ID: 1176229367

View in Genome Browser
Species Human (GRCh38)
Location 20:64023960-64023982
Sequence CCACACAGTGTGATTGTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 191}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176229362_1176229367 13 Left 1176229362 20:64023924-64023946 CCTCTGGAGAGCACGGTTGCTTT 0: 1
1: 0
2: 0
3: 8
4: 83
Right 1176229367 20:64023960-64023982 CCACACAGTGTGATTGTGTGTGG 0: 1
1: 0
2: 0
3: 12
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176229367 Original CRISPR CCACACAGTGTGATTGTGTG TGG Intronic
900503008 1:3015861-3015883 CCAGGCTGTGTGATTTTGTGAGG + Intergenic
901908727 1:12437045-12437067 TCACACCGTGTGTGTGTGTGTGG + Intronic
903528717 1:24013110-24013132 TCACACAATGTGATTGTATTTGG + Intergenic
905699947 1:40004499-40004521 CAAGACAATGTGATTGGGTGGGG + Intergenic
908999772 1:70204844-70204866 CCACACAGAGTGTTTGAATGTGG - Intronic
909850470 1:80455718-80455740 CCTCCCAGTGTGTATGTGTGTGG + Intergenic
910773799 1:90854815-90854837 CCACCAAATGTGATTATGTGGGG - Intergenic
911229362 1:95344535-95344557 ACCCACAGTGTGATGGTGTTTGG + Intergenic
913356254 1:117925612-117925634 CCTCACTGTGTAATTGTGTGTGG - Intronic
916272174 1:162955068-162955090 CCACACAAAATGATTGTTTGAGG + Intergenic
918484602 1:185016091-185016113 CCACACATTGGGAATGTGTTGGG - Intergenic
919259478 1:195173388-195173410 CCTCACAGTATGGTTGTTTGAGG + Intergenic
919723110 1:200862037-200862059 CAACACATTCTTATTGTGTGGGG - Intergenic
920562079 1:206946185-206946207 GCAGACTGTGTGACTGTGTGTGG - Intronic
920597164 1:207283696-207283718 CCATACAGTGAGAGTGAGTGAGG - Intergenic
924385742 1:243496720-243496742 CCCCACAGTGTGGTTGCCTGGGG + Intronic
1063686716 10:8243686-8243708 GCACTCAGTGTGATGGTTTGGGG + Intergenic
1065150480 10:22817611-22817633 CCCCCCAGTGTGACTGTGTCTGG - Intergenic
1066483986 10:35826049-35826071 CCACACAGTGTGACAGTGCAAGG - Intergenic
1067165290 10:43861911-43861933 CCACGCATTGTGGTTGGGTGAGG + Intergenic
1067330112 10:45307426-45307448 CCACTTATTGTGATTGGGTGGGG + Exonic
1067924691 10:50496421-50496443 GTACACAGTGTGATTCTGTCTGG - Intronic
1067991858 10:51222991-51223013 TTACTCAGTGTGTTTGTGTGTGG + Intronic
1068033560 10:51732322-51732344 CCTCACACTGTGACTGTATGTGG - Intronic
1070451423 10:76561337-76561359 CCACACTGTTTCATTGTGTTGGG - Intergenic
1071253864 10:83849273-83849295 CCAAACATTTTGATTGAGTGGGG - Intergenic
1071479637 10:86055369-86055391 CCACCCAGTGTGATGGTATTTGG + Intronic
1071553679 10:86586219-86586241 CCACACAGTGAGAAAGTGTCAGG - Intergenic
1075837232 10:125464769-125464791 GCACACAGTGTGATCGTGGAGGG - Intergenic
1076163539 10:128264353-128264375 CCACATACTGTGATTTTCTGAGG - Intergenic
1077418016 11:2434488-2434510 CCGCACTGTGTGTGTGTGTGTGG + Intergenic
1079106933 11:17577815-17577837 TCACGCAGTGTGAATGTGCGGGG + Intronic
1079394108 11:20046695-20046717 CCACCCAGTGTGAAAATGTGGGG - Intronic
1083164859 11:60877585-60877607 CTGCACAGTGGGATTGGGTGGGG - Intergenic
1086432618 11:86749782-86749804 CCTGACAATATGATTGTGTGTGG - Intergenic
1089499118 11:118922465-118922487 CCCCACGGTGTGTTTGTGGGTGG + Intronic
1089534701 11:119153902-119153924 CTACTCAGTGTGATTGGGTTAGG - Intronic
1090183250 11:124718922-124718944 TTACACAGTGGGGTTGTGTGGGG + Intergenic
1090611792 11:128477992-128478014 CCACACAGTGTGTTAGAGTTGGG + Intronic
1096602677 12:52741660-52741682 CAAGACAGTGTGTGTGTGTGTGG - Intergenic
1096787219 12:54024097-54024119 CCAAATAGTGTGATTATGAGGGG + Intronic
1097239140 12:57562907-57562929 TCGCACAGTGAGATTGTGTTAGG - Intronic
1101731958 12:107434048-107434070 ACCCACAATGTGATGGTGTGAGG - Intronic
1102450650 12:113039497-113039519 ACCCACAGTGTGATGGTGTGAGG - Intergenic
1104119946 12:125789549-125789571 ACACCCAGTGTGATGGTATGAGG + Intergenic
1104412413 12:128570219-128570241 GACCACAGTGTGAGTGTGTGGGG - Intronic
1104700531 12:130900288-130900310 CCTCAGAATGTGATTGTGTTTGG + Intergenic
1104858931 12:131914871-131914893 CCACACAGTGGGTGTGTGGGAGG - Intronic
1108394927 13:49982704-49982726 TCACACATAGTGATTGTGTGTGG - Intergenic
1110385467 13:74905828-74905850 CCACACAAGCTGATTGTGTGGGG + Intergenic
1111806507 13:93044847-93044869 CCACATGGTGACATTGTGTGGGG + Intergenic
1112487330 13:99831832-99831854 CCAGACAGGTTGATTGAGTGTGG - Intronic
1113090072 13:106608534-106608556 CCTCACATAGTTATTGTGTGTGG - Intergenic
1113529534 13:111011994-111012016 CCTCACAGTGTGACTTTGTAGGG + Intergenic
1114646805 14:24260513-24260535 CCCCAGCGTCTGATTGTGTGCGG + Exonic
1116870548 14:50065719-50065741 CTTCAGAGTGTGACTGTGTGGGG - Intergenic
1116870789 14:50067655-50067677 CCTCAGAGTGTGACCGTGTGGGG - Intergenic
1118778499 14:68989889-68989911 CCACACATTGTGATCTTCTGTGG - Intergenic
1122943210 14:104992572-104992594 CCTGACTGTGTCATTGTGTGAGG + Intronic
1124242354 15:28039634-28039656 CCACAATGTGTGAATGTGTTTGG + Intronic
1124830996 15:33148975-33148997 CCACCTAGAGTGCTTGTGTGTGG - Intronic
1127786597 15:62360939-62360961 CCACCCTGTGTGTGTGTGTGAGG - Intergenic
1128161504 15:65425767-65425789 GCACACATTGTGATTGTGAGGGG - Intergenic
1134752433 16:16636632-16636654 CCACAAGGTGGGATTGAGTGTGG - Intergenic
1138178360 16:54925068-54925090 GCACACAGTTTGCTTGTATGTGG - Intergenic
1138464771 16:57181436-57181458 CAACACAGTATAATTCTGTGAGG + Intronic
1139200814 16:64974999-64975021 CCACATAGTGAGATTCTGTTTGG - Intronic
1139369140 16:66455111-66455133 CCACTCAGAGTGTTTCTGTGAGG - Intronic
1140214056 16:72993254-72993276 CCATACAGGGTGCTTGGGTGAGG - Intronic
1140256657 16:73342876-73342898 CAACACAGTGACACTGTGTGGGG + Intergenic
1140815657 16:78618571-78618593 CCTCACAATGTGACTGTGTTTGG - Intronic
1142238253 16:88932947-88932969 CGACAGAGTGAGATTGTGTCTGG + Intronic
1144010274 17:11141597-11141619 CTTCCCAGTGTGATTGTATGTGG - Intergenic
1144209974 17:13005907-13005929 CCTCCCAGTGTGAGTGTGGGGGG - Exonic
1145819114 17:27817741-27817763 CCACAGAGTGTGACAGTGTTTGG + Intronic
1146918730 17:36695504-36695526 CAACACTGTGTGATAGGGTGGGG + Intergenic
1146948593 17:36890598-36890620 GCACACAGTGAGAGTTTGTGGGG - Intergenic
1147139465 17:38453274-38453296 CCACATAGGGTGAGTGTGTGTGG + Intronic
1149550183 17:57533960-57533982 GCACCCACTGTGATGGTGTGTGG + Intronic
1151443709 17:74149956-74149978 GAACGCAGTGTGAGTGTGTGTGG - Intergenic
1153146554 18:2039446-2039468 CCCCACAGTGGGATTGCCTGGGG - Intergenic
1157627027 18:49059647-49059669 CTACACAGTGTGGTGGTATGAGG + Intronic
1160385732 18:78495192-78495214 CCACACTCTGAGATTCTGTGTGG + Intergenic
1161593611 19:5140204-5140226 CCACACAGTGAGAGCCTGTGGGG + Intronic
1163774037 19:19207569-19207591 CGACCAAGTGTGATTGTGTGTGG + Intergenic
1166619379 19:44282505-44282527 CCAAGCAGTCTGATTGTCTGAGG - Intronic
1167404095 19:49292844-49292866 GCACATAGTGGGAGTGTGTGTGG - Intronic
1168477565 19:56687906-56687928 CATAACAGTGTGTTTGTGTGTGG + Intergenic
925901556 2:8512787-8512809 ACACTCAGTGTGGTTGTGTTTGG - Intergenic
925902173 2:8516475-8516497 TGACACAGTGTGAATGCGTGGGG - Intergenic
926379253 2:12268092-12268114 CCTCAGAATGTGATTGTGTTTGG - Intergenic
930217497 2:48711633-48711655 CAACACAGTATGTCTGTGTGAGG - Intronic
933038425 2:77430160-77430182 CCTCACATTGTTATTGTTTGTGG - Intronic
934872590 2:97880811-97880833 CCCCAAATTGTGGTTGTGTGCGG - Intronic
936764706 2:115832762-115832784 CCACAGATTGTGATTGAATGTGG + Intronic
938020967 2:127905574-127905596 CCCCACTGTGTGATTGTATTTGG - Intergenic
938218352 2:129543140-129543162 ACCCACAGTGTGATGGTGTTTGG + Intergenic
938905267 2:135830828-135830850 CCACACAGTGTGACTTTCAGAGG - Intronic
938950766 2:136252326-136252348 CCACTGAGTGTGTGTGTGTGTGG + Intergenic
939851484 2:147311293-147311315 CCACACAGTGAGAAGGTGAGAGG + Intergenic
942747402 2:179250718-179250740 CCTCAGAGTGTGATTGTATTTGG - Intronic
943711730 2:191104491-191104513 AAACACAGTGTGAGTCTGTGTGG - Intronic
944312280 2:198246926-198246948 CCTCCCAGTGTGATGGTGTTTGG + Intronic
946245019 2:218382532-218382554 CCACCCAGTGAGATTGAGTCTGG - Intronic
947472916 2:230414652-230414674 CCACACAGTATGCTTTGGTGTGG - Intergenic
948355531 2:237374365-237374387 TCACTCAGTGTCATTGTCTGGGG - Intronic
1170039039 20:12020769-12020791 ACATACAGAGTGATTGTGGGTGG - Intergenic
1170084168 20:12510568-12510590 CCTCACCCTGTGATCGTGTGAGG + Intergenic
1171092191 20:22295887-22295909 CAACACTGTGTGAATGTGTTAGG - Intergenic
1172880957 20:38199768-38199790 CCACAGGATGTGATTATGTGTGG + Intergenic
1172979723 20:38931782-38931804 ACACACTGAGTGATTCTGTGTGG - Intronic
1174091314 20:48050571-48050593 CTACACAGATTGACTGTGTGGGG - Intergenic
1174788252 20:53453530-53453552 CTCCATCGTGTGATTGTGTGTGG + Intronic
1175870390 20:62206584-62206606 ACACACAGGGTGATGGTCTGAGG - Intergenic
1176133164 20:63505662-63505684 CCACCCAGCGGAATTGTGTGTGG + Intergenic
1176229367 20:64023960-64023982 CCACACAGTGTGATTGTGTGTGG + Intronic
1177739254 21:25134154-25134176 CCACACACTGTGAAGGTATGAGG - Intergenic
1178604248 21:34021413-34021435 CCCCACAGTGAGATTGTATCTGG - Intergenic
1183144713 22:35979557-35979579 TCACTCTGTGTGTTTGTGTGTGG - Intronic
1183263913 22:36814138-36814160 CCACACAGTGTGATGGGCCGTGG + Intronic
1185090447 22:48765851-48765873 ACCCCCAGTGTGATTGTGTTTGG - Intronic
949146354 3:705261-705283 CAAGACAGTGAGATTGTTTGTGG + Intergenic
950171611 3:10842813-10842835 GCACACAGTCTGATTTTGTTTGG + Intronic
950497274 3:13341227-13341249 CCACACACTGAGCTGGTGTGGGG + Intronic
950574187 3:13821430-13821452 ACACACAGTGTGATTCTCTAGGG - Intronic
953610271 3:44442007-44442029 TCTCACAGGGTGATTGTGGGTGG - Exonic
954258366 3:49421741-49421763 CCACACAGAGTGACTGGGGGAGG - Intronic
955218994 3:57008397-57008419 CCAGACAGTGTGTTTCTGTTTGG - Intronic
960870677 3:122246792-122246814 TCACACAGTGTCTTTGTCTGAGG - Intronic
962824806 3:139091019-139091041 CTACACTCTGTGATTATGTGGGG + Intronic
963262189 3:143204210-143204232 CCACACAGTGAGGGCGTGTGTGG + Intergenic
964199380 3:154100960-154100982 GCACTCAGTATGATTGTGTTTGG - Intergenic
967033966 3:185633622-185633644 ACACACAGTGTGATTGTATATGG + Intergenic
968868753 4:3230322-3230344 CCACACACCGTGGTTCTGTGGGG - Intronic
969967642 4:11013699-11013721 TCACAGTGTGTGAGTGTGTGAGG + Intergenic
971346184 4:25813982-25814004 CCACACTGTGTGATTTTAGGTGG - Intronic
971578064 4:28302488-28302510 CTTCACCTTGTGATTGTGTGAGG - Intergenic
976364205 4:84214878-84214900 CTACTCAGTGTGATAGTGTTTGG - Intergenic
979350011 4:119632574-119632596 CCACAGAATGTGATTGTATTTGG + Intergenic
981746603 4:148058028-148058050 CCAAACAATGTGCTTGCGTGTGG + Intronic
983297416 4:165883447-165883469 CCACACATGGTTATTATGTGGGG - Intronic
983727425 4:170945895-170945917 CATCACCTTGTGATTGTGTGAGG - Intergenic
984117835 4:175704362-175704384 CCCCACATTGTGTGTGTGTGGGG - Intronic
986812571 5:11375946-11375968 ACACCCAGTGTGATGGTGTTAGG + Intronic
986860352 5:11920261-11920283 CCTCAGAATGTGATTGTGTTTGG - Intergenic
988694913 5:33612170-33612192 CCACACTGTTTGTTTGAGTGAGG - Intronic
990447208 5:55904142-55904164 CCACACAATGTGACTGTATTTGG - Intronic
996349787 5:122525818-122525840 CCAAACAGTGTAATTGTATATGG + Intergenic
997738520 5:136233049-136233071 CTCCCGAGTGTGATTGTGTGGGG + Intronic
998683289 5:144495382-144495404 ACACACACTGTCATGGTGTGGGG - Intergenic
998761642 5:145438927-145438949 GCACACTGTGTGATTATGGGTGG - Intergenic
1001150992 5:169227006-169227028 CCCCACACTGTGTTTGTGTCTGG + Intronic
1003399670 6:5781487-5781509 CCTCAGAGTGTGACTGTGTTTGG + Intergenic
1005277393 6:24234424-24234446 CCACACAGTCAGATTTTGTTTGG + Intronic
1010811949 6:80311033-80311055 CCACAATGTGAGATTGGGTGGGG - Intronic
1011548047 6:88502121-88502143 CCACTCCGTGTGTATGTGTGGGG - Intergenic
1011629822 6:89312443-89312465 CTTCACAGTGTGCATGTGTGAGG + Intronic
1012123013 6:95390620-95390642 CCACCAAATGTGTTTGTGTGTGG - Intergenic
1013459437 6:110360667-110360689 CCACACAGTGTTTTCCTGTGTGG + Intergenic
1015560613 6:134511241-134511263 CCACTCAATGTGATTGTGTCTGG - Intergenic
1016307939 6:142702893-142702915 CCAGGCAGTGTCACTGTGTGTGG - Intergenic
1017070179 6:150569200-150569222 CAACACAGAGTGAGTGTGCGTGG + Intergenic
1017854739 6:158340437-158340459 GCACACAGGGTGAGCGTGTGTGG + Intronic
1019572516 7:1719609-1719631 CCACAGACTCTGATTCTGTGAGG + Intronic
1021279951 7:18705422-18705444 CCACACACTGGGATAGAGTGTGG + Intronic
1021987072 7:26107232-26107254 ACCCACAGTGTGATGGTGTTAGG - Intergenic
1022460206 7:30597752-30597774 TCACACTGTGTGATTGTTTTTGG - Intronic
1022601808 7:31767936-31767958 CCACACAATGTGATGATGTTTGG - Intronic
1026353919 7:69540909-69540931 CCTCACAGTGTGATGGTATTTGG + Intergenic
1027595037 7:80162761-80162783 CCACACACTGGGATTTGGTGTGG + Intronic
1028744330 7:94310062-94310084 CCACAGAATGTGATTGTATTTGG + Intergenic
1029375016 7:100171945-100171967 CCCCCCAGGGTGACTGTGTGAGG - Intronic
1030072290 7:105708321-105708343 CCAAGCACTGTGATTCTGTGAGG + Intronic
1035063641 7:156089570-156089592 CCAGACAGTGTGGGTGTGTGGGG + Intergenic
1036087562 8:5629104-5629126 ACACACATTGTGTTTGTGTTTGG + Intergenic
1037344631 8:17885730-17885752 ACACTCAGTGTCATTCTGTGTGG - Intronic
1038741696 8:30222230-30222252 CCTCAGTGTGTGAGTGTGTGTGG - Intergenic
1038758918 8:30368192-30368214 CCACTGAGCATGATTGTGTGAGG + Intergenic
1041329854 8:56713288-56713310 ACACACAGTGTGTGTCTGTGGGG - Intergenic
1041353273 8:56971788-56971810 CCACACAGTAGCATTGTGGGGGG - Intronic
1041799935 8:61787767-61787789 CCACACATTGTGAAAGAGTGTGG + Intergenic
1041804663 8:61836861-61836883 CCAGACAGAGTACTTGTGTGAGG + Intergenic
1042526368 8:69768759-69768781 ACCCCCAGTGTGATTGTATGTGG - Intronic
1044713258 8:95076939-95076961 CCTCACAGTGTGACCGTATGTGG + Intronic
1044861954 8:96532662-96532684 CCTCACAGTGTGTTTTTTTGGGG - Intronic
1046006589 8:108493613-108493635 TCTTACATTGTGATTGTGTGTGG + Intergenic
1046323532 8:112610181-112610203 ACACACAGTGTAACTATGTGAGG + Intronic
1050570271 9:6931127-6931149 ACATAAAGTGTGTTTGTGTGGGG - Intronic
1051471954 9:17453595-17453617 CCTCACAGTGTCATTGGGTCAGG + Intronic
1055703476 9:78972045-78972067 CCACACATTGAGATTGTTTACGG - Intergenic
1055923957 9:81490853-81490875 CCTCACAGTGTTATTGTATGAGG + Intergenic
1056777706 9:89525823-89525845 CCAGACAGTGTGAGTGTGACTGG + Intergenic
1056818635 9:89820846-89820868 CCAAACCGTGAGCTTGTGTGTGG - Intergenic
1059431196 9:114251363-114251385 CCACATAGAGTGATAGAGTGTGG - Intronic
1059719093 9:116942115-116942137 CCACATTGTGTGTGTGTGTGTGG - Intronic
1060998071 9:127886153-127886175 CCAGAAAGAGAGATTGTGTGGGG - Exonic
1185986897 X:4845067-4845089 CCTCAGAGTGTGACTGTGTTTGG + Intergenic
1186032420 X:5384354-5384376 CCTCACCTTGTGATTGTGTGAGG - Intergenic
1190747899 X:53336912-53336934 CAAGACAGTGTGGTTGAGTGTGG + Intergenic
1191912012 X:66161343-66161365 CTAGACAATGTGATTGTGTCTGG - Intergenic
1191922628 X:66272712-66272734 CCTCCCAGTATTATTGTGTGGGG - Intergenic
1195391951 X:104371592-104371614 TCACATTGGGTGATTGTGTGGGG + Intergenic
1198745884 X:139890238-139890260 CAAAACAGTGTGGTTTTGTGTGG + Intronic
1199378439 X:147139388-147139410 CCCCACAATGTGATAGTATGTGG + Intergenic