ID: 1176221954

View in Genome Browser
Species Human (GRCh38)
Location 20:63973976-63973998
Sequence GCTCAAGTCACGCCTGTGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 76}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176221954_1176221960 0 Left 1176221954 20:63973976-63973998 CCGCCCACAGGCGTGACTTGAGC 0: 1
1: 0
2: 0
3: 6
4: 76
Right 1176221960 20:63973999-63974021 CCTGTTTCCAGCCTCTGCGCGGG 0: 1
1: 0
2: 0
3: 19
4: 181
1176221954_1176221958 -1 Left 1176221954 20:63973976-63973998 CCGCCCACAGGCGTGACTTGAGC 0: 1
1: 0
2: 0
3: 6
4: 76
Right 1176221958 20:63973998-63974020 CCCTGTTTCCAGCCTCTGCGCGG 0: 1
1: 0
2: 3
3: 22
4: 387
1176221954_1176221965 23 Left 1176221954 20:63973976-63973998 CCGCCCACAGGCGTGACTTGAGC 0: 1
1: 0
2: 0
3: 6
4: 76
Right 1176221965 20:63974022-63974044 GTTGCCCAGACGCCCCTCCAGGG 0: 1
1: 0
2: 1
3: 6
4: 132
1176221954_1176221961 1 Left 1176221954 20:63973976-63973998 CCGCCCACAGGCGTGACTTGAGC 0: 1
1: 0
2: 0
3: 6
4: 76
Right 1176221961 20:63974000-63974022 CTGTTTCCAGCCTCTGCGCGGGG 0: 1
1: 0
2: 0
3: 9
4: 143
1176221954_1176221964 22 Left 1176221954 20:63973976-63973998 CCGCCCACAGGCGTGACTTGAGC 0: 1
1: 0
2: 0
3: 6
4: 76
Right 1176221964 20:63974021-63974043 GGTTGCCCAGACGCCCCTCCAGG 0: 1
1: 0
2: 1
3: 10
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176221954 Original CRISPR GCTCAAGTCACGCCTGTGGG CGG (reversed) Intronic
900675790 1:3885152-3885174 GCTCATGTCAGCCGTGTGGGTGG + Exonic
900966605 1:5962992-5963014 GCTCAAGTCCCAGCTGTGGCCGG + Intronic
901133849 1:6980174-6980196 GCTGAAGTCTCGCCTGTTGGGGG + Intronic
902668515 1:17955799-17955821 GCACAAGTCAGGCCTGAGTGTGG - Intergenic
902979529 1:20113093-20113115 GCTCAATTCATGCCTGTGAATGG - Exonic
904832987 1:33317040-33317062 GCTCAAGTCTCGCTTGTGTAAGG - Intronic
918229497 1:182515105-182515127 GCTGCAGTGACACCTGTGGGTGG - Intronic
920185712 1:204158025-204158047 GCTCGAGTGATGCCTGTAGGTGG - Intronic
920229925 1:204463487-204463509 GCTGGAGGCACGCCTTTGGGAGG + Intronic
920706975 1:208258631-208258653 TCTAAAGTCCTGCCTGTGGGTGG + Intergenic
1066726674 10:38402573-38402595 GCTCAAGTGAGGCGAGTGGGCGG + Intergenic
1070627811 10:78063609-78063631 GGTGAAGTCTCCCCTGTGGGAGG + Intergenic
1071197453 10:83177662-83177684 CCTCAATTCATGCCTATGGGGGG + Intergenic
1071993830 10:91127565-91127587 GCACAAGGCACTCCTCTGGGTGG + Intergenic
1074211418 10:111338886-111338908 GCTCACTTCAGGCCTGTGGGCGG + Intergenic
1075921635 10:126218259-126218281 GCCCAAGTTACGCCTGTTGTCGG - Intronic
1088503640 11:110508191-110508213 GCTGCAGTCACACCTGTGTGAGG + Intergenic
1089386429 11:118071186-118071208 CCTCAAGTCAGGCATGTGGAAGG + Intergenic
1095818967 12:46455999-46456021 GCTCAAGTCAGGCTTGGGAGAGG + Intergenic
1100349496 12:93765648-93765670 ACTCCAGTCACACCTGTGGATGG + Intronic
1101725245 12:107383286-107383308 GCTAAACTCAGGGCTGTGGGTGG - Intronic
1105006018 12:132721063-132721085 GCACAAGTCAGGCCTGTTGTGGG + Exonic
1115561880 14:34589852-34589874 GCTCATGTCAGCCCTTTGGGAGG + Intronic
1119635712 14:76271568-76271590 GAGAAAGTCACGCCTGGGGGTGG - Intergenic
1122861577 14:104584969-104584991 GTTCAGGGCAGGCCTGTGGGAGG - Intronic
1128389628 15:67174306-67174328 GCTGAAGTCATGCCAGTGGATGG + Intronic
1134019087 16:10909019-10909041 GCTCAAGGCAGCCCTGTGGAGGG - Exonic
1137467184 16:48720472-48720494 GCTCCAGGCCTGCCTGTGGGAGG + Intergenic
1137585143 16:49659806-49659828 GCTGACGGCACCCCTGTGGGTGG + Intronic
1143652216 17:8270369-8270391 GCTCAAGCCACGCATGTGTGAGG + Exonic
1147458342 17:40552670-40552692 GCAGAAGTCACGGCTCTGGGTGG + Intergenic
1151358764 17:73576001-73576023 GCAAAAGACACGCCTGTGGTGGG + Intronic
1153605079 18:6824943-6824965 GCTGAGGTCACACCTGTGGATGG + Intronic
1158389719 18:57035136-57035158 ACCCAAGTCACTCCAGTGGGGGG - Exonic
1159746524 18:72242922-72242944 GCTCTTGTGATGCCTGTGGGAGG + Intergenic
1160586668 18:79917103-79917125 GCTCCAGAAACGCCTGTGGAAGG - Intronic
1161120055 19:2520757-2520779 GTTCAGGTCAGGCCTCTGGGTGG + Intronic
1163289141 19:16367432-16367454 GCTAAAGTCAGTCCTGTGTGTGG - Intronic
1163760319 19:19132902-19132924 GCTCTAGCCAGTCCTGTGGGTGG - Intronic
1164127374 19:22330846-22330868 GCTAACATCACGCCTGTGGCTGG + Intergenic
1166819448 19:45568570-45568592 GATCAAGCCAGGTCTGTGGGAGG - Intronic
943387614 2:187222053-187222075 TCTCAAGTAAGGCCTGAGGGTGG - Intergenic
945757095 2:213860105-213860127 GTTCAAATCACTCCTGTGGGAGG - Intronic
1168764689 20:373701-373723 GCTCTTCTCATGCCTGTGGGTGG - Intronic
1172363882 20:34334124-34334146 GATAAAGACAAGCCTGTGGGTGG + Intergenic
1176194018 20:63828772-63828794 GCACCAGTCACGGCAGTGGGAGG + Intronic
1176221954 20:63973976-63973998 GCTCAAGTCACGCCTGTGGGCGG - Intronic
1179156772 21:38857825-38857847 CCTCAAGTCACCCCTGATGGAGG + Intergenic
1179947223 21:44686529-44686551 GCTCAGGTCGGGCCTGTGTGTGG + Intronic
953405099 3:42656060-42656082 GCTGAAGCCAGGCCTGTTGGGGG - Intronic
956084452 3:65595515-65595537 GCTCTAGTCTCCCCTGGGGGTGG + Intronic
961522316 3:127473813-127473835 GCTCAGGTCCCTCCTGTGTGGGG - Intergenic
968431060 4:559273-559295 GGTCACCTCACGCCTGTGGCTGG - Intergenic
968483052 4:845307-845329 GCTCCACCCAGGCCTGTGGGTGG + Intergenic
969202769 4:5618820-5618842 GCTCAAGGAATGCCTGTGGCAGG - Intronic
969265675 4:6062708-6062730 ACTCAAGTGATTCCTGTGGGTGG - Intronic
996804404 5:127438630-127438652 GCTCCAGTCACGCATGCGGAGGG - Intronic
998332505 5:141341128-141341150 GCACAAGTCACGCCTGCTGCAGG + Exonic
998333061 5:141346190-141346212 GCACAAGTCACGCCTGCTGCAGG + Exonic
998336470 5:141376240-141376262 GCACAAGTCACGCCTGCTGCAGG + Exonic
998337408 5:141385056-141385078 GCACAAGTCACGCCTGCTGCAGG + Exonic
998340756 5:141415344-141415366 GCACAAGTCACGCCTGCTGCAGG + Exonic
998342841 5:141432916-141432938 GCACAAGTCACGCCTGCTGCAGG + Exonic
1001251614 5:170151449-170151471 GCCCCAGTCACCCCTGGGGGAGG + Intergenic
1001282331 5:170395701-170395723 GCTCAAGTCAGGCCTGGGACAGG - Intronic
1002276423 5:178107114-178107136 GCCCCAGTCACCCCTGGGGGTGG + Intergenic
1002427354 5:179184138-179184160 GCTGCAGTCTGGCCTGTGGGAGG - Intronic
1004273207 6:14212796-14212818 GCTCACCTCGCCCCTGTGGGGGG - Intergenic
1010846669 6:80717721-80717743 GGTCCGGTCACGCCTGTGGTAGG + Intergenic
1018800919 6:167221744-167221766 GCTCACGTCACCCCCGTGGCTGG + Intergenic
1019180106 6:170181364-170181386 GCTCAAGGGAAGCCTGAGGGAGG - Intergenic
1028121406 7:87059688-87059710 GCTCCCGTCACGCCGGAGGGAGG + Exonic
1029798305 7:102919038-102919060 GCTCCAGTGACCACTGTGGGAGG - Intronic
1032986229 7:137340606-137340628 GGTCATGTCACTGCTGTGGGAGG - Intronic
1034498243 7:151434353-151434375 GCCCAAGTCATGCCTTTGCGTGG - Intronic
1034951123 7:155297768-155297790 GCTCAGGCCACGCCCCTGGGCGG + Exonic
1055665166 9:78545769-78545791 CCTCAAGTCTTGCCTGTGGTGGG + Intergenic
1056376212 9:86014664-86014686 TCTGAAGTCACTGCTGTGGGAGG + Intronic
1058674653 9:107389940-107389962 GGTCAAGTCAGGCCTGTGCAGGG + Intergenic
1061050423 9:128191664-128191686 GCACAAGTCACGCTGGGGGGCGG + Intronic
1062614282 9:137388998-137389020 TCTCAGGACACGCCTGCGGGAGG - Intronic
1187339711 X:18410208-18410230 GCTCATGTTACACCTGTGGGAGG + Intergenic
1189880512 X:45486860-45486882 GCTCAAGTCACTCCTCTGGAAGG + Intergenic