 ACTGTGCAGCCTCAGGTGCTCGG + Exonic
1035053387 7:156017632-156017654 CCTCTGCAGCTGCCGGCGCTGGG - Intergenic
1037788201 8:21915370-21915392 CCTGAGATGCTGCCGGTGGTGGG + Intergenic
1037916816 8:22777975-22777997 TCTGTGCAGGGGCTGGTGGTGGG - Intronic
1040077034 8:43246921-43246943 CCTGTGCAGCCGCCGTCGGGCGG - Intergenic
1049767849 8:144363239-144363261 GCTGTGCAGCTGGTGGTGGTGGG - Intergenic
1050533261 9:6608921-6608943 CCTGAGCAGCCGTTGGGGGTGGG - Intronic
1052872655 9:33523713-33523735 CCTCTGCAGCCACCGGGGATGGG - Intergenic
1054351597 9:64021338-64021360 CCTCTGCAGCCACCGGGGATGGG - Intergenic
1056250265 9:84740512-84740534 CCTGTGCAGCCACATGTGATGGG - Intronic
1056928975 9:90858816-90858838 CCTGGGCAGCCCCCTGTGGCAGG - Intronic
1057152649 9:92808737-92808759 CCTCTGCAGCCACCGGGGTTGGG - Intergenic
1057225117 9:93289087-93289109 GCTGTGCAGCCCCTCGTGGTGGG + Exonic
1057654087 9:96938528-96938550 CCTGGGCAGCCGTCTGGGGTGGG - Exonic
1059391694 9:114003183-114003205 CCTGTGCCGCCCCAGGTGCTGGG - Intronic
1062296021 9:135827449-135827471 CCCGTGCAGCTGCCGGCGGAAGG - Exonic
1062341404 9:136095297-136095319 GCGGTGCGGCCGCCGGTGCTGGG - Intergenic
1202800844 9_KI270719v1_random:174537-174559 CCTGTGCAGCCGCCACCGCTGGG - Intergenic
1203552131 Un_KI270743v1:172031-172053 CCTCTGCAGCCACCGGGGATGGG - Intergenic
1199531493 X:148852811-148852833 GCTGTGCAGCCACAGGTGTTTGG - Intronic
1200038365 X:153347611-153347633 CGTGTGGATCCGCCGGTGCTTGG - Exonic
1201153412 Y:11107604-11107626 CCTCTGCAGCCACCGGGGATGGG - Intergenic