ID: 1176220563

View in Genome Browser
Species Human (GRCh38)
Location 20:63967600-63967622
Sequence AGCACCGCTGTCCCAACACG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 39}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176220556_1176220563 12 Left 1176220556 20:63967565-63967587 CCGCCTACCACCGGCGGCTGCAC 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1176220563 20:63967600-63967622 AGCACCGCTGTCCCAACACGAGG 0: 1
1: 0
2: 0
3: 3
4: 39
1176220560_1176220563 2 Left 1176220560 20:63967575-63967597 CCGGCGGCTGCACAGGCCCACAG 0: 1
1: 0
2: 0
3: 19
4: 258
Right 1176220563 20:63967600-63967622 AGCACCGCTGTCCCAACACGAGG 0: 1
1: 0
2: 0
3: 3
4: 39
1176220559_1176220563 5 Left 1176220559 20:63967572-63967594 CCACCGGCGGCTGCACAGGCCCA 0: 1
1: 0
2: 2
3: 20
4: 188
Right 1176220563 20:63967600-63967622 AGCACCGCTGTCCCAACACGAGG 0: 1
1: 0
2: 0
3: 3
4: 39
1176220557_1176220563 9 Left 1176220557 20:63967568-63967590 CCTACCACCGGCGGCTGCACAGG 0: 1
1: 0
2: 0
3: 12
4: 123
Right 1176220563 20:63967600-63967622 AGCACCGCTGTCCCAACACGAGG 0: 1
1: 0
2: 0
3: 3
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176220563 Original CRISPR AGCACCGCTGTCCCAACACG AGG Intronic
920386114 1:205570993-205571015 AGCACTGCTTACCCAACAGGGGG + Intronic
1063126017 10:3137312-3137334 AGAAACGCTGTCCCTACAGGAGG - Intronic
1067917670 10:50418273-50418295 AGCGCCGCTGTCCTAGCACCAGG - Intronic
1084545812 11:69814586-69814608 AGGAGTGCTGTCCCACCACGGGG - Intronic
1084548171 11:69824900-69824922 CGCACCCCAGTCCCAACACCAGG + Intergenic
1091410696 12:237347-237369 AGCTCCACTGTCCCAGGACGGGG - Intronic
1102445857 12:113002332-113002354 AGCACAGCTGTGCCAAAACCTGG + Intronic
1104847554 12:131854258-131854280 AGAACCGAGGTCCCATCACGAGG - Intergenic
1121440745 14:93947589-93947611 AGCACAGCAGGCCCACCACGCGG - Intronic
1124466836 15:29947891-29947913 AGCACAGCTGTGCCAACCCTGGG + Intronic
1129230209 15:74192853-74192875 TGCACCACAGTCCCAACACCCGG + Intronic
1137622546 16:49885637-49885659 TGCACCACTGTCCCAGCATGTGG - Intergenic
1143561148 17:7695956-7695978 ACCACTGCTTCCCCAACACGTGG - Intronic
1152161871 17:78673987-78674009 AGCACCCCTTTCCCACCTCGAGG + Intergenic
1158480666 18:57818770-57818792 AGCACTGCTGCCCCACCACCAGG + Intergenic
1158512751 18:58106150-58106172 AGCACGGATGTCCCTACACAGGG - Intronic
1167579519 19:50333319-50333341 AGCACCGCTCCCCCAACCCAGGG + Intronic
1167583026 19:50357705-50357727 AGCACCGCTCCCCGAACCCGGGG + Intronic
935121846 2:100189966-100189988 AGCAGTGCTGTCCCAACAGGTGG + Intergenic
937292074 2:120787748-120787770 AGCACCGCTGACCCAGCAGAGGG - Intronic
941413280 2:165186958-165186980 AGCACCCCTGTCCCAACCCTAGG - Intronic
1172222210 20:33281741-33281763 AGCTTTGCTGTCCCAGCACGTGG + Intronic
1174237167 20:49103329-49103351 AGCACCTCTGGCCCATCCCGTGG - Intergenic
1175771556 20:61627670-61627692 GGCACTGCTGTCCCAACCAGGGG - Intronic
1176220563 20:63967600-63967622 AGCACCGCTGTCCCAACACGAGG + Intronic
956725422 3:72152731-72152753 AGAACCGGTGTCCCAGCACCAGG + Intergenic
969618012 4:8265022-8265044 TGCACTGCTGTCCCCACCCGTGG + Intergenic
972342267 4:38162613-38162635 AGCACCTCTGTCCCTTCAGGTGG + Intergenic
979159290 4:117438461-117438483 AGTACAGCTCTCCCAACACCTGG + Intergenic
984749382 4:183256974-183256996 AGCACCTCTTTCCCACCACCAGG - Intronic
1001288129 5:170438349-170438371 TGCCCTGCTGTCCCCACACGAGG - Intronic
1006374579 6:33664890-33664912 GGCACCTCTGCACCAACACGTGG + Exonic
1010320588 6:74504531-74504553 ATCACCCCTCTCCCAACACCAGG + Intergenic
1026498295 7:70921994-70922016 AGCACTGCGGTTCCAACACACGG - Intergenic
1032359797 7:131244748-131244770 AGGACCCCTGTGCCAACACAGGG - Intronic
1034335976 7:150323632-150323654 GGCACCGCTGGCCCAGCAGGTGG - Intronic
1034548504 7:151805100-151805122 AGCACAGCTGCCCCAACTCAAGG - Intronic
1036445700 8:8820260-8820282 AGCACAGCAGTCCCAACCCTGGG - Intronic
1040491330 8:47925006-47925028 CAGACAGCTGTCCCAACACGTGG + Intronic
1041548075 8:59069068-59069090 AGCACTGCTGTCCCAACTCCTGG - Intronic
1057168840 9:92948789-92948811 ACCACCCCTGCCCCAACACAAGG - Intronic
1061284294 9:129613437-129613459 GCCAGCGCAGTCCCAACACGAGG + Exonic
1187836318 X:23435632-23435654 ATCACCACTGTCCCAACTCCAGG + Intergenic