ID: 1176220559

View in Genome Browser
Species Human (GRCh38)
Location 20:63967572-63967594
Sequence TGGGCCTGTGCAGCCGCCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 188}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176220559_1176220572 19 Left 1176220559 20:63967572-63967594 CCACCGGCGGCTGCACAGGCCCA 0: 1
1: 0
2: 2
3: 20
4: 188
Right 1176220572 20:63967614-63967636 AACACGAGGGCACCGGGGGCAGG 0: 1
1: 0
2: 0
3: 5
4: 114
1176220559_1176220573 20 Left 1176220559 20:63967572-63967594 CCACCGGCGGCTGCACAGGCCCA 0: 1
1: 0
2: 2
3: 20
4: 188
Right 1176220573 20:63967615-63967637 ACACGAGGGCACCGGGGGCAGGG 0: 1
1: 0
2: 0
3: 7
4: 128
1176220559_1176220564 6 Left 1176220559 20:63967572-63967594 CCACCGGCGGCTGCACAGGCCCA 0: 1
1: 0
2: 2
3: 20
4: 188
Right 1176220564 20:63967601-63967623 GCACCGCTGTCCCAACACGAGGG 0: 1
1: 0
2: 1
3: 1
4: 35
1176220559_1176220567 13 Left 1176220559 20:63967572-63967594 CCACCGGCGGCTGCACAGGCCCA 0: 1
1: 0
2: 2
3: 20
4: 188
Right 1176220567 20:63967608-63967630 TGTCCCAACACGAGGGCACCGGG 0: 1
1: 0
2: 0
3: 8
4: 78
1176220559_1176220569 15 Left 1176220559 20:63967572-63967594 CCACCGGCGGCTGCACAGGCCCA 0: 1
1: 0
2: 2
3: 20
4: 188
Right 1176220569 20:63967610-63967632 TCCCAACACGAGGGCACCGGGGG 0: 1
1: 0
2: 0
3: 3
4: 61
1176220559_1176220568 14 Left 1176220559 20:63967572-63967594 CCACCGGCGGCTGCACAGGCCCA 0: 1
1: 0
2: 2
3: 20
4: 188
Right 1176220568 20:63967609-63967631 GTCCCAACACGAGGGCACCGGGG 0: 1
1: 0
2: 1
3: 4
4: 62
1176220559_1176220575 27 Left 1176220559 20:63967572-63967594 CCACCGGCGGCTGCACAGGCCCA 0: 1
1: 0
2: 2
3: 20
4: 188
Right 1176220575 20:63967622-63967644 GGCACCGGGGGCAGGGGCTGCGG 0: 1
1: 0
2: 14
3: 170
4: 1689
1176220559_1176220563 5 Left 1176220559 20:63967572-63967594 CCACCGGCGGCTGCACAGGCCCA 0: 1
1: 0
2: 2
3: 20
4: 188
Right 1176220563 20:63967600-63967622 AGCACCGCTGTCCCAACACGAGG 0: 1
1: 0
2: 0
3: 3
4: 39
1176220559_1176220574 21 Left 1176220559 20:63967572-63967594 CCACCGGCGGCTGCACAGGCCCA 0: 1
1: 0
2: 2
3: 20
4: 188
Right 1176220574 20:63967616-63967638 CACGAGGGCACCGGGGGCAGGGG 0: 1
1: 0
2: 0
3: 21
4: 244
1176220559_1176220566 12 Left 1176220559 20:63967572-63967594 CCACCGGCGGCTGCACAGGCCCA 0: 1
1: 0
2: 2
3: 20
4: 188
Right 1176220566 20:63967607-63967629 CTGTCCCAACACGAGGGCACCGG 0: 1
1: 0
2: 1
3: 5
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176220559 Original CRISPR TGGGCCTGTGCAGCCGCCGG TGG (reversed) Intronic
900142392 1:1144174-1144196 TGGGCCTGGGCAGCCGCCGAGGG - Intergenic
900346996 1:2214778-2214800 GGCGCCTGTGCAGCAGGCGGAGG - Intergenic
900985255 1:6069402-6069424 TAGGGGTGTGCAGCAGCCGGGGG + Intronic
901490534 1:9594318-9594340 TGGGCCTGTGCTGGGGCAGGGGG + Intronic
904542123 1:31239999-31240021 TGGGGCGGGGGAGCCGCCGGAGG + Intergenic
906430295 1:45750613-45750635 AGGGCCTGAGCGGGCGCCGGAGG - Exonic
907909938 1:58816555-58816577 TGGGGCTCTGGGGCCGCCGGTGG - Intergenic
912549055 1:110472754-110472776 TCCTCCTGGGCAGCCGCCGGCGG - Intergenic
915234768 1:154472584-154472606 TGGGCCTGTGCATCAGAAGGAGG + Intronic
917537916 1:175887883-175887905 TGGGCCTGAGGAGGCGACGGAGG + Intergenic
922726524 1:227925451-227925473 TGCGCCTGGGCAGCCGCCTCTGG + Exonic
923538568 1:234871588-234871610 GGGGCCTGTGCATCCCCCCGTGG + Intergenic
1062855635 10:778246-778268 TGGGCCTGTGGGGCCTCCCGGGG - Intergenic
1062898885 10:1126565-1126587 TGGCCCTGTGCAGCCACAGGAGG - Intronic
1069994093 10:72332184-72332206 TTGGCTGGTGCAGCCGCGGGAGG + Intergenic
1071509877 10:86254833-86254855 TGGGGCTGTGCAGCCGGCACTGG - Intronic
1072336472 10:94402742-94402764 CGGCGCTGTGGAGCCGCCGGAGG + Exonic
1074892630 10:117748267-117748289 AGGGCCTGGGCAGCAGCCAGAGG + Intergenic
1077245416 11:1534653-1534675 TGGGCCTGTTCCTCAGCCGGGGG - Intergenic
1077468509 11:2745671-2745693 TGGGCCTCAGCACCCGGCGGAGG + Intronic
1077871868 11:6269753-6269775 TGGGACTGAGCCGCCGCCTGAGG + Exonic
1078631668 11:13009449-13009471 AGGGCTAGTGCAGCCGCCGGAGG + Intergenic
1079251511 11:18791211-18791233 TGAGCCTCTGCGGCCGGCGGAGG - Intronic
1083144983 11:60751382-60751404 TGGGCCTGCGCAGCCCCAGAAGG - Intergenic
1083630310 11:64091817-64091839 TGGGCCTCAGCAGCCTCCTGGGG - Intronic
1083658583 11:64241839-64241861 TGGCCCTGTGCTTCCGCCCGGGG - Exonic
1083780848 11:64916569-64916591 TGGGCCTGCGCAGCTGGTGGGGG - Intronic
1084285359 11:68127811-68127833 GGGCCCTGTGCAGCCGGCAGAGG - Intergenic
1084507211 11:69575788-69575810 TGGGCCTGGGAACCCTCCGGGGG - Intergenic
1084597059 11:70123245-70123267 GGGGGCTGTGCAGCAGCAGGCGG + Intronic
1084776704 11:71381624-71381646 TGGGTCTGTGCAGCCCTCCGTGG + Intergenic
1085042660 11:73335621-73335643 TGGGCCTCTGCTGCCACCTGTGG + Intronic
1085395675 11:76206073-76206095 TGGTCCTGTGCAGCTGACGGTGG - Intronic
1087402607 11:97686134-97686156 TGGGCCTGTGCATCTGCTGAGGG - Intergenic
1090267050 11:125359750-125359772 TAGGCCTGGGCAGCCCCAGGGGG + Intronic
1096491440 12:52015130-52015152 TGAACTTGAGCAGCCGCCGGCGG - Exonic
1101442898 12:104716731-104716753 TGGGCCTGTGAAGCCCTCCGTGG - Intronic
1103711738 12:122917861-122917883 TGGGCCTGTGCTGCTGCCCCGGG + Intergenic
1104330342 12:127838751-127838773 TGGGCTTCTGCAGCAGGCGGTGG - Intergenic
1105074538 12:133264248-133264270 TGCGCCTGTGCCGGCGCGGGGGG + Intergenic
1108503312 13:51087287-51087309 TGGGTCTGGGCAGCCACCGTGGG + Intergenic
1111874163 13:93872561-93872583 TGGCCCTGTCCAGCTGCTGGAGG + Intronic
1112509613 13:99997809-99997831 TGGGCCTGGGCCGCAGCCGTGGG - Intergenic
1113956205 13:114101040-114101062 GGGGCCTGAGGAGCAGCCGGGGG + Intronic
1114424047 14:22607695-22607717 TGGGCCTGTGGGGCCTCAGGTGG - Intronic
1117899070 14:60514887-60514909 GGGGTCTGTGGAGCGGCCGGCGG + Intronic
1119195475 14:72714229-72714251 TGGGCCTCTGCTGCCCCAGGGGG - Intronic
1119761967 14:77158108-77158130 GGGGCCTGTGCAGCCAGGGGAGG + Intronic
1121438932 14:93936719-93936741 TGGGACTGTGCAGCCTCGGGGGG - Intronic
1122858536 14:104571772-104571794 TGGGCCTGAGTAGCCTCTGGCGG - Intronic
1122871916 14:104642612-104642634 TGGGGCTGGGCAGCCCACGGTGG + Intergenic
1125429545 15:39581237-39581259 TGGTCCTCGGCGGCCGCCGGGGG - Intronic
1126466106 15:48962931-48962953 TGGCCCTGTGCAGCATCCCGGGG + Exonic
1128319155 15:66680632-66680654 TGGGCATTTGCAGCTGCAGGAGG + Intronic
1129296293 15:74602156-74602178 TGGGGCTGAGCAGCGGCCTGAGG - Intronic
1130150644 15:81308918-81308940 TGGGCCTGGGCAGCAGCCACTGG - Intronic
1130156636 15:81356415-81356437 TGAGCCTGTGCAGCCTGCGGGGG - Intronic
1131268986 15:90935234-90935256 TGGGGCGGGGCAGCTGCCGGTGG + Intronic
1132355717 15:101169857-101169879 TGGCCCTGTGCAGCCCCAGCTGG - Intergenic
1132633625 16:932008-932030 TGAGCCTGTGTGGCCGCCGTCGG - Intronic
1132773148 16:1575878-1575900 TGGGGCTGTGCAGGCACCAGTGG - Intronic
1132955401 16:2589909-2589931 TGAGGCTGTGCTGCAGCCGGAGG - Intronic
1134519510 16:14912129-14912151 GGGGGCTGTGCAGACGCCAGCGG + Intronic
1134554424 16:15154105-15154127 GGGGGCTGTGCAGACGCCAGCGG - Intergenic
1136861544 16:33707207-33707229 TGGGCCTGCGCCGGCGCCGTGGG + Intergenic
1138439659 16:57026430-57026452 AGGGCCTGTGCAGACGCAGAAGG - Exonic
1139515771 16:67451527-67451549 TGGGCCTGGGCAGCCATCAGTGG + Intronic
1139776308 16:69319036-69319058 TGGCCCTCTGCAGGCCCCGGGGG - Intronic
1141608604 16:85169317-85169339 TCGGCCCGCGCCGCCGCCGGGGG + Intergenic
1141840110 16:86568539-86568561 TGGGGCTGGGGAGCCGGCGGGGG - Exonic
1142246443 16:88972304-88972326 TGTGCCAGTGGAGCCTCCGGTGG + Intronic
1203123044 16_KI270728v1_random:1555398-1555420 TGGGCCTGCGCCGGCGCCGTGGG + Intergenic
1142468336 17:148304-148326 TGGGCCTGGGCCTCCGCCGGGGG + Intronic
1143757194 17:9075730-9075752 TGTGGCTCTGCAGCCCCCGGAGG + Intronic
1143865008 17:9917204-9917226 TGGGCCTGTGCAGCTTCGGGGGG - Exonic
1145346943 17:22047579-22047601 AGGGCCTGGGCAGCCACCTGTGG + Intergenic
1145881742 17:28357398-28357420 TGGCCGTGGGCAGCCGCTGGTGG - Exonic
1146052885 17:29567051-29567073 GGGCCCTGGGCAGCCGCCGCCGG - Exonic
1146920099 17:36704389-36704411 TGTGCCTGTGCACGCGCCGCGGG + Intergenic
1148080995 17:44967757-44967779 CGGCCCTGTGGGGCCGCCGGGGG - Exonic
1152594593 17:81232176-81232198 TGGGCATGTGCTTCCGCCGCGGG + Intronic
1152703943 17:81833296-81833318 TGCGCCTGTGCAGCCCGCGGTGG - Intronic
1154129512 18:11724664-11724686 TGGGCCTGAGCAGGCCCCGAAGG - Intronic
1157533526 18:48441894-48441916 TGGGCCAGAGCAGCCGGTGGAGG - Intergenic
1157738361 18:50070782-50070804 TGGGGGTGTGCAGGGGCCGGGGG - Intronic
1158151757 18:54382175-54382197 TGGGCATGTGCAGGAGCAGGAGG - Intronic
1158542520 18:58369817-58369839 AGGGCCTGTGCAACCCCCCGCGG - Intronic
1158937717 18:62380157-62380179 TGGGCCTGTGCAGCCGCACAAGG - Intronic
1160055169 18:75472079-75472101 GGGGCCTGTACAGCCGCCTCAGG + Intergenic
1160295479 18:77633242-77633264 TGGGCCTGGGCAGAGGCAGGGGG - Intergenic
1160735321 19:659644-659666 TGGGTCTGCGCAGCCGCCTGTGG + Intronic
1160808562 19:1003138-1003160 TGGCCCAGTGCAGCTGCAGGTGG - Exonic
1161353855 19:3808570-3808592 TGGCTCTGTGCCGCCGCCGGTGG + Intronic
1161772651 19:6239469-6239491 GCGGCCTGTGCTGACGCCGGAGG + Intronic
1162469687 19:10864985-10865007 CGGGCCTGTGCAGCCCTCTGAGG + Intronic
1163368589 19:16889597-16889619 TTGGCCTGGGTAGCCGCGGGGGG - Exonic
1164538985 19:29108102-29108124 TGGCCCTGTGCAGTCTCCAGAGG + Intergenic
1165065737 19:33226852-33226874 TGGCACTGTGCGGCCGGCGGCGG + Intergenic
1165328285 19:35126617-35126639 TGGGCCGCAGCAGCCGCCGCGGG + Exonic
1166369355 19:42292634-42292656 CCTGCCTGTGCAGCCCCCGGAGG + Exonic
1167414360 19:49362382-49362404 TGGGGCTGGGGAGCCGCGGGCGG + Intronic
1167640800 19:50680322-50680344 AGGGCCTGCGCAGCCCCAGGAGG + Intronic
1168553668 19:57320643-57320665 TAGGCCTCGGCAGGCGCCGGTGG - Exonic
925098623 2:1227620-1227642 TGGGCCTGTGCAGCCGCAGCTGG + Intronic
925227182 2:2193442-2193464 TGACCGTGTGCAGCCGCAGGAGG - Intronic
927672593 2:25081717-25081739 GGGGCCTGTGCGGCTGCAGGCGG - Intronic
929574672 2:43044127-43044149 TGGGCCTGTCTGGCCTCCGGTGG - Intergenic
929775271 2:44927097-44927119 TGGGACTCTGCAGCCTGCGGAGG - Intergenic
932432129 2:71682402-71682424 AGGGCCTGGGCAGGCGCTGGGGG + Intronic
932840678 2:75079438-75079460 TGGGCCAGTGCTGCTGCCTGTGG + Intronic
934488309 2:94738181-94738203 TGGCCCTGGGCAGTTGCCGGCGG - Intergenic
934649385 2:96082326-96082348 AGGGCCTGGGCAGCTGCCGGAGG - Intergenic
934983743 2:98869333-98869355 TGTGCCTGTGCACCCGCCCAAGG - Intronic
937338944 2:121078664-121078686 AGGTCCTGTGCAGCCGCAGCTGG - Intergenic
937932401 2:127217549-127217571 TGGCCCTCTGCAGCCACCTGTGG - Intronic
937983766 2:127629446-127629468 TGTGCCTGTGCAGCTGCAGCAGG + Intronic
938090005 2:128425215-128425237 TGGGCCTGTGCCGCCGCCCAGGG - Intergenic
939567973 2:143807065-143807087 TGGGTATGTGCAGCCGCGTGTGG - Intergenic
940009480 2:149038808-149038830 TGGGCCAGCGCAGCAGGCGGGGG + Intronic
941640300 2:167980534-167980556 TGGGCCAATGCAGCCGACTGAGG + Intronic
942150992 2:173075967-173075989 GGGGCGTGAGCAGCAGCCGGGGG - Exonic
942748648 2:179264410-179264432 TGGGCCGGTGCAGTCGGCGGCGG - Intronic
945107797 2:206332424-206332446 TGGGCCTGTGCAAGTGCCTGAGG - Intergenic
949009910 2:241672471-241672493 AGGGCCTGTGCATCCGCACGCGG + Exonic
1168756847 20:324448-324470 TGGGCGTGTGCCGCCCCTGGGGG - Intergenic
1168913262 20:1466853-1466875 TGGGCCTGTGCGGCGGCCGCCGG - Exonic
1174459422 20:50672266-50672288 TGGTCCTTTGCAGCCCCAGGAGG - Intronic
1176109949 20:63406613-63406635 TGGGCCAGTGGACCCGCCCGCGG - Exonic
1176220559 20:63967572-63967594 TGGGCCTGTGCAGCCGCCGGTGG - Intronic
1180074233 21:45454696-45454718 TGTGCCTGGGCAGCTGGCGGGGG + Intronic
1180219003 21:46346214-46346236 TGAGCCTGTGCAGGCCCCGCCGG - Intronic
1181949112 22:26541502-26541524 CGGGCCTGCGGAGCCCCCGGGGG - Exonic
1184536950 22:45093991-45094013 TTGGCCTCTGCAGCCTCAGGGGG - Intergenic
1184559221 22:45252031-45252053 TGGGGCTGTGCTGCCTCCAGAGG + Intergenic
1184728242 22:46358347-46358369 AGGGCCTGTGCATCGGCCAGTGG + Intergenic
1185285542 22:49998191-49998213 TGAGCCTGTGCTGGCGCCCGGGG - Exonic
950200161 3:11036912-11036934 TGGTCCTGAGCAGCCCCAGGCGG + Exonic
950420980 3:12899346-12899368 TCCGCCTGGGCAGGCGCCGGGGG + Exonic
950726132 3:14918249-14918271 TGGGACAGTGGAGCCGCAGGCGG + Intronic
953407285 3:42665693-42665715 TGGGCCTGTGCACCGGTGGGTGG + Exonic
954372103 3:50174368-50174390 TGGCCCTGTGCTGCCCCCGCTGG + Intronic
956681393 3:71785061-71785083 CGGGACTGGGCGGCCGCCGGAGG + Exonic
961666858 3:128497979-128498001 TGCGCTTGGGCAGCAGCCGGGGG - Intergenic
961827275 3:129605753-129605775 TAGGACTGTGCACCCGGCGGCGG + Exonic
962012183 3:131402492-131402514 TGGGCATGTGCAGCAGGCAGAGG - Intergenic
962108391 3:132417201-132417223 TGGTCATGGGCACCCGCCGGAGG + Intergenic
962244836 3:133783976-133783998 TGGCCCTCTGCACCCGCTGGTGG - Intergenic
967884142 3:194321979-194322001 TGGGCTTGAGCAGCCGTGGGAGG + Intergenic
968353578 3:198081611-198081633 CGCCCCTGTGCAGCCGCCGCCGG + Intergenic
968505390 4:968865-968887 TGCGCTTGTGGAGCCCCCGGGGG + Exonic
968582174 4:1400303-1400325 TGGGCCTGTGCTGCAGGCAGAGG - Intergenic
968820057 4:2843681-2843703 TGGGCCTCCGCAGGCCCCGGCGG + Intergenic
969049663 4:4363707-4363729 TGTGCCTGCTCAGCCGCCAGAGG + Intronic
969366201 4:6695744-6695766 TGGGCTTCAGCAGCCTCCGGAGG - Intronic
969882260 4:10184673-10184695 TGGGGCTGTGCTCCTGCCGGAGG + Intergenic
981049893 4:140299451-140299473 TGGGACTGTTCAGCTGCCAGTGG + Intronic
981748568 4:148072998-148073020 GAGGCCTGTGCAGCCACTGGAGG - Intergenic
987317789 5:16740232-16740254 TGGTCCTTTGTAGCCGCTGGGGG + Intronic
988944191 5:36178690-36178712 TTTGCCTGTGCAGCCCCCTGGGG + Intronic
990308592 5:54517729-54517751 TGGGCCGCCGCAGCCGCCGCCGG - Intergenic
992939698 5:81750609-81750631 GGGACCTGGGGAGCCGCCGGGGG - Intronic
997825073 5:137098913-137098935 GGGGACTGAGCAGCAGCCGGAGG - Intronic
1001826840 5:174751859-174751881 GGGGCCTGTGCACCTGACGGCGG - Intergenic
1002045135 5:176537225-176537247 TGGGTCTGCGCGGCAGCCGGCGG + Exonic
1002322014 5:178381959-178381981 TTGGCCTGTGCCCCCTCCGGTGG + Intronic
1007428058 6:41759873-41759895 TGGGGCTGAGCAGCCTCCAGAGG + Intergenic
1018384120 6:163287470-163287492 GGGGCCTGGGCAGCCTCCGCAGG - Intronic
1023864214 7:44231226-44231248 TGGGGCCCTGCAGCCGCCAGAGG - Intronic
1025281101 7:57626916-57626938 AGGGCCTGGGCAGCCACCTGTGG - Intergenic
1025303628 7:57838591-57838613 AGGGCCTGGGCAGCCACCTGTGG + Intergenic
1025777367 7:64570544-64570566 CGGGCCGGTGCAGCCGCAGGCGG - Intergenic
1026974142 7:74486334-74486356 TGTGCCTGAGCAGCTGCCTGCGG - Intronic
1029236814 7:99126957-99126979 TGGGTCTGAGCAGGGGCCGGGGG + Intronic
1029338031 7:99919129-99919151 CGGGCCTGTGCGGCCGCCACTGG - Exonic
1029425826 7:100493628-100493650 TGGGGCTGTGCCGCGGGCGGGGG - Exonic
1029595007 7:101533164-101533186 TGGGCCTGGGGAGCTGCCTGGGG + Intronic
1032241476 7:130162517-130162539 TGGGCCTGGACAGCCGCAGCAGG - Intergenic
1034737679 7:153444072-153444094 TGGGCCAATGCAGCTGCCTGGGG + Intergenic
1034958822 7:155351675-155351697 TGGGGCTGTGCAGACCCAGGAGG - Intergenic
1035237518 7:157508552-157508574 TGGGCCTGGGCAGGAGCCCGAGG - Intergenic
1037434146 8:18845350-18845372 TGGGACAGTGCAGCCGCCAAAGG - Intronic
1037841510 8:22248519-22248541 TATGCCTGTGCAGCTGCCGCTGG + Exonic
1040076956 8:43246596-43246618 CGCCCCTGTGCAGCCGCCGCCGG - Intergenic
1040077039 8:43246925-43246947 CGCCCCTGTGCAGCCGCCGTCGG - Intergenic
1043502862 8:80873994-80874016 CCAGCCTGGGCAGCCGCCGGGGG - Intronic
1049482756 8:142834747-142834769 CGGGGCTGTGCGGCCGGCGGAGG + Intronic
1049538607 8:143194721-143194743 AGGGCCAGTGCAGGGGCCGGGGG + Intergenic
1052872732 9:33523965-33523987 TGCCCCGGTGCAGCCGCCGCCGG - Intergenic
1053503410 9:38620895-38620917 TGTCCCGGTGCAGCCGCCGCCGG + Intergenic
1053503574 9:38621524-38621546 CGCCCCTGTGCAGCCGCCGCCGG + Intergenic
1053669479 9:40346183-40346205 TGGCCCTGGGCAGTTGCCGGCGG + Intergenic
1054380611 9:64486203-64486225 TGGCCCTGGGCAGTTGCCGGCGG + Intergenic
1054515135 9:66030108-66030130 TGGCCCTGGGCAGTTGCCGGCGG - Intergenic
1057099231 9:92341679-92341701 TGGGCCTGGGCAGCCGCCCCAGG + Intronic
1057152553 9:92808373-92808395 CGTCCCTGTGCAGCCGCCGCGGG - Intergenic
1057152641 9:92808698-92808720 TGCCCCTGTGCAGCCGCCGCAGG - Intergenic
1057390677 9:94639511-94639533 TGGGCCAGGCCAGGCGCCGGCGG + Intronic
1057684722 9:97221861-97221883 TGCCCCGGTGCAGCCGCCGCGGG + Intergenic
1057684889 9:97222478-97222500 TGCTCCTGTGCAGCCGCCGCTGG + Intergenic
1058412459 9:104748220-104748242 TGGCGCTGTGGAGCCGCGGGTGG + Intronic
1061201125 9:129139112-129139134 GAGGCCTGGCCAGCCGCCGGGGG - Intronic
1061601964 9:131676224-131676246 TGGGCATGGGCAGCCGCTGGGGG + Intronic
1062395516 9:136351145-136351167 TGGGCTTGGGCAGCCTCGGGGGG - Intronic
1062457624 9:136646920-136646942 TAGGCCTGTGCAGGAGTCGGGGG - Intergenic
1062488151 9:136791328-136791350 CGGGCCTGCGCAGGCGCAGGCGG - Intergenic
1062592191 9:137279253-137279275 TGGGCCCGTGCAGCGCCAGGAGG - Exonic
1062634722 9:137484807-137484829 TGCTCCTGTGCAGCCTCGGGGGG - Intronic
1202800565 9_KI270719v1_random:170878-170900 TGCCCCGGTGCAGCCGCCGCCGG - Intergenic
1185751019 X:2609532-2609554 TGGGCCTGGGGATCCGCCTGGGG + Intergenic
1197262456 X:124333374-124333396 TGGGCCAGTGGAGCGGCCTGGGG - Intronic
1197932582 X:131711030-131711052 TGGGCCTGTTCAGCCTCCACTGG + Intergenic