ID: 1176226192

View in Genome Browser
Species Human (GRCh38)
Location 20:64001069-64001091
Sequence CCTCACAGAGTGAAGATGTC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 121}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176226189_1176226192 9 Left 1176226189 20:64001037-64001059 CCTGCACTGAGCCTTATTGGTCT 0: 1
1: 0
2: 0
3: 14
4: 131
Right 1176226192 20:64001069-64001091 CCTCACAGAGTGAAGATGTCTGG 0: 1
1: 0
2: 0
3: 7
4: 121
1176226185_1176226192 27 Left 1176226185 20:64001019-64001041 CCCTGTTGCGGCTTCCAGCCTGC 0: 1
1: 0
2: 1
3: 14
4: 194
Right 1176226192 20:64001069-64001091 CCTCACAGAGTGAAGATGTCTGG 0: 1
1: 0
2: 0
3: 7
4: 121
1176226190_1176226192 -2 Left 1176226190 20:64001048-64001070 CCTTATTGGTCTTATCTCTTGCC 0: 1
1: 0
2: 0
3: 10
4: 172
Right 1176226192 20:64001069-64001091 CCTCACAGAGTGAAGATGTCTGG 0: 1
1: 0
2: 0
3: 7
4: 121
1176226186_1176226192 26 Left 1176226186 20:64001020-64001042 CCTGTTGCGGCTTCCAGCCTGCA 0: 1
1: 0
2: 0
3: 6
4: 191
Right 1176226192 20:64001069-64001091 CCTCACAGAGTGAAGATGTCTGG 0: 1
1: 0
2: 0
3: 7
4: 121
1176226187_1176226192 13 Left 1176226187 20:64001033-64001055 CCAGCCTGCACTGAGCCTTATTG 0: 1
1: 0
2: 1
3: 13
4: 241
Right 1176226192 20:64001069-64001091 CCTCACAGAGTGAAGATGTCTGG 0: 1
1: 0
2: 0
3: 7
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176226192 Original CRISPR CCTCACAGAGTGAAGATGTC TGG Exonic
901787527 1:11634552-11634574 CCTCACAGAGGGAGTATGGCTGG - Intergenic
906217522 1:44052151-44052173 TCTCCAAGAGTGAAGATGACAGG - Intergenic
909693841 1:78441604-78441626 CCTAACAAAGTGAAGTTGTATGG - Intronic
910291936 1:85607754-85607776 GCTCACAGAGTGGAGATCACTGG + Intergenic
912747969 1:112261361-112261383 TCTTACAGAGTGAAAATGTCAGG - Intergenic
917995140 1:180430048-180430070 CTTCACAAATTGAAGATTTCAGG + Intronic
919629790 1:199949153-199949175 CTTCACTGTGTGAACATGTCTGG + Intergenic
924035827 1:239935723-239935745 TCTCAAAGTGTGAAGATTTCAGG + Intergenic
924669770 1:246111777-246111799 CCTCACATGGTGAAGTAGTCTGG - Intronic
1065626494 10:27634889-27634911 GCTCACAGATTCTAGATGTCAGG + Intergenic
1068015249 10:51507714-51507736 CTCCACACAGTGAAGATGACTGG + Intronic
1068568804 10:58606066-58606088 CCTCAAAGAGGAAAGTTGTCAGG - Intronic
1068953313 10:62800105-62800127 CCTCATAGAGTCAAGAGGTAGGG + Intergenic
1069713008 10:70501798-70501820 ACACACAGAGTAAAAATGTCTGG - Intronic
1073608907 10:104923735-104923757 GCTCACAGAGGAGAGATGTCTGG - Intronic
1074889554 10:117724060-117724082 CTCCACAGTGTGAAGCTGTCAGG - Intergenic
1075578286 10:123596855-123596877 AGGCACAGAGTGAGGATGTCTGG - Intergenic
1078386148 11:10894717-10894739 ACTCAAAGAGAGAAGATGTATGG + Intergenic
1078441254 11:11370738-11370760 AGTCACAGAGTGGAGATTTCTGG - Intronic
1080745278 11:35103218-35103240 CCTCAAAGATTGTAGATGTGTGG - Intergenic
1084213698 11:67635395-67635417 CCTCACAGAGTGATGCTGAGTGG - Intronic
1086334845 11:85790162-85790184 CATCAGAAAGTGAAGATGCCAGG + Intronic
1087829295 11:102801503-102801525 CCTAACAGAGAGAAAGTGTCTGG + Intergenic
1088786267 11:113184694-113184716 ACTCACACAGGGAATATGTCAGG + Intronic
1090819604 11:130329524-130329546 CCTCCCAAAGTGAAGATTACAGG + Intergenic
1091589771 12:1836243-1836265 CCTCAGAGTGTGAAGATGGTGGG + Exonic
1091877138 12:3944686-3944708 CCTGACAGAATGAAGAGGTGGGG + Intergenic
1096252381 12:50041367-50041389 CCTGACAGAGTGAGGAGGGCTGG + Intergenic
1099804374 12:87499159-87499181 CCTCACAGTGGGAAGAAGTTTGG - Intergenic
1101533727 12:105598296-105598318 ACTCACATAATGAAGAAGTCCGG + Intergenic
1103098168 12:118148657-118148679 CCTATCAGAGTGAACATGACTGG + Intergenic
1103281806 12:119764260-119764282 CTTCACATAGTGGAGTTGTCAGG + Intronic
1103342293 12:120227516-120227538 AATCATAGAGTGCAGATGTCAGG + Intronic
1104679609 12:130740342-130740364 ACACACAACGTGAAGATGTCCGG - Intergenic
1108216338 13:48188556-48188578 CTTCAAAGAGTGAAGGGGTCAGG + Intergenic
1117073239 14:52075055-52075077 CCTCACAGTGAGAAGATGGCTGG - Intergenic
1122330685 14:100910450-100910472 CCTCACAGTATGAAGAAGGCAGG + Intergenic
1123770494 15:23523517-23523539 GCTCACATAATGAAGATTTCCGG + Intergenic
1125937271 15:43648291-43648313 CATCACAAAGTGAAGATGCCTGG - Intronic
1125950119 15:43745397-43745419 CGTCACAAAGTGAAGATGCCTGG - Intergenic
1130683299 15:86014895-86014917 CCTCATAAAATGCAGATGTCTGG + Intergenic
1135308882 16:21390035-21390057 CCCCACAGAGTGAAGGGGTGGGG - Intergenic
1135612537 16:23881117-23881139 CATCACAGAGTGAAGAGGAGAGG - Intronic
1140887217 16:79255287-79255309 CCTCACAGAGGGACCATGACAGG - Intergenic
1141489240 16:84360760-84360782 CCAGACAGAGGGAAGAGGTCAGG + Intergenic
1142537452 17:628950-628972 CGTCACTGAGTGAACATGACTGG + Intronic
1144951674 17:18997764-18997786 ACTCACAGAGAGAAGCTCTCAGG + Intronic
1145289924 17:21534844-21534866 CCTCACAGAGTGGACAGGTGAGG + Exonic
1146617784 17:34370468-34370490 CCCCACAGAGCAAAGATGCCAGG + Intergenic
1147489614 17:40853222-40853244 CCTCACAGAATTAAGAATTCTGG + Intergenic
1151338405 17:73454588-73454610 CCTCACAGAGTGTGGCTGTCCGG + Intronic
1152274591 17:79348916-79348938 TCTCGGAGAGTGGAGATGTCGGG - Intronic
1158413715 18:57231191-57231213 CCTCACAGAGGGGAGGTGTTTGG - Intergenic
1158421109 18:57295255-57295277 CCTCACAAAGATAAGATGTTGGG - Intergenic
1158780173 18:60639473-60639495 CATCAGACAGTGAAGAAGTCTGG - Intergenic
1158932535 18:62335459-62335481 CCCCACACAGTTAAGATGACTGG - Intronic
1162940259 19:14005349-14005371 CCTCCCAGAGAGAAGGTGGCAGG + Intronic
1165532432 19:36415302-36415324 TCTTATAGAGTGAAGATGACTGG + Intronic
1166255250 19:41599756-41599778 CCTCACAGAGTGCACATCCCTGG + Intronic
929422199 2:41803786-41803808 CCTCACAGAATGGAGATCACAGG - Intergenic
930097967 2:47581420-47581442 CCCCACTGAGTGAAAATGCCAGG + Intergenic
930236404 2:48892804-48892826 GCCCTCAGAGTGAAGATTTCTGG + Intergenic
931826560 2:66006418-66006440 GCTTTCAGAGTAAAGATGTCAGG - Intergenic
932581612 2:72995906-72995928 GCTCACTGTGTGAAGACGTCAGG + Intronic
936485919 2:112925618-112925640 CTTCATGGGGTGAAGATGTCAGG + Intergenic
936613351 2:114023554-114023576 CCTCACATAGTGTATATGTGAGG + Intergenic
940770795 2:157837686-157837708 ACTCACAGAATGAAGTTGGCTGG - Intronic
942591194 2:177548589-177548611 CCACACAGAGTCAAGAAGTCTGG - Intergenic
944352444 2:198744891-198744913 CCTCACCCAGTGAAGCTGTGTGG - Intergenic
947925533 2:233918917-233918939 GCTCAAAGAGTGGAGATGGCTGG + Intronic
1170014950 20:11769862-11769884 CATCACAGAGTGAGGGAGTCCGG - Intergenic
1170812418 20:19684918-19684940 CCTCCCAGATGGAAGTTGTCTGG + Intronic
1171218385 20:23370407-23370429 GCTCAAAGAGTGAAGCTGTGTGG - Exonic
1173965804 20:47111778-47111800 CTTCAGAGGGTGAAGATGTAAGG + Intronic
1176226192 20:64001069-64001091 CCTCACAGAGTGAAGATGTCTGG + Exonic
1183600292 22:38835949-38835971 CCTCACAGAGTGAAGAAGGTGGG - Intronic
950166454 3:10804012-10804034 CCTCCCACAGTGAATATGACTGG + Intergenic
960130009 3:114045676-114045698 CCCCACAGAGAGAAGCTGGCGGG - Intronic
960292949 3:115908560-115908582 CATCACAGAGTAAAAAGGTCAGG - Intronic
961079526 3:124014227-124014249 CCTGGCAGATGGAAGATGTCTGG - Intergenic
962814690 3:138987634-138987656 CCAAACAGAGTGAAGGAGTCTGG - Intergenic
963404975 3:144852528-144852550 ACTCACAGGTTGAAAATGTCTGG + Intergenic
965497008 3:169411539-169411561 CCTCTCAGAGTGCGGACGTCAGG - Intronic
969368236 4:6712924-6712946 CCTAACACAGTGATGATATCAGG - Intergenic
972025551 4:34371880-34371902 CCTGACACAGTGCAGATGGCTGG + Intergenic
979989334 4:127355925-127355947 CGTCACAGAGTGATTATGGCAGG - Intergenic
982560632 4:156924954-156924976 CCTCACACAGTGAAAGAGTCAGG + Intronic
982760363 4:159275877-159275899 CTTCACAGAGTAAAAGTGTCTGG - Intronic
985135235 4:186779288-186779310 CCTCAACGCGTGAAGATGACAGG - Intergenic
988847383 5:35141911-35141933 CCTCACAGAGTGGAGGAGACGGG - Intronic
994362782 5:98873369-98873391 CCTCCCAGACAGAAAATGTCAGG + Intronic
994941314 5:106327398-106327420 ACTCACATAGTGAAGTTTTCTGG - Intergenic
997889200 5:137660089-137660111 CCTCTCAGAGTGAACACCTCTGG - Intronic
1001111577 5:168901037-168901059 CATCACAGGGTGATGAAGTCAGG - Intronic
1001120756 5:168978085-168978107 CCACACAGAGGGAAGACTTCTGG + Intronic
1001542684 5:172550472-172550494 CCCCACAGAGGCAAGATGGCTGG - Intergenic
1001763590 5:174227081-174227103 CCTCACAGAGGGAAGTTGGGAGG - Intronic
1010253829 6:73735511-73735533 CCTAACAAAGTTAAAATGTCAGG + Intronic
1011998799 6:93627238-93627260 CATCAGAGAGTGAAGATCACAGG - Intergenic
1014960951 6:127683827-127683849 CCTCAAAAAGTGAAAATGTGGGG + Intergenic
1018723996 6:166596792-166596814 CCTCACAGAGTGTATTAGTCAGG - Intronic
1019191511 6:170253701-170253723 CTTCAGCGAGTGCAGATGTCAGG - Intergenic
1020428292 7:8094250-8094272 CCTTACAGTGTGAGGATGTTGGG - Intronic
1022392850 7:29958535-29958557 CCACACTGAAAGAAGATGTCAGG - Intronic
1022882398 7:34601714-34601736 TCTCACTGAGTGAAGAGGTGAGG - Intergenic
1024318076 7:48040036-48040058 CCCCACAGAGAGAAGAGATCTGG - Intronic
1027847763 7:83405181-83405203 GATTACAGAGTGAAGATATCAGG + Intronic
1029866035 7:103630080-103630102 CTTCCCAGAGAGAAGATGTATGG - Exonic
1030424417 7:109356047-109356069 CCTCAGATAGAGAAGATATCGGG - Intergenic
1032907747 7:136391181-136391203 CCTCACACAGTGAACTTGTTTGG - Intergenic
1036129651 8:6097376-6097398 CCTCACAGAGGGATGAGGGCAGG - Intergenic
1037657214 8:20895212-20895234 CCTCTCTGAGTGCAGATCTCTGG + Intergenic
1038348538 8:26755304-26755326 CCTGACAGAGTGACCATGTTTGG - Intronic
1041722165 8:60985505-60985527 CTGCACAGAGTCAAGATGACAGG - Intergenic
1045254237 8:100506290-100506312 ACTCACAGAGCTAAGGTGTCGGG - Intergenic
1046909468 8:119610045-119610067 GCACACAGAGTGAAAATGACAGG + Intronic
1047228052 8:122973206-122973228 AACCACAGAGTCAAGATGTCAGG - Intronic
1051847441 9:21467998-21468020 TCTCACAGATTGAAGAAGACAGG - Intergenic
1056008982 9:82305314-82305336 CCTCACAGAGTGCTGTTTTCAGG - Intergenic
1058980056 9:110160656-110160678 CCTCAGAAAGTGAAGATGATGGG + Intronic
1059284845 9:113163355-113163377 CCTCAAAGACAGAAGAGGTCAGG - Exonic
1062455039 9:136632164-136632186 ACTGACAGAGTGAACGTGTCAGG + Intergenic
1062455063 9:136632333-136632355 ACTGACAGAGTGAACGTGTCAGG + Intergenic
1185690963 X:2154949-2154971 CCTCAGAGAGGGAGGATGTAAGG + Intergenic
1187674805 X:21705436-21705458 CTTCACAGTGTGAAGATTTGAGG - Intergenic
1190491223 X:50984081-50984103 CCACACAGAGAGAAGGAGTCAGG - Intergenic
1193632329 X:83905360-83905382 CCACTAAGAGTGAAGATGTTGGG + Intergenic
1200972077 Y:9163582-9163604 CTTCACAGAGTGAAGAGCCCTGG - Intergenic
1202138947 Y:21700709-21700731 CTTCACAGAGTGAAGAGCCCTGG + Intergenic