ID: 1176220795

View in Genome Browser
Species Human (GRCh38)
Location 20:63968623-63968645
Sequence TAGGATAGTTCAGCCGGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 38}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176220795_1176220801 16 Left 1176220795 20:63968623-63968645 CCTGTGCCGGCTGAACTATCCTA 0: 1
1: 0
2: 0
3: 7
4: 38
Right 1176220801 20:63968662-63968684 GACTTGTCTCCAGGCTTGGCAGG 0: 1
1: 0
2: 1
3: 11
4: 175
1176220795_1176220799 7 Left 1176220795 20:63968623-63968645 CCTGTGCCGGCTGAACTATCCTA 0: 1
1: 0
2: 0
3: 7
4: 38
Right 1176220799 20:63968653-63968675 CTCTTCGCAGACTTGTCTCCAGG 0: 1
1: 0
2: 1
3: 9
4: 143
1176220795_1176220800 12 Left 1176220795 20:63968623-63968645 CCTGTGCCGGCTGAACTATCCTA 0: 1
1: 0
2: 0
3: 7
4: 38
Right 1176220800 20:63968658-63968680 CGCAGACTTGTCTCCAGGCTTGG 0: 1
1: 0
2: 1
3: 11
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176220795 Original CRISPR TAGGATAGTTCAGCCGGCAC AGG (reversed) Intronic
905537515 1:38734707-38734729 TAGGCTAGTTCAGTTGGCTCTGG - Intergenic
913561349 1:120023514-120023536 TAGTATGGTTCAGCCTGCACTGG - Intronic
913636778 1:120770088-120770110 TAGTATGGTTCAGCCTGCACTGG + Intergenic
913717277 1:121549085-121549107 TAAGATATTTCTGCGGGCACTGG + Intergenic
914281933 1:146182923-146182945 TAGTATGGTTCAGCCTGCACTGG - Intronic
914513991 1:148358006-148358028 TAGGATAGTTTGGCAGGCAAGGG - Intergenic
914542962 1:148633630-148633652 TAGTATGGTTCAGCCTGCACTGG - Intronic
914623659 1:149437382-149437404 TAGTATGGTTCAGCCTGCACTGG + Intergenic
921493778 1:215811586-215811608 TAGGATAGTGCAGTAGGCATAGG - Intronic
922154953 1:223033771-223033793 AAGGATAGTTTGGCAGGCACAGG + Intergenic
924050100 1:240071881-240071903 AAGGATAGTTCAACAGGCAAGGG + Intronic
924695726 1:246397777-246397799 AAGGATAATTCAGCAGGCAGGGG + Intronic
1066245069 10:33574783-33574805 TAGTATAATTCAGCCCTCACAGG - Intergenic
1070941455 10:80351868-80351890 TAGGAGAGTTCAGAGGGGACTGG - Intronic
1077402980 11:2368123-2368145 TAGGGTAGCTCAGCCAGCTCTGG + Intergenic
1085039202 11:73317160-73317182 TAGGAGAGTGGAGCCGCCACAGG + Intronic
1085039986 11:73321311-73321333 CAGGATAGCTCAGCCCACACGGG + Intronic
1088584912 11:111353709-111353731 TAAGATGGTTCAGCAGGCACTGG + Exonic
1106347766 13:28895896-28895918 TAGGATATTTCCACCGGCTCAGG + Intronic
1116050998 14:39803017-39803039 TAGCATACCTCAGCCGGCCCAGG + Intergenic
1120036014 14:79699335-79699357 AAGGATAGTTCTGTCTGCACAGG + Intronic
1125729966 15:41887611-41887633 GAGGAGAGTTCATTCGGCACAGG + Intronic
1129693785 15:77729113-77729135 TAGGAGGGCCCAGCCGGCACTGG + Intronic
1143297024 17:5878732-5878754 TAGGATGGTTCCGACGGCCCAGG + Intronic
1152117268 17:78396198-78396220 TAGGATAGTTCAGCTTGGAGTGG + Intronic
1157285832 18:46376633-46376655 GAAGTTAGTTCAGCCAGCACTGG + Intronic
1165396162 19:35564795-35564817 AATGATAGTTCTGCCTGCACAGG - Intergenic
945491142 2:210456726-210456748 TAGGAGAGTTCAGGCAGCAATGG - Intronic
948021335 2:234736239-234736261 CAGGATAGGTCAGCTGGCAGAGG - Intergenic
1170676831 20:18489971-18489993 TAGGATACTTCACCCGCCCCTGG - Exonic
1176220795 20:63968623-63968645 TAGGATAGTTCAGCCGGCACAGG - Intronic
1182469568 22:30539852-30539874 TAGGACAGTTCAGCTGGCCCTGG + Intronic
1184359986 22:44010372-44010394 TAGGACAGTGCAGCCGCCCCAGG - Intronic
950123714 3:10498633-10498655 TAGAGTAGCCCAGCCGGCACAGG + Intronic
965732968 3:171792168-171792190 TAGGACAGTTCACTAGGCACTGG - Intronic
981581866 4:146257507-146257529 TAGGGTAGTTCAGCCAGTGCTGG - Intronic
989961284 5:50418697-50418719 TAAGATATTTCTGCAGGCACTGG - Intronic
991455376 5:66797883-66797905 TAGGATAGTTGAGAAGGCAGAGG + Intronic
997348337 5:133210261-133210283 TAGGACAGCTTAGCCGGCAGAGG + Exonic
1005795842 6:29360523-29360545 GAGGAGAGTCCAGCTGGCACTGG + Intronic
1012060507 6:94472944-94472966 TAGTTTAGTTCAGCCAGCCCAGG + Intergenic
1034974451 7:155439705-155439727 GAGGAGAGTTCAGCGGGAACAGG - Intergenic
1044514436 8:93121834-93121856 TAGGATAATTCATCCCGCAATGG + Intergenic
1045860649 8:106811853-106811875 TTGGATACTGCAGCAGGCACTGG - Intergenic
1050070011 9:1800671-1800693 CAGGATAGTGCAGCCTGCCCTGG + Intergenic
1199655859 X:149994872-149994894 TAGGCTAGTTCAGTCAGAACTGG + Intergenic