ID: 1176222784

View in Genome Browser
Species Human (GRCh38)
Location 20:63978046-63978068
Sequence GTCCCGGGCTGCAGGCCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 344
Summary {0: 1, 1: 1, 2: 5, 3: 31, 4: 306}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176222784_1176222796 18 Left 1176222784 20:63978046-63978068 CCACAGGGCCTGCAGCCCGGGAC 0: 1
1: 1
2: 5
3: 31
4: 306
Right 1176222796 20:63978087-63978109 GGTGGGTACCCATTGGATATGGG 0: 1
1: 0
2: 0
3: 6
4: 66
1176222784_1176222790 0 Left 1176222784 20:63978046-63978068 CCACAGGGCCTGCAGCCCGGGAC 0: 1
1: 1
2: 5
3: 31
4: 306
Right 1176222790 20:63978069-63978091 AACACCGGCCATGTGAATGGTGG 0: 1
1: 0
2: 1
3: 5
4: 85
1176222784_1176222797 21 Left 1176222784 20:63978046-63978068 CCACAGGGCCTGCAGCCCGGGAC 0: 1
1: 1
2: 5
3: 31
4: 306
Right 1176222797 20:63978090-63978112 GGGTACCCATTGGATATGGGCGG No data
1176222784_1176222798 22 Left 1176222784 20:63978046-63978068 CCACAGGGCCTGCAGCCCGGGAC 0: 1
1: 1
2: 5
3: 31
4: 306
Right 1176222798 20:63978091-63978113 GGTACCCATTGGATATGGGCGGG 0: 1
1: 0
2: 1
3: 8
4: 94
1176222784_1176222789 -3 Left 1176222784 20:63978046-63978068 CCACAGGGCCTGCAGCCCGGGAC 0: 1
1: 1
2: 5
3: 31
4: 306
Right 1176222789 20:63978066-63978088 GACAACACCGGCCATGTGAATGG 0: 1
1: 0
2: 0
3: 6
4: 71
1176222784_1176222794 11 Left 1176222784 20:63978046-63978068 CCACAGGGCCTGCAGCCCGGGAC 0: 1
1: 1
2: 5
3: 31
4: 306
Right 1176222794 20:63978080-63978102 TGTGAATGGTGGGTACCCATTGG 0: 1
1: 0
2: 3
3: 12
4: 89
1176222784_1176222791 1 Left 1176222784 20:63978046-63978068 CCACAGGGCCTGCAGCCCGGGAC 0: 1
1: 1
2: 5
3: 31
4: 306
Right 1176222791 20:63978070-63978092 ACACCGGCCATGTGAATGGTGGG 0: 1
1: 0
2: 0
3: 3
4: 50
1176222784_1176222795 17 Left 1176222784 20:63978046-63978068 CCACAGGGCCTGCAGCCCGGGAC 0: 1
1: 1
2: 5
3: 31
4: 306
Right 1176222795 20:63978086-63978108 TGGTGGGTACCCATTGGATATGG 0: 1
1: 0
2: 1
3: 3
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176222784 Original CRISPR GTCCCGGGCTGCAGGCCCTG TGG (reversed) Intronic
900181061 1:1311189-1311211 GCCCAGGGCTGCAGTCCCTCAGG + Intronic
900350658 1:2233059-2233081 GTCCCAGGCAGCAGGCCAAGCGG - Intronic
900405476 1:2491049-2491071 GTGGCTGCCTGCAGGCCCTGAGG + Intronic
900456571 1:2777818-2777840 GTCCAGGGCCGCAGGACCAGAGG - Intronic
900996843 1:6127544-6127566 GGGCCGAGATGCAGGCCCTGAGG + Intronic
901069058 1:6508231-6508253 ATCCAGGGCTGCAGCCCCTCAGG - Intronic
901228502 1:7628975-7628997 GGCCAGGGCTGCATGCCCTGAGG + Intronic
902290889 1:15433893-15433915 GTCATGGGCTCCAGGCCCTGTGG - Intergenic
902414371 1:16230287-16230309 GAGCCGGCCTGCAGGCTCTGAGG + Intergenic
902540166 1:17149067-17149089 GTCCAGCTCTGCTGGCCCTGGGG + Intergenic
903658705 1:24964162-24964184 GGCTGGGGCTGCAGGCCCTGGGG + Intronic
903815429 1:26061008-26061030 GGCCAGGGCTGCTGTCCCTGTGG + Intronic
903954080 1:27012840-27012862 GCCGCGGGCTGCAGGCGCTAGGG - Intergenic
904015081 1:27413558-27413580 CTCCAGGGCTCCAGGCCTTGGGG - Intronic
905522735 1:38612933-38612955 GGCCCAGGCTGCAGGCGCTGTGG + Intergenic
906551195 1:46667986-46668008 GGCCCGGGCTGCTGGGCCTTAGG - Intronic
906551751 1:46671336-46671358 TTCCCAGGCCCCAGGCCCTGTGG - Intronic
906845783 1:49190307-49190329 GCCCAGACCTGCAGGCCCTGAGG - Intronic
907518874 1:55010471-55010493 GGCCCAGGGTGCAGGCTCTGAGG - Exonic
908433558 1:64082562-64082584 GTCCCCAGCTGCAGCCCCTTGGG + Intronic
908473785 1:64470014-64470036 GTCCCGGGGGGCAGGTTCTGAGG + Intergenic
910232156 1:84997673-84997695 GACCCGGGCGGTGGGCCCTGCGG + Intergenic
910676543 1:89821544-89821566 GCCCCGGGCGGCCGGCCCTGCGG + Intronic
912811961 1:112801739-112801761 GTCCTGGGCTGCAGGCCTGGGGG + Intergenic
913104178 1:115596268-115596290 TTCCTGGGCTCCAGACCCTGAGG + Intergenic
913280710 1:117182488-117182510 TTTCCCGGCTGCAGCCCCTGCGG + Intronic
915637055 1:157194847-157194869 CTCCAGGGCGGCAGGCCCCGGGG - Intergenic
916454127 1:164953085-164953107 TGCCTGGGCTGCAGGCTCTGGGG + Intergenic
920066174 1:203271545-203271567 GACACGGGCTGCAGGAACTGTGG - Intronic
920244067 1:204574926-204574948 GCCCCGGCCAGCTGGCCCTGTGG + Intergenic
920565021 1:206966114-206966136 TTCCTGGACTGCAGGCCTTGAGG + Intronic
921148544 1:212381892-212381914 GTCCTGGCATGCAGGCCGTGTGG - Intronic
922003404 1:221503870-221503892 GGCCCTGGCTGCAGGTCTTGTGG - Intergenic
922154678 1:223031634-223031656 GTCCTGGGCTGGAAGCCCTAGGG + Intergenic
922795520 1:228337733-228337755 GTCCAGGCCTGGAGACCCTGGGG + Intronic
1065112971 10:22458161-22458183 GTCCCTTGCTGCGGGCCCTAGGG - Intergenic
1066654042 10:37682880-37682902 GTCCAGGCCTGGAGACCCTGAGG - Intergenic
1067170689 10:43903734-43903756 GGGCAGGGCTACAGGCCCTGCGG + Intergenic
1069865113 10:71497531-71497553 GACCCTGGCTGCTGGCTCTGCGG + Intronic
1070850443 10:79558575-79558597 GTCCTGGGATGGAGGCCCTGGGG - Intronic
1070856776 10:79612721-79612743 GTCCTGGGATGGAGGCCCTGGGG + Intronic
1074048849 10:109864683-109864705 CTCCAGGGCTGCTGGCTCTGTGG - Intergenic
1075031160 10:119025613-119025635 GGCCCGGGCTGGGGGCCATGTGG + Intergenic
1076499368 10:130924330-130924352 GCCCCAGGCCGCAGGACCTGGGG + Intergenic
1076729720 10:132432274-132432296 CTCCCGCCCTGCAGGCCCAGGGG + Intergenic
1076824745 10:132961187-132961209 GCCTCAGGCTGCAGGCCCTGTGG + Intergenic
1077026471 11:442105-442127 GTCCCAGGCTCCAGGGGCTGGGG - Intergenic
1077043500 11:534771-534793 GTGCCAGCCTGCAGGCCCCGCGG + Intronic
1077187581 11:1242279-1242301 GTCCCCGCCTGCAACCCCTGAGG - Exonic
1077190794 11:1255279-1255301 CTCGGGGGTTGCAGGCCCTGGGG + Intronic
1077322054 11:1947032-1947054 GGCCCGGGCTTCAGGCTGTGGGG + Intergenic
1077362539 11:2147111-2147133 GCCCCAGGCTGCTGGCCATGGGG - Intronic
1079710724 11:23679988-23680010 GGCCCGGGCTGCCAGTCCTGTGG - Intergenic
1081629891 11:44681821-44681843 GGCCCTAGCTGCAGGTCCTGAGG - Intergenic
1083747801 11:64745081-64745103 GTCCCGGGCGGCGGGGCCTCCGG - Intronic
1084437950 11:69155098-69155120 GTGCAGGGCAGCAGGGCCTGAGG + Intergenic
1084888381 11:72224673-72224695 GGCCCGGGCTGCGGGCCGAGCGG + Intronic
1085321273 11:75575491-75575513 GCCCCGTGCTGCAGGGACTGGGG - Intergenic
1085517832 11:77121763-77121785 GTCCCCAGCTCCAAGCCCTGTGG - Intronic
1085561056 11:77473496-77473518 GTCCCGGGCTGCCAGGGCTGGGG - Intronic
1088868947 11:113875393-113875415 GGGGCGGGCTCCAGGCCCTGAGG - Intronic
1089214984 11:116829850-116829872 CTCCAGGGCAGCAGGCACTGAGG - Intronic
1089398195 11:118149462-118149484 CTCCTGGGGTGCAGGCCCTGGGG + Intronic
1090085115 11:123643764-123643786 GACCAGGCCTGAAGGCCCTGGGG + Intronic
1090976539 11:131684623-131684645 GTCCCAGGCTGGAGGCCCTGCGG + Intronic
1091227693 11:133967417-133967439 CGCCCGGGCTACAGGCGCTGGGG + Intergenic
1091370267 11:135051606-135051628 GTCCTGGGCTTCCGCCCCTGAGG + Intergenic
1202805070 11_KI270721v1_random:2345-2367 GGCCCGGGCTTCAGGCTGTGGGG + Intergenic
1091417685 12:303508-303530 GTCCAGGGGTGCAGGCCTAGGGG + Intronic
1091752840 12:3033347-3033369 GTCCCTCGCTCCAGGCCCCGTGG - Intronic
1092290835 12:7158657-7158679 GGCCGGGGCTGCAGGACCTCAGG - Exonic
1093525853 12:20102671-20102693 GGCTGGGGCTGCATGCCCTGTGG - Intergenic
1095461192 12:42446087-42446109 TTCCGGGGCTGCAGGGGCTGCGG - Exonic
1096178687 12:49539159-49539181 ATCCCGGGCTCCAGGCCCCGCGG - Exonic
1096607480 12:52777045-52777067 CTCCCGGGCTGGAGGCTTTGGGG - Exonic
1096610176 12:52795799-52795821 CTCCCGGGCTGGAGGCTTTGGGG - Exonic
1100329172 12:93569690-93569712 GTCCCCGGCTGCAGACCCCAAGG + Intergenic
1102252518 12:111397162-111397184 GTCCCAGGCATCAGGCCCTGAGG - Intergenic
1102873791 12:116434336-116434358 ATGCCGGGCTCCAGGCCTTGCGG - Intergenic
1103914803 12:124370674-124370696 GTTCTGGGCTGGAGGCCTTGAGG + Intronic
1104639881 12:130460765-130460787 GTCCCCGGCGCCAGGCCCTGGGG - Intronic
1104682747 12:130762536-130762558 ATGCCAGGCTGGAGGCCCTGCGG + Intergenic
1104760280 12:131293992-131294014 ATCCAGGGCTGCAGGGGCTGGGG - Intergenic
1104857120 12:131907571-131907593 GGCCCTGGGTGCGGGCCCTGTGG - Intronic
1104900717 12:132188320-132188342 GTGCCGTTCTGCAGGCTCTGGGG - Intergenic
1104965733 12:132508092-132508114 GTCCTGGGCCCAAGGCCCTGGGG + Intronic
1105821976 13:24087914-24087936 CTCACTGGCTGCAGCCCCTGAGG + Intronic
1107695100 13:42992182-42992204 GTCCCGGGCCGCCGTCGCTGCGG + Exonic
1113138690 13:107122660-107122682 GTCCCGGAGTGCAGGCCATTTGG + Intergenic
1113938025 13:114005499-114005521 GTCCCAGGCTGAAGGCGCAGGGG + Intronic
1114371819 14:22097819-22097841 GTGCCAGGCTCCAGGCACTGTGG - Intergenic
1116811111 14:49540995-49541017 GTACAGGGCTGCAGGGCCTTGGG - Intergenic
1117548433 14:56811505-56811527 GCCCCGGGCTGCGAGCCCAGAGG + Intergenic
1118714419 14:68548901-68548923 GTGCCTGGCAGAAGGCCCTGGGG - Intronic
1118764298 14:68899733-68899755 GTCCCGGGCTTCATGCCCATTGG - Intronic
1119598650 14:75959266-75959288 GTCAGGGGCTCCAGGTCCTGGGG + Exonic
1121850526 14:97218356-97218378 GTCCTGGTCTGCAGGGCCCGGGG + Intergenic
1122804168 14:104248279-104248301 GCCCAGGCCTCCAGGCCCTGGGG + Intergenic
1122930063 14:104929006-104929028 GTCTCGGGCACCAGGCCCGGGGG + Intronic
1123716703 15:23039183-23039205 GTCCCGGGTAACACGCCCTGTGG + Intronic
1124604284 15:31159428-31159450 GGCCCGGGCTGCACGGCCAGTGG + Intronic
1125722568 15:41852270-41852292 CTCCCGGGCTTCAGCTCCTGTGG + Exonic
1125736734 15:41932322-41932344 GACCCTGCCTGCAGACCCTGGGG - Intronic
1125756446 15:42068769-42068791 GTGCCATCCTGCAGGCCCTGAGG - Exonic
1126362563 15:47861326-47861348 TTCACAGGCTGCAGCCCCTGGGG + Intergenic
1126725063 15:51623088-51623110 CTCCCGGGCTGTAGCCGCTGCGG + Intergenic
1128173134 15:65530505-65530527 GTGCCGGGTTGCAGGCGCTCAGG + Exonic
1128729229 15:70009532-70009554 GACCAGGGCTGCAGCTCCTGTGG + Intergenic
1131252102 15:90837692-90837714 GTCCAGGCCTCCAGGCCCAGTGG + Intergenic
1132018439 15:98339361-98339383 GTCCCAGGATCCAGGGCCTGCGG + Intergenic
1132466380 16:79133-79155 GGCCCAGGCTGCATGACCTGGGG - Exonic
1133110365 16:3544474-3544496 GCGGCGGGCTGCAGGGCCTGTGG - Intronic
1134548981 16:15130558-15130580 TGCCCGGGTTACAGGCCCTGTGG - Intronic
1135712545 16:24729896-24729918 GCCGCGGGTTGCGGGCCCTGCGG - Intronic
1136403603 16:30031069-30031091 GTGCCGGGCGGCAGGGACTGGGG - Exonic
1137334524 16:47534129-47534151 CACCCGGGCTGCATGCTCTGTGG - Intronic
1137734921 16:50716720-50716742 TTCCCAGGCTGCACGACCTGGGG - Intronic
1138328113 16:56191917-56191939 GGCGCGGACTGCAGGCACTGAGG - Intronic
1139367371 16:66441769-66441791 TTCCATGGCTGCAGGCCCTGGGG + Intronic
1139528134 16:67528933-67528955 TTCCGGGGCTGCAGGCCGGGCGG + Intronic
1141448528 16:84080498-84080520 GACCTGAGCTGCTGGCCCTGTGG - Intronic
1141756840 16:85996994-85997016 GCCAGGGACTGCAGGCCCTGGGG - Intergenic
1141948749 16:87327266-87327288 CTCCCGGTCAGCAGCCCCTGAGG + Exonic
1141981084 16:87550874-87550896 GCCCAGGGCTGCAGACGCTGGGG - Intergenic
1142213882 16:88821571-88821593 CTCCTGGGCTGCAGCCCCTCAGG - Intronic
1145998997 17:29120424-29120446 ATCCAGGGCAGGAGGCCCTGAGG + Intronic
1147141155 17:38461274-38461296 GGGCAGGGCTGCAGGGCCTGGGG + Intronic
1147384277 17:40072338-40072360 GCCCCGGGGAGCAGGTCCTGGGG - Intronic
1147597697 17:41727418-41727440 GTTCCCAGCTGCAGGACCTGCGG - Intronic
1147970767 17:44218477-44218499 GAGCCGGGCTGCAGGGGCTGGGG - Intronic
1147976919 17:44253170-44253192 GATCTGGGCTGCAGCCCCTGGGG + Exonic
1148736849 17:49869776-49869798 GTCCGGGGCTGCAGTGCCAGTGG - Intergenic
1148800304 17:50220989-50221011 GTCCTGAGCGGCAGGGCCTGGGG - Intergenic
1151351261 17:73533478-73533500 GTCCCTGGACACAGGCCCTGAGG + Intronic
1151728420 17:75897284-75897306 GACCTGGGCTGAAGGCCCAGGGG - Intergenic
1151815838 17:76471013-76471035 CTCCCTGGGAGCAGGCCCTGGGG + Exonic
1151879056 17:76883957-76883979 GTGCTGGGCTGCTGGCCATGGGG + Intronic
1151900211 17:77007428-77007450 GGTCCGGCCTGCAGGCCATGTGG - Intergenic
1152448967 17:80364318-80364340 GACCCGGGGTCCAGGCCCAGCGG - Intronic
1152633968 17:81422989-81423011 CTCCCTGGCTGCCGGGCCTGTGG + Intronic
1152740540 17:82016581-82016603 CTCCCGGGCAGCTGGCTCTGAGG - Intronic
1152748967 17:82053802-82053824 GACCCTGGCCCCAGGCCCTGAGG - Intronic
1152778891 17:82217828-82217850 GTCACTGGCTGCGGGGCCTGCGG + Intergenic
1153799582 18:8657647-8657669 GCCCCAGGCTGCAGGCACAGGGG + Intergenic
1154078911 18:11234837-11234859 GCCCCGAGGTGCAGGGCCTGTGG - Intergenic
1157480820 18:48052531-48052553 GTCCATTGCTGCTGGCCCTGGGG + Intronic
1157525393 18:48376621-48376643 CCTCCAGGCTGCAGGCCCTGGGG - Intronic
1160329267 18:77977370-77977392 GTGCCTGTCTGCAGTCCCTGGGG + Intergenic
1160340364 18:78084225-78084247 TGCCCTGGCTGAAGGCCCTGGGG + Intergenic
1160835230 19:1121873-1121895 GTCCTGGGAGGCTGGCCCTGTGG - Intronic
1160867805 19:1263401-1263423 GTCTGTGGCTGGAGGCCCTGGGG - Intronic
1160929447 19:1563249-1563271 GTTCCTGGCTGCAGCCCCAGAGG - Intronic
1161021512 19:2013652-2013674 GTCCGGGGCTGGAGGGGCTGTGG + Intronic
1161631774 19:5360528-5360550 CTCCCGGGCTGCAGCCTGTGAGG + Intergenic
1162022104 19:7872685-7872707 GTCCCGGGCTGCGGGCACCGAGG - Exonic
1162105279 19:8366418-8366440 GTCCTGGCCTGGAGTCCCTGAGG + Intronic
1162135763 19:8554434-8554456 GGCCCGGGCAGCAGGGTCTGTGG + Intronic
1162342985 19:10102912-10102934 GTGGGAGGCTGCAGGCCCTGGGG + Intergenic
1162954742 19:14091446-14091468 GTCCCGGGCTGGACGCCGAGGGG + Intergenic
1162966838 19:14160151-14160173 ATGCCCAGCTGCAGGCCCTGCGG - Exonic
1163143514 19:15365487-15365509 GTGTAGGGGTGCAGGCCCTGTGG + Intronic
1163183929 19:15623225-15623247 GCACCAGTCTGCAGGCCCTGTGG - Exonic
1163187616 19:15650033-15650055 GCACCAGGCGGCAGGCCCTGCGG - Exonic
1163189634 19:15667091-15667113 GCCCCAGGCGGCAGGCCCTGTGG - Intergenic
1163191970 19:15683613-15683635 GCACCAGGCGGCAGGCCCTGTGG - Exonic
1163201258 19:15771113-15771135 GCACCAGGCGGCAGGCCCTGCGG + Intergenic
1163217181 19:15889551-15889573 GCACCAGGCGGCAGGCCCTGCGG + Exonic
1163229600 19:15992242-15992264 GAACCAGGCAGCAGGCCCTGCGG + Intergenic
1163460841 19:17436605-17436627 CTCCAGGGCTGCAGGTGCTGTGG + Exonic
1163559385 19:18009936-18009958 GCCCCGGGCAGCGGGCGCTGTGG + Exonic
1163687347 19:18719334-18719356 GGCACCTGCTGCAGGCCCTGGGG - Intronic
1165349754 19:35269213-35269235 GCCCCGGCCTGCAGGCCGCGGGG - Intronic
1165828572 19:38719381-38719403 GGCCAGGGCTGCAGGCCGTGTGG - Intronic
1166351286 19:42199591-42199613 GCGCCCTGCTGCAGGCCCTGCGG - Exonic
1166365876 19:42278233-42278255 GACTGGGGCTGCAGGCCCTGGGG - Intronic
1166374011 19:42316851-42316873 GCCCCTGGCAGCAGGCCATGAGG - Exonic
1166561404 19:43734537-43734559 GTCCCAGGCTGTGGGACCTGGGG - Intronic
1167329370 19:48845405-48845427 CTCCCGGGCTTCCAGCCCTGAGG - Exonic
1167461079 19:49625063-49625085 GTGCCGGGCTGGAGGGGCTGAGG + Intronic
1167590385 19:50401680-50401702 GCCCCAGGCTGCAGGCCCCAAGG + Intronic
1168667651 19:58216874-58216896 GTCAAAGGCTGCAGGCCCTGGGG + Intergenic
925352144 2:3208880-3208902 TTCCCAGGCTGGAGGCCTTGTGG - Intronic
925705499 2:6681231-6681253 TTGCTGGGCTGCAGGCTCTGTGG + Intergenic
926101695 2:10122395-10122417 GACCAGGGCCGCAGCCCCTGAGG - Exonic
927811845 2:26184827-26184849 TCCCCGGCCAGCAGGCCCTGCGG - Exonic
927854392 2:26518821-26518843 GGCCATGGCTGGAGGCCCTGTGG - Intronic
927888868 2:26735948-26735970 GTCCCTGCCTGCAGGACCTTGGG - Intergenic
929492249 2:42407486-42407508 GGCCAGGGCTGCACACCCTGTGG + Intronic
929668697 2:43852875-43852897 GGCCCTGGCTGCTGGCCTTGGGG - Intronic
931170217 2:59795287-59795309 GACCCGAGATTCAGGCCCTGGGG + Intergenic
932570109 2:72934078-72934100 GCCCCGGGCTTCAAGCCCTGTGG - Exonic
934555333 2:95284142-95284164 GTCCAGGGCAGGGGGCCCTGAGG + Intronic
935072827 2:99710961-99710983 ATCCCAGACTGCAGCCCCTGCGG + Intronic
935947700 2:108301223-108301245 GTCCCAGGCTGCAGGCCATGGGG + Intronic
936088155 2:109483780-109483802 TCCCCAGGCTGCAGGCGCTGGGG + Intronic
937299832 2:120832403-120832425 GACCCGGGCAGCAGGGCCTGGGG + Intronic
939354300 2:141081276-141081298 GTCCTGGGCTGTATCCCCTGTGG + Intronic
940214387 2:151289525-151289547 GTCCCGGGCTGGAGAGCCGGGGG - Intronic
941318415 2:164024155-164024177 CTCCCGGGCTCCAGGCCCACTGG - Intergenic
942987853 2:182163590-182163612 GTCCAGTGGTGCAGGGCCTGTGG + Intronic
945506826 2:210652029-210652051 GTCTTGGGCTCCAGTCCCTGAGG + Intronic
946419734 2:219558000-219558022 GTCCCGGGCTGGCGCCCCCGTGG - Exonic
947605612 2:231483571-231483593 GTCCCGGGCTGCAGGCCCCGTGG + Intronic
1171011401 20:21511126-21511148 GTTCGGGGCTGAAGGCCCGGAGG + Exonic
1171033975 20:21702196-21702218 GACCCGGGATCCCGGCCCTGCGG + Intergenic
1173246294 20:41340111-41340133 CTCCCTGTCTGCAGGCACTGCGG - Intergenic
1174157366 20:48524551-48524573 GTCCTGGGCAGCTGGACCTGGGG + Intergenic
1174287721 20:49484070-49484092 CGCCCGGGCTGCAGGCGCCGCGG + Intergenic
1175388415 20:58611678-58611700 GGCCTGGGCTCCTGGCCCTGAGG + Intergenic
1175883912 20:62277383-62277405 GGCCCCGGGTGCAGCCCCTGGGG - Intronic
1175943887 20:62550045-62550067 CTCCCAGGCTGCAGGGCCGGGGG - Intergenic
1176115622 20:63430775-63430797 GTCCAGGGCAGGAGACCCTGAGG + Intronic
1176222784 20:63978046-63978068 GTCCCGGGCTGCAGGCCCTGTGG - Intronic
1179730186 21:43363432-43363454 GTCCCCTGCTGCAGGCTGTGGGG + Intergenic
1180083523 21:45497409-45497431 GTCCCCGTCAGCAGGCCATGTGG - Intronic
1180096209 21:45556208-45556230 TCCCCGGGCCGCAGGCCGTGAGG - Intergenic
1181002136 22:19992804-19992826 GGCTTGGGCTGCAGACCCTGCGG + Intronic
1182923639 22:34102934-34102956 GTCCTGGGCTCCAGACTCTGGGG - Intergenic
1183456316 22:37925089-37925111 GTCCCGTGCTGCAGGACCTGAGG - Intronic
1183490559 22:38113433-38113455 GACCTGGGCTACAGACCCTGAGG + Intronic
1184073789 22:42163315-42163337 GCCCCAGGCTGCAGGTGCTGAGG - Intronic
1184147541 22:42620112-42620134 GTTTCAGGCTGCAGGGCCTGAGG - Intronic
1184973935 22:48047600-48047622 GTCTCCGTCTGCAGGCTCTGAGG - Intergenic
1185013992 22:48333057-48333079 GGCCAGGCCTGGAGGCCCTGGGG - Intergenic
1185065686 22:48630755-48630777 GCCCCAGGCTCCAGGCGCTGGGG + Intronic
1185127129 22:49017542-49017564 GTCCCTGGGCACAGGCCCTGGGG + Intergenic
1185325536 22:50224111-50224133 AGCCCGGGCTCCAGGCCCAGGGG - Intronic
1185332140 22:50256630-50256652 TTGCCGGGCTTCAGGTCCTGGGG + Exonic
950469030 3:13173377-13173399 AGCCCGGGCTGCAGGTGCTGAGG - Intergenic
950829649 3:15860353-15860375 GTCTCGGCCTGCAGCCCCCGGGG - Intergenic
953559526 3:43975801-43975823 GGCCAGGGCTGCAGTCCCTCTGG + Intergenic
953626756 3:44578488-44578510 AGGCCGGGCAGCAGGCCCTGCGG - Intronic
953918628 3:46936870-46936892 CTCACAGGCAGCAGGCCCTGGGG + Intronic
953980642 3:47411250-47411272 GTCGTCGGCCGCAGGCCCTGCGG + Exonic
954256593 3:49411763-49411785 GTACCGGGCTGGCGGGCCTGGGG + Intronic
954794444 3:53154455-53154477 GTGCTGGGCTGCAGGGGCTGTGG - Intergenic
961300674 3:125920189-125920211 CTCCCGGCCAGCAGGCACTGCGG + Intergenic
961324469 3:126102135-126102157 GGCCTGGGCTTCAGGCTCTGAGG + Intergenic
961325326 3:126106041-126106063 GTGCCGGGCTGCAGCGCCGGGGG + Intronic
961340433 3:126213538-126213560 GCCCCAGGCGCCAGGCCCTGCGG - Intergenic
962751113 3:138435265-138435287 CTCCCGGGGCGCAGACCCTGGGG + Intronic
962786095 3:138769144-138769166 GGCCGGGGCTGCATGCTCTGTGG - Intronic
967978045 3:195046346-195046368 AGCCCTGGCTGCTGGCCCTGGGG - Intergenic
968268339 3:197379967-197379989 GTCCCTGCCTTCAGTCCCTGGGG + Intergenic
968655999 4:1778697-1778719 GTGGCGGGCAGCTGGCCCTGTGG - Intergenic
968785729 4:2621049-2621071 GTCCCAGCCTGCAGGACCTCAGG - Intronic
969297613 4:6279060-6279082 GCCCCCAGCTGCAGGCCCAGTGG - Intronic
972279480 4:37588337-37588359 GTCCCATGATTCAGGCCCTGAGG - Intronic
975405311 4:73981900-73981922 GCCCCGGGCTGCTGTTCCTGGGG - Exonic
976897401 4:90128244-90128266 GCCCCGGGCTGCGGGTGCTGAGG + Intronic
978041237 4:104065214-104065236 CTCACAGGCTGCAGGCTCTGAGG - Intergenic
978605686 4:110476614-110476636 GTCCTGGGCAGGAGGACCTGAGG - Exonic
980990593 4:139735496-139735518 CTCCCGGGCTGTCGGCCCTGGGG - Intronic
984778788 4:183505673-183505695 GCCCCGTGCCGCAGACCCTGCGG + Intronic
985537599 5:473654-473676 CTCCCGCGCTGCAGGGCCTGGGG - Intronic
985544824 5:504366-504388 GGCCCTGGCTGCAGCCCCGGGGG - Intronic
985630195 5:1009882-1009904 GTCCCGGGCTGGGGGTCCCGGGG + Intronic
985636404 5:1037943-1037965 GGCCCGGGCAGCAGGCTCCGAGG - Exonic
986132232 5:4942360-4942382 TGCCCAGGCTGCAGGGCCTGGGG + Intergenic
986351896 5:6887989-6888011 GTCCTGGGCTGTTGTCCCTGTGG + Intergenic
986674255 5:10169270-10169292 GTCCTGAGCTGCAGGCACTGTGG - Intergenic
987715185 5:21559282-21559304 GTCATGAGCTTCAGGCCCTGGGG - Intergenic
989492506 5:42074104-42074126 GTCCCGGGCTTCACCCACTGGGG + Intergenic
989632269 5:43497606-43497628 TTCACAGGCTGCAGGCACTGAGG - Intronic
990954548 5:61330408-61330430 GTCCCAGGCTGCAGGTCCCTGGG - Intergenic
992552034 5:77868248-77868270 GTGCCAGGCTGCTGCCCCTGTGG - Intronic
997293301 5:132753213-132753235 CTCCCTGGCTTCAGGCCCAGAGG - Exonic
997757991 5:136418511-136418533 GACCGGGGCTGCAGTCTCTGAGG + Intergenic
997965520 5:138353016-138353038 GGCCGGGGCTGCGGGGCCTGCGG + Intronic
998279236 5:140788594-140788616 GGCCTGGGCTGAAGGCCATGAGG - Exonic
998285030 5:140850799-140850821 GGCCCGGGCTGAAGGCCATGAGG - Exonic
999436293 5:151566107-151566129 GTCCCGGGGGGCAGGTCCTCTGG + Exonic
999628384 5:153544178-153544200 GTCACTGGCAGCAGGCCTTGGGG - Intronic
1001590454 5:172861060-172861082 GCCCCAGCCTGCAGGGCCTGTGG + Intronic
1002082587 5:176746256-176746278 GTCTGGGGCTGCAGGCACAGTGG + Intergenic
1002214427 5:177619933-177619955 GTCACAGGCTGCAGGCCCCTGGG + Intergenic
1002559624 5:180072303-180072325 CTCCCGGGCTCCACGCCCTGCGG - Intergenic
1002762248 6:210989-211011 CTCCAGGGCTGCACGCCCTCTGG + Intergenic
1003129950 6:3386853-3386875 GCCCTGGGGTGCCGGCCCTGTGG - Intronic
1006421798 6:33939109-33939131 GTCCCGGGTTGGATTCCCTGAGG - Intergenic
1006429698 6:33988163-33988185 GTCCTGGGACCCAGGCCCTGTGG + Intergenic
1006941780 6:37756422-37756444 ATCCCGGGCTGCAGGGCCTGGGG + Intergenic
1007605345 6:43113993-43114015 GTCCCCGGCCACAGGCCCCGGGG - Intronic
1008100017 6:47380177-47380199 GTCCCTCTCTGTAGGCCCTGAGG - Intergenic
1010781274 6:79947805-79947827 GTCCCGGGCATCGGCCCCTGCGG + Intergenic
1019287933 7:232920-232942 GGCTGGGGCTGCAGGCCCAGAGG - Intronic
1019622885 7:2001184-2001206 GACCTGGGCTGCAGGCCCTGGGG + Intronic
1019648134 7:2141827-2141849 GTCCCGGGAGCCAGGCCATGTGG - Intronic
1019659865 7:2218230-2218252 GTCCCAGGCCCCAGCCCCTGTGG + Intronic
1019892838 7:3960396-3960418 GTCCAGGGCTTCAGGTCCTGGGG - Intronic
1023048923 7:36234933-36234955 GGCCTGGGCTGGAGGCCATGGGG - Intronic
1025992013 7:66503855-66503877 GTCCCGGGAGGCAGTCCCTGGGG + Intergenic
1027224418 7:76235022-76235044 GGCCTGGGCCGCTGGCCCTGAGG - Exonic
1029531198 7:101126539-101126561 GTGGCTGGCTGCATGCCCTGTGG + Intergenic
1029595906 7:101537597-101537619 GCCCAGGTCTGCAGGCTCTGTGG + Intronic
1029598743 7:101551356-101551378 ATCCAGGGCTGCAGGCACTCAGG - Intronic
1030413646 7:109213255-109213277 GTCCTGGTCTGCTGGCTCTGGGG - Intergenic
1032279674 7:130490914-130490936 GTCCCGGGTTGGATGCCCCGCGG + Intronic
1033156127 7:138958459-138958481 TCCCCAAGCTGCAGGCCCTGAGG + Intronic
1033652684 7:143354536-143354558 GTCTCCTGCTGCAGGCTCTGGGG - Exonic
1033756560 7:144401556-144401578 GCCCCTGGCTGCAGGACCCGGGG - Exonic
1034098976 7:148435762-148435784 GTCCGGGGCTGCAGGTGCTGGGG - Intergenic
1034474354 7:151274150-151274172 CTCCAAGGCCGCAGGCCCTGAGG + Intronic
1035029485 7:155848246-155848268 GGCCCTGGCAGGAGGCCCTGAGG + Intergenic
1035266289 7:157691892-157691914 GGCCCGGGGTCCAGGGCCTGGGG - Intronic
1036380271 8:8232164-8232186 CTCCCAGGCAGCAGGCGCTGCGG + Intergenic
1037742217 8:21616734-21616756 GGACAGGGCTGGAGGCCCTGGGG + Intergenic
1037968145 8:23149681-23149703 GTCCCAGGGTGCAGGCGCTGGGG - Intronic
1038642641 8:29340117-29340139 GACCTGGGCTGCAGCTCCTGTGG - Exonic
1044614593 8:94126845-94126867 CTCCCAGGCTGGAGGCACTGGGG + Intergenic
1048953624 8:139516032-139516054 GGCCCAGGCTGCAGGCCCCCAGG + Intergenic
1049372813 8:142275825-142275847 GTGCCTGGCAGCAGTCCCTGTGG - Intronic
1049557328 8:143289526-143289548 GGGCGGGGCTGCTGGCCCTGCGG + Intergenic
1049591441 8:143464746-143464768 GAGCCGTGCTGCAGGCCCCGGGG + Intronic
1049657796 8:143806424-143806446 GGCCCGGGCTGGAGTCCGTGTGG - Exonic
1049767360 8:144361077-144361099 CTCCTGGGCTGCAGGCACTCAGG - Exonic
1053854472 9:42323655-42323677 CTCCCGTGCAGCAGCCCCTGTGG - Intergenic
1056935612 9:90913133-90913155 GTCCCTGCCTGCAGGGCGTGGGG + Intergenic
1057020933 9:91697341-91697363 GCCCTGGGCTGCAGGTCCTCTGG - Intronic
1057444203 9:95102707-95102729 GTCCTGGGCTGTCGGACCTGAGG - Intronic
1060471457 9:123951820-123951842 GGCCCAAGCTGCAGGCCCAGGGG - Intergenic
1060795963 9:126513546-126513568 TGCCTGGGCTGGAGGCCCTGAGG - Intergenic
1060976080 9:127766079-127766101 GGCCCAGGATGAAGGCCCTGAGG - Intronic
1061453395 9:130681137-130681159 GCCCCGGGCTGGGGGCGCTGAGG + Intronic
1061715373 9:132515328-132515350 GTCCAGGGCAGCTGGACCTGAGG + Intronic
1061734199 9:132641524-132641546 ATCCCGGACTGCAGAGCCTGAGG + Intronic
1062041261 9:134405297-134405319 CATCCAGGCTGCAGGCCCTGGGG - Intronic
1062476137 9:136728397-136728419 GGCCCTGGCTGCTGGCCCCGTGG - Intergenic
1062542009 9:137045754-137045776 GACCAGGCCTGCAGGGCCTGCGG + Intronic
1062560963 9:137141711-137141733 GTCCCGTGCTCCAGGCCCCCAGG + Intronic
1062600458 9:137316682-137316704 GCTCCGGGCTGCAGGGGCTGGGG + Intronic
1062631375 9:137464642-137464664 GTCCTGGCTTTCAGGCCCTGGGG - Intronic
1187419639 X:19122796-19122818 CTCCTGGGCTCCAGGCACTGCGG + Intergenic
1190042973 X:47086567-47086589 TTCCGAGGCTGCAGCCCCTGTGG - Intronic
1191735549 X:64384722-64384744 GCCCAGGGCTGCAGGGCCTTCGG + Intronic
1195668844 X:107452511-107452533 GCCCCAGGCTTCTGGCCCTGAGG + Intergenic
1196684301 X:118496844-118496866 GTCCAGGGATGGAGGACCTGGGG + Intronic
1196818773 X:119686357-119686379 GACCCGGAATGAAGGCCCTGGGG - Intronic
1196997675 X:121401938-121401960 ACCCAGGGCTGCAAGCCCTGAGG - Intergenic
1197996870 X:132386795-132386817 GTACCAGGCTGCAGGGCCTGTGG + Exonic
1199772472 X:150983673-150983695 GTTCCCGGCTGCGGCCCCTGGGG - Intronic
1200282021 X:154785098-154785120 GCCCCGAGCTGCAGTCCCTTTGG - Exonic
1200977780 Y:9230835-9230857 GTCCTGGGCTGCAGTGGCTGTGG + Intergenic
1202133031 Y:21632073-21632095 GTCCTGGGCTGCAGTGGCTGTGG - Intergenic