ID: 1176223086

View in Genome Browser
Species Human (GRCh38)
Location 20:63979276-63979298
Sequence ACCCGGCGGGCTTCGAGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 35}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176223086_1176223093 1 Left 1176223086 20:63979276-63979298 CCGCCGCTCGAAGCCCGCCGGGT 0: 1
1: 0
2: 0
3: 3
4: 35
Right 1176223093 20:63979300-63979322 CCGCCCCGCCCCCGTGCCTCTGG 0: 1
1: 2
2: 2
3: 62
4: 440
1176223086_1176223094 2 Left 1176223086 20:63979276-63979298 CCGCCGCTCGAAGCCCGCCGGGT 0: 1
1: 0
2: 0
3: 3
4: 35
Right 1176223094 20:63979301-63979323 CGCCCCGCCCCCGTGCCTCTGGG 0: 1
1: 1
2: 2
3: 32
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176223086 Original CRISPR ACCCGGCGGGCTTCGAGCGG CGG (reversed) Intronic
900366867 1:2315047-2315069 AACCGGCGGGCTACGTGCGGGGG + Intergenic
901019672 1:6249433-6249455 GCCCGGGGGGCTGCGCGCGGCGG - Exonic
910773455 1:90851773-90851795 ACCCGGCGGGCGTTGAGGAGCGG - Intergenic
913998089 1:143667875-143667897 AGCCGGCGGGGTTTGAGCGCCGG + Intergenic
918720229 1:187842985-187843007 ACTCGGCGGGTTTGGAGCGCAGG - Intergenic
920013678 1:202888686-202888708 CCCGGGGGGGCTTCGAGCGCGGG - Intronic
1076140881 10:128077790-128077812 ACCTGGAGGGCTTCGGGCTGGGG - Intronic
1076777207 10:132704506-132704528 TGCCGGCGGGCTGCGAGGGGTGG - Intronic
1090709518 11:129373183-129373205 ACGAGGCGGGCTTGGAGCTGGGG - Intergenic
1105577903 13:21670220-21670242 CCGCGGCGGGCTTCGGACGGTGG + Intergenic
1114265397 14:21070306-21070328 ACCCGGCGAGACACGAGCGGCGG + Exonic
1120881269 14:89416943-89416965 GCCCGGCGGGCATCGCTCGGTGG + Intronic
1123547023 15:21345219-21345241 ACCCTGCGGGCCTGGAGCGAAGG + Intergenic
1132551384 16:555217-555239 TCCGGGCGGGCCTCGGGCGGCGG + Intergenic
1132604205 16:786987-787009 ACCGGGCGGGCATCGTGCGTTGG - Intronic
1142136271 16:88453316-88453338 AACCCGCGGGCGGCGAGCGGCGG - Exonic
1143166412 17:4899323-4899345 GCCCGGGGGGCCTCGGGCGGCGG + Exonic
1146052866 17:29566982-29567004 CCCCGGCGGGCAGCGGGCGGCGG + Exonic
1153872664 18:9334872-9334894 ACCCGGCGGGGATCTAGGGGTGG + Exonic
1165772869 19:38388776-38388798 TCCGGCCGGGCTCCGAGCGGCGG - Intronic
932496708 2:72149102-72149124 CCCGGGCGGGCTGCGGGCGGCGG - Intergenic
934678562 2:96266435-96266457 ACCCTGCTGGCCTCGTGCGGCGG + Exonic
942240904 2:173964068-173964090 AGCCGGGGTGCTTGGAGCGGGGG - Intronic
947641600 2:231710362-231710384 GCCCGGCGGGCTTTGCGCGCGGG - Intronic
948207315 2:236168897-236168919 ACCCGGCGGGTTTCTGGCGGCGG - Intergenic
1174218131 20:48932808-48932830 ACCAGGCTGGCTTGGAGTGGAGG + Intronic
1175217491 20:57399245-57399267 ACCACGCAGGCTCCGAGCGGAGG + Intronic
1176223086 20:63979276-63979298 ACCCGGCGGGCTTCGAGCGGCGG - Intronic
1176238167 20:64063749-64063771 ACCCCGGGGGCTCCGAGAGGCGG - Intronic
1180194604 21:46185075-46185097 CCCCGTCGGGCTCAGAGCGGGGG - Intergenic
1184059685 22:42074352-42074374 GCCCGGCGGGCTCCGGGAGGAGG + Intronic
976608681 4:87007049-87007071 CGCCGGCGGTCTTCGAGCGTGGG + Intronic
1001035068 5:168291709-168291731 ACCCGGCGAGCTCAGAGCGGTGG + Intronic
1004989943 6:21125593-21125615 ACCCGGCGGGGGTGGGGCGGAGG + Intronic
1018960041 6:168441493-168441515 ACCCGGCCGGCTGCAAGAGGCGG - Intronic
1023607379 7:41942792-41942814 ACCCTGCGGGCTTCACGCGTGGG + Intergenic
1041167257 8:55102315-55102337 GCCCGGCGGGCGGCGGGCGGCGG + Intergenic
1050458758 9:5858882-5858904 ACCAGGCAGGCTTCAAGCAGTGG + Intergenic
1200128647 X:153829851-153829873 TCCCGGCGGGCCTGGAGCGTGGG - Intronic